ID: 1167058761

View in Genome Browser
Species Human (GRCh38)
Location 19:47130427-47130449
Sequence ACATGGGGCTACAGAGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167058761_1167058766 15 Left 1167058761 19:47130427-47130449 CCTGTTACTCTGTAGCCCCATGT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1167058766 19:47130465-47130487 TCCAAAGCATTTATCATCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 86
1167058761_1167058768 16 Left 1167058761 19:47130427-47130449 CCTGTTACTCTGTAGCCCCATGT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1167058768 19:47130466-47130488 CCAAAGCATTTATCATCGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167058761 Original CRISPR ACATGGGGCTACAGAGTAAC AGG (reversed) Intronic
901640436 1:10690433-10690455 GCATGGGGCTACTGAGAATCAGG + Intronic
905319833 1:37108043-37108065 ACAAGTGGCCCCAGAGTAACAGG - Intergenic
906852860 1:49270507-49270529 ACATGGTGTTACAAATTAACAGG + Intronic
907094225 1:51761508-51761530 TCTTGGGGCTAAAGAGGAACAGG + Intronic
914945922 1:152066194-152066216 ACGTTGGCCTCCAGAGTAACTGG + Intergenic
916266182 1:162891852-162891874 ACATGTGGCTACAAAGAAAAGGG + Intergenic
923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG + Intronic
924539481 1:244968330-244968352 GCATGGGGCCACAGAGGAAAAGG + Intergenic
924841444 1:247713850-247713872 AAATGGGTCTACAAAGTAAACGG + Intergenic
1063126799 10:3142857-3142879 ACCTGGGGCCACAGAGGGACAGG - Intronic
1064979887 10:21155461-21155483 TCATGGAGCTAGAGAGTAAAAGG - Intronic
1066182988 10:32981368-32981390 ACATCGGCCTACAGAGTAGCTGG + Intronic
1067243583 10:44517372-44517394 ACATGGGGTAACAGGGTAATAGG - Intergenic
1071278824 10:84080974-84080996 ACAAGGGGCTAGAGAGAAATTGG - Intergenic
1072786696 10:98288008-98288030 ACATGGAGCAACAGAGAAAAAGG + Intergenic
1075741841 10:124700822-124700844 ACAGGGAGCCACAGAGCAACAGG + Intronic
1078115245 11:8442308-8442330 ACATGTGGCCATAGAGCAACTGG - Intronic
1078123586 11:8536054-8536076 ACATGGAGGTACAGAGTGAAAGG + Intronic
1078399277 11:11010011-11010033 ACATGGAGCCACAGAGTGTCAGG + Intergenic
1079162280 11:18006288-18006310 AGCTGGGACTACAGAGTAGCTGG + Intronic
1079544678 11:21618789-21618811 ACATGGGGATACACAATAGCAGG - Intergenic
1080548984 11:33352388-33352410 CCAAGTGGCTAAAGAGTAACTGG + Intronic
1085957387 11:81415696-81415718 ACATGTAGCTACACAGTATCCGG - Intergenic
1087514696 11:99142936-99142958 ACATGGGGCTGCTGAGCACCAGG - Intronic
1091408649 12:224588-224610 GCGTGGGGCCACAGAATAACAGG + Intronic
1095905298 12:47371168-47371190 AGAAGGGGCTAAAGAGGAACAGG - Intergenic
1098491516 12:71086493-71086515 ACATGGTGATAGAGAGTAAGAGG - Intronic
1099444096 12:82731305-82731327 ACGTGGGGCTCCAGAGTGTCTGG + Intronic
1100515088 12:95319789-95319811 AAATGGGACTACAGGGTGACTGG + Intergenic
1102307032 12:111812761-111812783 ACATCAGCCTCCAGAGTAACTGG - Intergenic
1102574379 12:113846825-113846847 ACCTTGGCCTACCGAGTAACTGG + Intronic
1104467616 12:129003639-129003661 AAACAGGGCTACAGAGTGACGGG + Intergenic
1108013891 13:46052749-46052771 GCCTGGGTCTACAGAGGAACAGG - Exonic
1108482631 13:50890188-50890210 ACATGGGCCTCCAGAGAATCCGG - Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1113900533 13:113794328-113794350 ACATGGTGCTACACAGGGACAGG - Intronic
1115114393 14:29862058-29862080 CCATGGGGATACAGAGTAGAAGG - Intronic
1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG + Intergenic
1121557049 14:94846154-94846176 ACATGTGGCCTCAGAGCAACAGG + Intergenic
