ID: 1167056191

View in Genome Browser
Species Human (GRCh38)
Location 19:47112761-47112783
Sequence CGGAGAAAGCAGGCGGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 225}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167056191_1167056203 15 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056203 19:47112799-47112821 GTCACTCGCTCACTGGCGCGGGG 0: 1
1: 0
2: 1
3: 2
4: 32
1167056191_1167056206 27 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056206 19:47112811-47112833 CTGGCGCGGGGCCCTCATAGGGG 0: 1
1: 0
2: 2
3: 9
4: 61
1167056191_1167056205 26 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056205 19:47112810-47112832 ACTGGCGCGGGGCCCTCATAGGG 0: 1
1: 0
2: 0
3: 0
4: 33
1167056191_1167056202 14 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056202 19:47112798-47112820 GGTCACTCGCTCACTGGCGCGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1167056191_1167056204 25 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056204 19:47112809-47112831 CACTGGCGCGGGGCCCTCATAGG 0: 1
1: 0
2: 0
3: 4
4: 59
1167056191_1167056201 13 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056201 19:47112797-47112819 CGGTCACTCGCTCACTGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 44
1167056191_1167056194 -7 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056194 19:47112777-47112799 TTCTCCGCAGCCCACCCTTGCGG 0: 1
1: 0
2: 2
3: 12
4: 119
1167056191_1167056200 8 Left 1167056191 19:47112761-47112783 CCGCTCGCCGCCTGCTTTCTCCG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1167056200 19:47112792-47112814 CCTTGCGGTCACTCGCTCACTGG 0: 1
1: 0
2: 1
3: 23
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167056191 Original CRISPR CGGAGAAAGCAGGCGGCGAG CGG (reversed) Intronic
902955761 1:19923312-19923334 AGGAGAATGCAGGCTGGGAGGGG - Intronic
905027354 1:34859787-34859809 CCGAGAGAGCCGGCGGCCAGTGG - Exonic
905455096 1:38083237-38083259 CGGGGAAGGCAAGCAGCGAGGGG - Intergenic
905718173 1:40171317-40171339 CTGAGAAATCAGGCTGGGAGTGG - Intronic
905732010 1:40304101-40304123 TGGAGAAAGCGGGCAGTGAGGGG + Intronic
907850548 1:58250679-58250701 CGGAGAAGGGAGTCTGCGAGTGG - Intronic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
911041560 1:93594884-93594906 CTGAGAAAGGAGCCGGGGAGAGG - Intronic
913644735 1:120845127-120845149 CGGTGAAAGAAGCCGGGGAGCGG + Intergenic
914081992 1:144418456-144418478 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914095467 1:144540649-144540671 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914099112 1:144568373-144568395 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914176899 1:145286956-145286978 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914200045 1:145476248-145476270 CGGGGAAAGAAGCCGGAGAGCGG + Intergenic
914299875 1:146369291-146369313 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914303058 1:146393244-146393266 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914313484 1:146487436-146487458 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914479163 1:148049383-148049405 CGGGGAAAGAAGCCGGAGAGCGG + Intergenic
