ID: 1167061752

View in Genome Browser
Species Human (GRCh38)
Location 19:47153013-47153035
Sequence AAACTCATGCTCTCCTAGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167061752_1167061758 4 Left 1167061752 19:47153013-47153035 CCAATCTAGGAGAGCATGAGTTT 0: 1
1: 1
2: 1
3: 8
4: 97
Right 1167061758 19:47153040-47153062 AGTAAGTGTTGGGAGAGGAGGGG 0: 1
1: 0
2: 1
3: 39
4: 562
1167061752_1167061756 2 Left 1167061752 19:47153013-47153035 CCAATCTAGGAGAGCATGAGTTT 0: 1
1: 1
2: 1
3: 8
4: 97
Right 1167061756 19:47153038-47153060 AGAGTAAGTGTTGGGAGAGGAGG 0: 1
1: 0
2: 5
3: 34
4: 572
1167061752_1167061753 -7 Left 1167061752 19:47153013-47153035 CCAATCTAGGAGAGCATGAGTTT 0: 1
1: 1
2: 1
3: 8
4: 97
Right 1167061753 19:47153029-47153051 TGAGTTTGTAGAGTAAGTGTTGG 0: 1
1: 0
2: 2
3: 15
4: 189
1167061752_1167061755 -1 Left 1167061752 19:47153013-47153035 CCAATCTAGGAGAGCATGAGTTT 0: 1
1: 1
2: 1
3: 8
4: 97
Right 1167061755 19:47153035-47153057 TGTAGAGTAAGTGTTGGGAGAGG 0: 1
1: 0
2: 1
3: 21
4: 256
1167061752_1167061754 -6 Left 1167061752 19:47153013-47153035 CCAATCTAGGAGAGCATGAGTTT 0: 1
1: 1
2: 1
3: 8
4: 97
Right 1167061754 19:47153030-47153052 GAGTTTGTAGAGTAAGTGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 132
1167061752_1167061757 3 Left 1167061752 19:47153013-47153035 CCAATCTAGGAGAGCATGAGTTT 0: 1
1: 1
2: 1
3: 8
4: 97
Right 1167061757 19:47153039-47153061 GAGTAAGTGTTGGGAGAGGAGGG 0: 1
1: 1
2: 1
3: 40
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167061752 Original CRISPR AAACTCATGCTCTCCTAGAT TGG (reversed) Exonic
904288520 1:29469248-29469270 GATCCCATGCTCTCCTAGGTGGG - Intergenic
912016324 1:105041032-105041054 AAAATCATGATGTCCTAGAATGG + Intergenic
915509731 1:156380001-156380023 AACCTCAATCTCTCCTAGAGAGG - Intronic
917255437 1:173110919-173110941 AAACCCATGCTCAACTAGAAGGG - Intergenic
917285231 1:173416102-173416124 CAACCCAGGCTCTCCTAGGTTGG + Intergenic
921655637 1:217733320-217733342 AAACTCTTGCTCTCTTCGGTAGG - Intronic
921734416 1:218610667-218610689 AATTTCATACTCACCTAGATAGG + Intergenic
922909982 1:229207282-229207304 ATATTCATGCTCTGATAGATGGG - Intergenic
1066212545 10:33253985-33254007 AAACTTATTCAATCCTAGATAGG + Intronic
1068684166 10:59852488-59852510 AAAGTCATTTTCTCCTAGAAAGG + Intronic
1073872215 10:107878674-107878696 TAACTCTTGCTCTACTTGATGGG - Intergenic
1075297879 10:121293954-121293976 AAACTCATGATCACCTAAGTAGG + Intergenic
1075653167 10:124143321-124143343 AAGTTCACGCTCTCCTAGAGAGG - Intergenic
1076596904 10:131629035-131629057 AAACTCATGGTCTGCAAAATGGG - Intergenic
1077989069 11:7385808-7385830 AAACATTTGCTCTCCTGGATAGG - Intronic
1079743955 11:24101434-24101456 AAACACATGCTCACCCAGATTGG + Intergenic