1121789638 14:96689499-96689521 ACATTGTGTTACAGAGTTACTGG - Intergenic
1121875877 14:97452230-97452252 ACCAGGGCCAACAGAGTAACTGG - Intergenic
1125328083 15:38557228-38557250 AAATTGGGCTACAGAGGAAATGG - Intronic
1131557495 15:93412562-93412584 ATATGGGGCTCCAGACTAAGAGG - Intergenic
1131805332 15:96116052-96116074 ACATGTGGCCACAGATTCACGGG + Intergenic
1133562974 16:6966611-6966633 ACATGGGGTCACAGAGCAAGAGG + Intronic
1134419020 16:14069597-14069619 ACATCAGCCTCCAGAGTAACTGG + Intergenic
1141702240 16:85647912-85647934 ACATGGGGCTGCAGTGCAGCAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1145982151 17:29019293-29019315 ACATGGGGCTTCAGTGCAGCTGG + Intronic
1146711232 17:35043272-35043294 ACTAGGAGCTTCAGAGTAACAGG + Intronic
1147253358 17:39166523-39166545 ACATGGGCCAACAGAGAACCAGG + Intronic
1148585870 17:48779407-48779429 ATATGGAGCTACGGAGCAACTGG + Intronic
1148897835 17:50850333-50850355 ACAAGGGGCAACAGAATAAAAGG + Intergenic
1149417474 17:56474633-56474655 AGATGTGGCTACAGACTCACAGG - Intronic
1149503721 17:57175336-57175358 AGATGAGGCGGCAGAGTAACCGG + Intergenic
1152071497 17:78136122-78136144 ATATGGGGCTACAGAGTGGCTGG - Intronic
1152940055 17:83164658-83164680 AAATGAGGCTATAGAGCAACTGG - Intergenic
1154289749 18:13097207-13097229 CCATGGGGCTACAGAAAAAGCGG - Intronic
1156012314 18:32509409-32509431 TCCTTGGGCTTCAGAGTAACTGG + Intergenic
1158208948 18:55024523-55024545 GCAGGGGGCTACAGAGTTGCAGG + Intergenic
1163862667 19:19750325-19750347 ATCTGGGGCTGCAGAGCAACTGG - Intergenic
1164510985 19:28897100-28897122 ACATGGGGAAACAAAGTAAGAGG - Intergenic
1166624401 19:44336990-44337012 ACCTGGGCCTCCAGAGTAGCCGG + Intronic
1167058761 19:47130427-47130449 ACATGGGGCTACAGAGTAACAGG - Intronic
925269040 2:2589166-2589188 ACAAGGGACCACAGATTAACTGG - Intergenic
925908148 2:8551867-8551889 ACATGGGGCTGCATAGAAGCAGG - Intergenic
926107179 2:10159841-10159863 TCGTGAGGCTACAGAGAAACTGG - Intronic
928811449 2:35232985-35233007 ACATGGGGATACTGTGCAACTGG + Intergenic
931224686 2:60319466-60319488 ACAGGAGGCTACAGAGTGAGAGG - Intergenic
939796331 2:146649051-146649073 TGATGAGGCTACAGAGGAACTGG + Intergenic
942901540 2:181125777-181125799 ACAAGGGGATACAAAGTTACAGG - Intergenic
944894910 2:204153873-204153895 ACATGTGGCTACTGAGCACCAGG + Intergenic
945808320 2:214517317-214517339 ACAGGCGGCTACAGGGTCACTGG + Intronic
946981311 2:225219007-225219029 ACACTGGGCTACAGAGAAACTGG - Intergenic
948042006 2:234909600-234909622 AAATGGGCCCACAGAGCAACAGG - Intergenic
1170435268 20:16320050-16320072 TCATGGGGCTGCTGTGTAACAGG + Intronic
1172234994 20:33365975-33365997 ACTTGGGGCTAGAGAATAAATGG - Intronic
1172925832 20:38534022-38534044 ACCTTGGCCTCCAGAGTAACTGG - Intronic
1173184825 20:40832502-40832524 ACATGAGGCAACTGAGGAACAGG + Intergenic
1175650415 20:60716670-60716692 ACATGGGGATGCAGATTGACGGG + Intergenic
1180554227 22:16562628-16562650 ACATGGGCCTCCCGAGTAGCTGG - Intergenic
1181153374 22:20901240-20901262 ACCTGGGGCTCCTGAGTAGCTGG - Intergenic
1181433021 22:22894395-22894417 ACATGGGGACACAGAGGGACGGG + Intronic
1183208381 22:36434679-36434701 ACATAGAGATACAGAGAAACAGG + Intergenic
1184876233 22:47277427-47277449 ACATGGAGAGACAGTGTAACCGG - Intergenic
950874725 3:16261412-16261434 ATATTGGGCAACAGAGTAGCAGG - Intronic
954753952 3:52828968-52828990 ACCTGGGGCCACACAGGAACAGG - Intronic
956389268 3:68754034-68754056 AAATGGGGCCACATATTAACTGG - Intronic
956799071 3:72740408-72740430 AGATGGTGGTACAGAGAAACAGG + Intergenic
958472541 3:94539044-94539066 ACACAGGGCTACAGAGTTCCAGG - Intergenic