914500864 1:148245945-148245967 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914531627 1:148528448-148528470 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914636764 1:149559281-149559303 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914680306 1:149934236-149934258 CGGAAGAAGCAGGCAGCCAGAGG - Exonic
915112119 1:153570680-153570702 CGGGGGAAGCAGGAGGCTAGAGG - Intergenic
915348025 1:155207936-155207958 CGGAGAGAGCAGGAGCCGGGGGG + Intronic
915530499 1:156500044-156500066 AGGAGGGAACAGGCGGCGAGAGG + Intronic
920574733 1:207050973-207050995 CGGGGAAACCAGGCGCCGGGTGG + Exonic
923359763 1:233199389-233199411 GGGAGAAGGCAGGAGGAGAGAGG + Intronic
1064506864 10:16040779-16040801 AAGAGAAAGCAGGCCGAGAGTGG + Intergenic
1064604297 10:17022602-17022624 CGGAGAAACCGGAGGGCGAGAGG + Intronic
1065099819 10:22321673-22321695 CGGAAAGAGCAGCCGGCGCGAGG - Exonic
1069769552 10:70888559-70888581 CGGAGAGGGCAGGCGGCGGCCGG + Exonic
1070328815 10:75403999-75404021 CAGAGAAAGAAGCCGGGGAGGGG - Intergenic
1070668058 10:78359273-78359295 GGGAGAAAGCAGGCAGCCAGTGG + Intergenic
1070828210 10:79403510-79403532 CGGAGGAAGCAGGCGGTCAGAGG + Intronic
1072620587 10:97076517-97076539 TGGAGAGAGCAGGCAGGGAGGGG - Intronic
1075483241 10:122800022-122800044 CAGAGAAGGCAGGCGGCCATAGG + Intergenic
1076870470 10:133190475-133190497 AGGAGACGGCAGCCGGCGAGGGG + Intronic
1077410387 11:2401150-2401172 CGGCGAAAGCCGGCAACGAGTGG - Intronic
1078474569 11:11620272-11620294 GGAAGAAAGCAGGGGGCGCGGGG + Intronic
1079797583 11:24825416-24825438 TGGGGAAAGCAGGAGGAGAGAGG - Intronic
1079924320 11:26473996-26474018 TGGAAAAAGCAGGCGGTGAAAGG + Intronic
1081649856 11:44816677-44816699 CGGAGAAAGCAGGAGGACATGGG - Intronic
1081735648 11:45401579-45401601 AGGAGAATGCAGGGGGAGAGTGG + Intergenic
1084793368 11:71489051-71489073 CAGAGAGAGCAGGAGGGGAGGGG + Intronic
1085038437 11:73313201-73313223 CAGAGAGAGCAGGCAGGGAGTGG + Intronic
1085143419 11:74170865-74170887 CGGGGAACGCAGGCGCCGTGGGG - Exonic
1085228411 11:74943488-74943510 TGAAGAAAGCTGGAGGCGAGGGG + Intronic
1085263996 11:75225587-75225609 CAGAGAGAGCAGGAGGGGAGTGG - Intergenic
1085297240 11:75438109-75438131 AGGGGAAAGCAGGAGGCGGGGGG + Intronic
1089243092 11:117098329-117098351 CGGAGGCAGCAGGCGGCCCGCGG + Exonic
1089789473 11:120932336-120932358 AGGAGGAAACAGGCGGGGAGGGG + Intronic
1089910951 11:122100485-122100507 CGGAGAACGGGGGCGGGGAGGGG + Intergenic
1091795270 12:3294425-3294447 TGGAGAAAGAAGGCAGAGAGGGG + Intergenic
1096077514 12:48814675-48814697 TGGAGAAAGGAGGGGGAGAGGGG + Intronic
1096199561 12:49672071-49672093 GGGAGGAAGCAGGCGGTGAGGGG - Intronic
1096253714 12:50050636-50050658 CAGAGGGAGGAGGCGGCGAGGGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1101390354 12:104294239-104294261 CCGGGAAAGCCGGCGGCGGGGGG - Intronic
1101640067 12:106581410-106581432 GGGAGGAAGAAGGCGGCGCGCGG - Intronic
1102968680 12:117148751-117148773 AGGAGACAGCAGGCGGGGAGGGG + Intronic
1105804023 13:23939133-23939155 AGGGGAAAGAAGACGGCGAGTGG - Intergenic
1112749394 13:102566596-102566618 CAGATAAAGCAGGTGGGGAGGGG + Intergenic
1114547550 14:23513643-23513665 CGGAGATGGGAGGAGGCGAGTGG + Intergenic
1119613645 14:76084046-76084068 CGGAGGGAGGAGGCGGCGGGAGG + Intronic
1120723858 14:87916483-87916505 GGGAGAAAGGAGGCGGGGATGGG + Intronic
1120881744 14:89419020-89419042 CTGAGAAAGCAGGAGGGGACTGG - Intronic
