ID: 1167056305

View in Genome Browser
Species Human (GRCh38)
Location 19:47113139-47113161
Sequence TAGAGGCTGAGGCGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104212
Summary {0: 3, 1: 39, 2: 942, 3: 11583, 4: 91645}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167056291_1167056305 27 Left 1167056291 19:47113089-47113111 CCGCCGCAATCAGGAATTGACAC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG 0: 3
1: 39
2: 942
3: 11583
4: 91645
1167056292_1167056305 24 Left 1167056292 19:47113092-47113114 CCGCAATCAGGAATTGACACAAA 0: 1
1: 0
2: 1
3: 24
4: 239
Right 1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG 0: 3
1: 39
2: 942
3: 11583
4: 91645
1167056289_1167056305 29 Left 1167056289 19:47113087-47113109 CCCCGCCGCAATCAGGAATTGAC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG 0: 3
1: 39
2: 942
3: 11583
4: 91645
1167056290_1167056305 28 Left 1167056290 19:47113088-47113110 CCCGCCGCAATCAGGAATTGACA 0: 1
1: 0
2: 1
3: 6
4: 35
Right 1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG 0: 3
1: 39
2: 942
3: 11583
4: 91645
1167056288_1167056305 30 Left 1167056288 19:47113086-47113108 CCCCCGCCGCAATCAGGAATTGA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG 0: 3
1: 39
2: 942
3: 11583
4: 91645

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167056305 Original CRISPR TAGAGGCTGAGGCGGGAGGA AGG Intronic
Too many off-targets to display for this crispr