958890312 3:99775659-99775681 ACATGGAGGTACAAGGTAACAGG - Intronic
958935032 3:100247582-100247604 AACTGGGACTACAGACTAACTGG + Intergenic
961447367 3:126987217-126987239 TCATCTGCCTACAGAGTAACAGG + Intergenic
961837425 3:129674625-129674647 ACATTGGACTACAGAATCACAGG + Intronic
963408380 3:144898482-144898504 AGATGGGGCCACAGAGTCACAGG + Intergenic
965893277 3:173541241-173541263 GCATGGGGCTACAAAGTATATGG + Intronic
968187749 3:196644836-196644858 ACCTAGGGCTACCGAGTAGCTGG - Intronic
969236648 4:5870125-5870147 ACCTGGGACTCCAGATTAACTGG - Intronic
974281723 4:59804074-59804096 ACCTGAGGCTACAGAGAAAAAGG + Intergenic
983164903 4:164463350-164463372 AAATGGGGCTACAAAGAAAAAGG - Intergenic
984414453 4:179438868-179438890 ACATGGGGTTAGAGAGCAAAAGG + Intergenic
986363037 5:7000520-7000542 ATATGGGGTTACACAGAAACAGG + Intergenic
989327078 5:40211025-40211047 AAATGAGGATACAGAATAACTGG + Intergenic
989647331 5:43649475-43649497 ATATGGGCCTGCAGAGTAAGAGG + Intronic
991370365 5:65912429-65912451 ACCTTAGGCTCCAGAGTAACTGG + Intergenic
993939046 5:94036521-94036543 AGATGAGGCTATAGAGAAACAGG - Intronic
995752065 5:115462460-115462482 ACTTGGGGCTACAGAGATAGGGG + Intergenic
997195856 5:131979179-131979201 ACCTGGGCCCACAGAGTACCTGG + Intronic
997408909 5:133675262-133675284 AAATGGGAACACAGAGTAACTGG + Intergenic
1002815803 6:678691-678713 GCATGGGGCTCCAGGGCAACAGG + Intronic
1003421296 6:5960687-5960709 ATTTGGGGCCACAGAGTGACAGG - Intergenic
1005990273 6:30897966-30897988 ACATGGGGAGCCAGAGTGACCGG + Intronic
1008889155 6:56465385-56465407 AAATGGGCCTACTGAGTAATTGG + Intronic
1013280300 6:108630104-108630126 ACAAGTGGCTTCAGAGAAACAGG + Intronic
1014669907 6:124289444-124289466 GCATGGGGCCACAGGGTGACTGG + Intronic
1016312026 6:142744525-142744547 ACATGGGGCTACAGAGCACTTGG - Intergenic
1019703148 7:2483982-2484004 ACCTGGGGCCACAGAGTACTAGG + Intergenic
1020506167 7:8991367-8991389 ACCGGGGGCAACAGAGTAAAGGG + Intergenic
1022602389 7:31773525-31773547 TCTTGGGACTACAGAGTATCAGG - Intronic
1023972421 7:45000628-45000650 ACCTGGGGCTGCAGAGGAAGTGG + Intronic
1026841115 7:73670340-73670362 ATCTGGGGCTACAGAGGAGCTGG + Intronic
1029649531 7:101881689-101881711 ACATGGCCCTACAGCCTAACAGG - Intronic
1033014125 7:137654317-137654339 TCATGGGGCAGCACAGTAACTGG - Intronic
1034836885 7:154360764-154360786 GTATGGGGCTTCAGAATAACAGG + Intronic
1035304897 7:157925614-157925636 GCATGGGGCCACAGAGTGATGGG + Intronic
1040287836 8:46109540-46109562 AAATGGGGCCACAGGGTAATGGG - Intergenic
1041404511 8:57483365-57483387 ACATGGGGCTACTGTGCACCTGG + Intergenic
1042607295 8:70558266-70558288 ACATCGGCCTCCAGAGTAGCTGG - Intergenic
1043455863 8:80411536-80411558 ACATGTGGCTATAGAGTACCTGG + Intergenic
1047302136 8:123622544-123622566 ACATGATGCTAGAGAGTAAAAGG + Intergenic
1049048979 8:140176790-140176812 TGGTGAGGCTACAGAGTAACTGG - Intronic
1052974980 9:34403473-34403495 GGATGGGGCTACAAAGTAAGGGG + Intronic
1061449068 9:130659079-130659101 ACAGGGTGCTACAGAGAGACTGG - Intergenic
1186876974 X:13826621-13826643 ACATCGGCCTTCTGAGTAACTGG - Intronic
1190417536 X:50195828-50195850 ACATGGGCATACACAGTCACAGG - Intronic
1192684391 X:73288591-73288613 ACACGGGGCTACAGTGCACCTGG + Intergenic
1196200649 X:112882390-112882412 ACCTTGGCCTACAGAGTACCTGG + Intergenic
1198623904 X:138546765-138546787 ACAAGAGGATACAGAGTAACTGG - Intergenic
1200839974 Y:7771372-7771394 ACATGGAGCTAGAGTGTCACTGG - Intergenic
1201531725 Y:14997261-14997283 CAATGGGGCTATAGAGTAAATGG - Intergenic