1122160526 14:99781134-99781156 AGGAGAAGGGAGGCGGCCAGTGG - Intronic
1124227068 15:27903600-27903622 GGCAGGAAGCAGGGGGCGAGGGG - Intronic
1127349587 15:58137178-58137200 TGGAGAAAGCAGCTGGTGAGAGG - Intronic
1127674916 15:61229376-61229398 GGGAAAAAGCAGGCGGCGGCGGG + Intergenic
1129351785 15:74959536-74959558 GGGAGAGAGCGGGCAGCGAGCGG + Intronic
1130952581 15:88604564-88604586 CGGAGAAAGCGAGTGGAGAGGGG - Intergenic
1132431940 15:101767682-101767704 CAGAGAAAGGAGGCGGGGATGGG - Intergenic
1132555834 16:572279-572301 CAGAGAGGGCAGGCGGCGGGTGG - Intronic
1132560109 16:589737-589759 CCGGGAAAGCAGGAGGCGAGTGG + Intronic
1134121039 16:11585643-11585665 CTGAGAAGGCAGGGGGTGAGAGG + Intronic
1134134222 16:11668767-11668789 CGGACAAAGGAGGCGGCGGGGGG + Intronic
1137788329 16:51154542-51154564 GGTCGAAAGTAGGCGGCGAGCGG + Intergenic
1138105222 16:54284375-54284397 CGCAGAAAGCAGGAGTGGAGAGG + Intronic
1138574303 16:57897731-57897753 CTGGGAAAGAAGGCGGCCAGCGG - Intronic
1141153651 16:81582045-81582067 CGAAGAGAGCTGGCGGGGAGAGG + Intronic
1142671293 17:1488452-1488474 CGGAGAACGCAGGAGGCGCCTGG - Intronic
1147044912 17:37744895-37744917 CGGAAAAAGAAGGGGGTGAGGGG + Exonic
1148644044 17:49209206-49209228 AGGAGAAAGCAGGCGAAGCGGGG - Intronic
1148875045 17:50682085-50682107 AGGAGAAACCACGCGGCCAGAGG - Intronic
1149290502 17:55213721-55213743 GGGAGAAAGGAGGTGGCAAGTGG - Intergenic
1151752259 17:76046278-76046300 CAGAGGAAGCAGGGGGCGGGTGG + Intronic
1152872502 17:82764352-82764374 AGGAGAAAGCAGGCCGGGTGCGG + Intronic
1153515224 18:5895607-5895629 CGGGGAAGGCCGGCGGCGTGGGG - Intronic
1157901307 18:51520869-51520891 CAGAGACAGCAGGCTGGGAGGGG + Intergenic
1159951496 18:74487370-74487392 AGGGGAAAACAGGAGGCGAGGGG + Intergenic
1160726162 19:618697-618719 CGGAGACATCAGCCGGTGAGTGG - Exonic
1161491811 19:4566537-4566559 CTGAGCAGGCAGGCGCCGAGCGG - Intergenic
1161702649 19:5804010-5804032 CCAAGAACGCAGGCGGCGCGGGG + Intergenic
1161716801 19:5880772-5880794 TGGACAAGGCAGGCGGCCAGCGG + Intronic
1165511723 19:36270112-36270134 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165512272 19:36272613-36272635 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165512819 19:36275154-36275176 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165513375 19:36277709-36277731 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165513924 19:36280243-36280265 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165514477 19:36282780-36282802 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165515028 19:36285313-36285335 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165515579 19:36287849-36287871 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165516130 19:36290386-36290408 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165516680 19:36292912-36292934 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165517233 19:36295435-36295457 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165517785 19:36297970-36297992 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165518338 19:36300505-36300527 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165518888 19:36303037-36303059 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165519437 19:36305552-36305574 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165519985 