1081784449 11:45737192-45737214 TGACTCATTCTCTCCTTGATAGG - Intergenic
1086356618 11:86008056-86008078 AAACTCATGCTCTGTCAGGTAGG + Intronic
1087146645 11:94819951-94819973 AAATTCATGATCTCAAAGATAGG + Intronic
1088899122 11:114101895-114101917 AAACTGATGGTATCCCAGATGGG + Intronic
1089124090 11:116164030-116164052 AAACTCATGCTCTTCCTGGTAGG + Intergenic
1090007796 11:123018138-123018160 AAACTCATGTTCTCCTAGATTGG - Intergenic
1090326538 11:125891229-125891251 AAATTCTTACTCTTCTAGATTGG + Intronic
1090326606 11:125892161-125892183 AAATTCTTACTCTTCTAGATTGG - Intronic
1094117362 12:26931720-26931742 CAACTCATGCTCAACTAGTTAGG - Intronic
1095104789 12:38219258-38219280 AAACTCTATCTCTCCTAGGTTGG + Intergenic
1101282177 12:103269717-103269739 AAACTCATGCTCTAGTGGAGAGG + Intronic
1110969475 13:81742985-81743007 AAACTTATGATCTGCTAAATGGG - Intergenic
1111382981 13:87483750-87483772 AAAGTCATGATCTCATAAATTGG - Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1114728911 14:24969849-24969871 AAACTAATCCTCTCCTTTATAGG - Intronic
1115147567 14:30242829-30242851 AAACTCACGCTCTCCTACACTGG + Intergenic
1117192910 14:53310885-53310907 AAACACATTCTCTCATGGATGGG + Intergenic
1119222617 14:72921260-72921282 AAACTCATGGTTTTCAAGATAGG + Intergenic
1127668986 15:61176352-61176374 AAAATCCTGGTCTCCTAAATGGG + Intronic
1128439150 15:67687712-67687734 AAATTCATGCTCTTCTGGATCGG + Intronic
1138577404 16:57916774-57916796 ACACTGATGCTCTCCTACTTGGG - Intronic
1140561931 16:75993492-75993514 AAATTCATGCTCTTCAAAATAGG - Intergenic
1144059419 17:11569150-11569172 AAACTCAAGCTTTCCAAGCTTGG - Intergenic
1144656713 17:17042031-17042053 AAACTAATCCTCTCCGAGCTGGG + Intergenic
1145776862 17:27535129-27535151 AAAATCATGCTTTCCTGGGTGGG + Intronic
1154315623 18:13301155-13301177 ACACTGAGGCTCTCCAAGATAGG - Intronic
1155933383 18:31729246-31729268 GAACTCATGGTCACATAGATGGG - Intergenic
1158222252 18:55161720-55161742 AAACTCCTTATCTTCTAGATGGG - Intergenic
1159884293 18:73889487-73889509 GAACTCCTGCTTTCCTAGCTTGG + Intergenic
1161154131 19:2723432-2723454 AAGCTCCTGCTGTCCTAGTTTGG - Intronic
1166242312 19:41502813-41502835 AATATCATCCTCTCCTACATTGG + Intergenic
1167061752 19:47153013-47153035 AAACTCATGCTCTCCTAGATTGG - Exonic
925173808 2:1768461-1768483 AAACTCAAGCCCTCCTGGAAGGG - Intergenic
926301784 2:11610040-11610062 AACCACCTGCTCTCCTAGAGTGG - Intronic
928088544 2:28360367-28360389 AAACTCATGCCACCCTAGAGTGG - Intergenic
931292485 2:60886764-60886786 AAGCTCATGCTTTATTAGATAGG + Intronic
936979858 2:118254498-118254520 AAAATCATGCTCACTTAGAAAGG - Intergenic
939237474 2:139515738-139515760 AAACTCAAGTTCACTTAGATTGG - Intergenic