19:36308080-36308102 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1165624082 19:37270501-37270523 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165624628 19:37273042-37273064 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165625171 19:37275569-37275591 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165625705 19:37278107-37278129 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165626246 19:37280635-37280657 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165626784 19:37283162-37283184 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165627326 19:37285680-37285702 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165627867 19:37288208-37288230 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165628404 19:37290732-37290754 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165628941 19:37293260-37293282 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165629487 19:37295783-37295805 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165630028 19:37298308-37298330 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165630571 19:37300836-37300858 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1165631105 19:37303377-37303399 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1166304997 19:41932521-41932543 AGGAGAAAGCAGGCAGAGAGGGG + Intergenic
1167056191 19:47112761-47112783 CGGAGAAAGCAGGCGGCGAGCGG - Intronic
1167353138 19:48988135-48988157 CAGAGAAAGGAGGCAGCGAGTGG - Intronic
1167464377 19:49642389-49642411 CGGCGAAACCTGGCGCCGAGAGG + Intronic
1168433839 19:56302447-56302469 GGGAGGAAGCAGACGGAGAGAGG - Intronic
1168666777 19:58210298-58210320 CTGAGAAAGCAGGAGGCAAGAGG + Intronic
927542684 2:23926944-23926966 CGGCGTGAGCAGGCGGCGTGCGG + Exonic
931232119 2:60383719-60383741 GGAAGAAAGCAGGCGGCGGCAGG + Intergenic
931671718 2:64653832-64653854 AGGAGGAAGCAGGAGGCGGGCGG + Exonic
933772588 2:85753751-85753773 CGGACAAAGGAGGCGGCCGGCGG + Intronic
938287730 2:130130920-130130942 GGAAGAAAACAGGTGGCGAGGGG + Intergenic
941773197 2:169364342-169364364 GGGAGGAGGGAGGCGGCGAGGGG + Intergenic
944154065 2:196592892-196592914 AGGAGAAAGCAGGCGGCCGGGGG + Intronic
946128838 2:217589036-217589058 CGAAGAAGGCAGGAGGGGAGAGG - Intronic
946391297 2:219418381-219418403 CGGAGAGTGGATGCGGCGAGGGG - Exonic
948588965 2:239037516-239037538 CGGAGAGAGGAGGCGGCTGGGGG - Intergenic
949049240 2:241888414-241888436 GGGAGGAAGCAGGCGGCGGGGGG - Intergenic
1168797386 20:620623-620645 TGGAGAACGCAGGCTGGGAGGGG + Intergenic
1169228378 20:3870324-3870346 GGGAGAAAGAAGGTGGAGAGGGG - Exonic
1173443186 20:43095904-43095926 GGGAGAAAGCGGGAGGAGAGAGG - Intronic
1173443215 20:43096024-43096046 GGGAGAAAGCGGGAGGAGAGAGG - Intronic
1174138626 20:48397833-48397855 AGGAGAAAGGAGGAGGTGAGAGG - Intergenic
1174261249 20:49297011-49297033 GGGAGAAATCAGGCTGAGAGAGG - Intergenic
1174611241 20:51800646-51800668 CGGAGGAAGCAGGCGGGCTGAGG + Intronic
1174611337 20:51801061-51801083 ATTAGAAAGCAGGCGGGGAGCGG + Intronic
1175108457 20:56630181-56630203 GGGAAGAAGGAGGCGGCGAGCGG + Intronic
1175721190 20:61288447-61288469 TGGAGAAAGCAGGTGGTCAGAGG + Intronic
1176237385 20:64059916-64059938 GGGAGAAATCAGGTGGGGAGCGG + Intronic
1182415332 22:30217743-30217765 TGGAGAAAGGAGGAGGCCAGTGG - Intergenic
1183297253 22:37037601-37037623 AAGAGAAACCAGGCGGGGAGGGG + Intergenic
1184640318 22:45866957-45866979 CTGAGGAAGCCGGCGGCGCGGGG + Intergenic
950940132 3:16884228-16884250 AGGAGACAGCAGCCGGCGGGTGG + Intronic
951717467 3:25664545-25664567 AGGAGAAAGCAGGGAGCGACCGG + Intronic
951981074 3:28567826-28567848 AGGAGACAGCAGTCGGCAAGGGG + Intergenic
953955388 3:47227897-47227919 CGGAGAGAGAAAGCGGGGAGGGG + Intergenic
954218901 3:49140327-49140349 CAGAGAAAGCAGGAAGGGAGAGG - Intergenic
955047260 3:55372121-55372143 GGGAGATAGCAGGTGGCTAGGGG - Intergenic
956809288 3:72848566-72848588 CGGAGAAAGGGCGTGGCGAGTGG + Intronic
961182168 3:124886328-124886350 AGGAGGAAGCAGGCGGGGGGCGG + Intronic
969321265 4:6414438-6414460 CGCAGAAAGCAGGAGGCTGGCGG + Intronic
969436569 4:7192525-7192547 CAGAGAAAGGAGCCGGCGAGGGG - Exonic
969534444 4:7747246-7747268 CTGAGAAACCAGGCGGTCAGAGG + Intergenic
977131121 4:93238601-93238623 AAGAGAAAGCAGGGGGTGAGGGG + Intronic
977809655 4:101345863-101345885 CGGAGGAAGCAGGCGGAATGAGG + Intronic
980354237 4:131723554-131723576 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980354776 4:131726060-131726082 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980355860 4:131731038-131731060 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980356395 4:131733529-131733551 CGGAAAAAGAAGCCGGCAAGGGG + Intergenic
980356935 4:131736017-131736039 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980357475 4:131738509-131738531 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980358014 4:131740998-131741020 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980358546 4:131743489-131743511 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980359088 4:131745962-131745984 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980359627 4:131748433-131748455 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980360168 4:131750925-131750947 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980360709 4:131753400-131753422 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980361252 4:131755880-131755902 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980361792 4:131758355-131758377 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980362335 4:131760835-131760857 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980362877 4:131763318-131763340 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
980377871 4:131975198-131975220 CGGAGAATGAAGCCGGCAAGGGG - Intergenic
980378405 4:131977674-131977696 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
981504144 4:145481891-145481913 CGGAGAAAGGAGAGGCCGAGCGG + Intronic
984714950 4:182917132-182917154 CGGAGAATGCGGGCGGGGTGGGG - Intronic
985493977 5:194166-194188 CTCAGAAAGCAGACGGCGGGGGG - Intronic
985493985 5:194216-194238 CTCAGAAAGCAGACGGCGGGGGG - Intronic
985548791 5:523047-523069 CGGAGAAGGGAGGAGGCGGGAGG + Intronic
985579981 5:691408-691430 CTGAGAAGTCAGGCGGGGAGGGG + Intronic
985594828 5:783467-783489 CTGAGAAGTCAGGCGGGGAGGGG + Intergenic
985841174 5:2307135-2307157 GGGAGAAAGCAGGAGGGGTGTGG - Intergenic
985923615 5:2998858-2998880 CAGAGACAGCAGGAGGGGAGAGG + Intergenic
987205863 5:15624975-15624997 GGGAAAAAGCAGGAGGGGAGGGG - Intronic
990845031 5:60127669-60127691 CGCAGTAAGCAGGCTGTGAGGGG + Intronic
991660416 5:68945431-68945453 TGGAGAAAGCAGGAGGCCAAAGG + Intergenic
993900406 5:93580648-93580670 CAGAGGCAGCAGGCGGAGAGAGG - Intergenic
996580821 5:125030294-125030316 CCGAGAAAGGAGTCGGCGAAGGG + Intergenic
997284301 5:132667524-132667546 GGGAGAGGGCAGGCGGCGGGTGG - Intergenic
998400381 5:141845744-141845766 CGGAGAAGACAGTCGGGGAGGGG - Intergenic
1002455911 5:179345287-179345309 GGGGCAGAGCAGGCGGCGAGCGG + Exonic
1002965387 6:1960968-1960990 TGGAAAAAGCAGGCGGAGACAGG + Intronic
1004177281 6:13350789-13350811 GGGAGAAACCAGCCGGGGAGAGG + Intergenic
1006177322 6:32130207-32130229 CGGAGAGGGCAGCCGGAGAGGGG + Exonic
1006932766 6:37697634-37697656 CGGCGAGCGGAGGCGGCGAGCGG - Exonic
1007232121 6:40355724-40355746 CTGAGAAAGGAGGCAGCGATGGG - Intergenic
1007370929 6:41426817-41426839 CGGAGAAAGCTGGGGGAGAAGGG + Intergenic
1008413627 6:51213866-51213888 CGAAGAAAGGAGGGGGCGGGGGG + Intergenic
1008562319 6:52735188-52735210 GGGAGAAAGAAGGCAGCCAGAGG - Intergenic
1024840012 7:53574836-53574858 CGGAGAAAGCCGGCAGCTACAGG - Intergenic
1024919950 7:54545572-54545594 GGGAGAAAGAAGGGGGAGAGAGG + Intronic
1026457123 7:70582397-70582419 CGGAGAATGCAGGCTGCTAGAGG - Intronic
1028417491 7:90596017-90596039 CGGAGGACGCGGGAGGCGAGCGG + Intronic
1029110367 7:98210844-98210866 CGGGGAAAGCGGGCGGGGGGAGG + Intergenic
1034466558 7:151233187-151233209 AGGAGACAGCAGGCGGGGACTGG - Exonic
1035455436 7:159005977-159005999 CTGAGAAAGCAGGCAGCGCGCGG - Intergenic
1035455470 7:159006129-159006151 CTGAGGAAGCAGGCAGCGCGCGG - Intergenic
1035455507 7:159006281-159006303 CTGAGAAAGCAGGCAGCGCGCGG - Intergenic
1035455523 7:159006357-159006379 CTGAGGAAGCAGGCAGCGCGCGG - Intergenic
1035455550 7:159006471-159006493 CTGAGGAAGCAGGCAGCGCGCGG - Intergenic
1035881411 8:3247341-3247363 AGGAGCAAGCAGGCGGGGAGGGG - Intronic
1037768041 8:21783766-21783788 AGGAGAGAGCAGGGGGCGCGGGG - Intronic
1037959352 8:23084452-23084474 AGGAGAGAGCAGGCGGTGGGAGG - Intronic
1039800522 8:40950667-40950689 TGGAGAAAGCAGAAGGTGAGAGG + Intergenic
1039935610 8:42041620-42041642 CGCAGACAGCAGGAGGGGAGAGG + Intronic
1042880222 8:73479443-73479465 GGGAGAAAGCAGGAAGAGAGAGG - Intronic
1047204037 8:122789136-122789158 TGGAGGAAGCAGGCGGAGGGAGG + Intronic
1049503991 8:142985184-142985206 GGGAGAAAGCAGACAGCAAGTGG + Intergenic
1049521901 8:143095609-143095631 AGGAGAAAGCTGGGGGCGAGGGG - Intergenic
1051355755 9:16238481-16238503 GGGATAAAGCAGGAGGAGAGAGG + Intronic
1053642884 9:40105604-40105626 CGGAGAAGGAAGCCGGCAAGGGG - Intergenic
1053763269 9:41359886-41359908 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1054541878 9:66271053-66271075 CGGAGAAGGAAGCCGGCAAGGGG + Intergenic
1056756259 9:89383860-89383882 CGGAGACAGGGGGCGTCGAGGGG - Intronic
1061087887 9:128409747-128409769 TGGGGAAAGCAGGCTGGGAGAGG - Intergenic
1062655934 9:137604797-137604819 CGGGGAAGGCAGGGGGCGGGGGG + Intergenic
1185641867 X:1592791-1592813 CGGAGAAAGAAGGCGCAGACGGG + Intronic
1186140667 X:6568487-6568509 AGGAGAAAGCAGGCAGGAAGCGG + Intergenic
1189771352 X:44430897-44430919 GGGAGAAAGCAGGAGGCAGGAGG - Intergenic
1195108531 X:101623367-101623389 CTTGGAAAGCGGGCGGCGAGTGG - Intronic