939576279 2:143899294-143899316 AAACTCATGCTCTTTTCCATTGG - Intergenic
943943152 2:194024587-194024609 AAAGTCATGCTATTCTAGGTTGG - Intergenic
1170361834 20:15554762-15554784 AAACTCATGCCCTCCTTAAATGG - Intronic
1177702603 21:24657860-24657882 AAACTGATTCTCTCCTTGTTTGG + Intergenic
1178901212 21:36600734-36600756 AGTCTCATGCTCTCCTACTTGGG - Intergenic
1182392880 22:30014031-30014053 AAACCCATGCTCTGGTAGAGAGG - Intronic
1184346581 22:43917324-43917346 AAAGTGATGCTCTTCTAGCTGGG + Intergenic
952652397 3:35741836-35741858 AACCTCATCCTCTCTTAGAGAGG - Intronic
956677817 3:71752679-71752701 AAAATCATGCTCTTCTAACTAGG - Intronic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
960485317 3:118245228-118245250 AAACTCTTCCTTTCCTAGATGGG - Intergenic
961800130 3:129441017-129441039 AAACACAAGCTCTCCTAATTGGG + Intronic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
963908021 3:150789997-150790019 AAACTCTTGCTCTCCTAGCTTGG - Intergenic
973898693 4:55444212-55444234 AAAGTCATAGTCTCCTAGAGTGG + Intronic
976379798 4:84386415-84386437 AAACTCTTCTTCTCCTTGATTGG + Intergenic
976676162 4:87705757-87705779 AAATTGATTCTCTCCTAGTTCGG + Intergenic
983607386 4:169604524-169604546 AAACTTATTTTCTCCTAGAAAGG - Intronic
983783680 4:171705205-171705227 CAACACATTCTCTCCTAGAAGGG - Intergenic
996984267 5:129539558-129539580 AAACTGATGCATTCCTATATCGG + Intronic
997893823 5:137698084-137698106 AAACTCATGCCTTCCTGGCTTGG - Intronic
998650871 5:144119771-144119793 AAAGTCATTCTCTCCTGGAGGGG - Intergenic
999797916 5:155005299-155005321 ACACTCATTCTCTCCTACCTTGG - Intergenic
1002386375 5:178870215-178870237 AAACTTATGCTCCCCATGATAGG + Intronic
1007909182 6:45496183-45496205 AAACTCATTATCCTCTAGATGGG + Intronic
1008117855 6:47573364-47573386 AAACTCATGCTAACTTTGATTGG + Intronic
1008746904 6:54682611-54682633 AAGCTCATGCTTTCCTATATTGG + Intergenic
1011321913 6:86104836-86104858 TCACTCTTGCTCACCTAGATTGG - Intergenic
1012118117 6:95330658-95330680 TAACTAATTCTCTCCTGGATTGG + Intergenic
1012969313 6:105710552-105710574 GAACTCCTGCTCTCCTTCATGGG - Intergenic
1014252051 6:119125626-119125648 AAACTCATGCTATCCAACAATGG - Intronic
1015205684 6:130635937-130635959 AAACTCATTATTTACTAGATAGG - Intergenic
1015303545 6:131680926-131680948 GAACTCATGCTCTCCTTGAGAGG + Intronic
1015963372 6:138672985-138673007 ACAGTCTTGCTCTCCCAGATTGG - Intronic
1016354653 6:143204893-143204915 AAACTCCTCTTCTACTAGATAGG - Intronic
1017152702 6:151295088-151295110 ATACTCATGCTCTCAGAGACCGG + Intronic
1027718667 7:81709781-81709803 AAACCCATAATATCCTAGATTGG + Intronic
1030518259 7:110564258-110564280 AAGATGATGATCTCCTAGATGGG - Intergenic
1032516844 7:132512741-132512763 AAACTCTTGCTTTGCCAGATTGG - Intronic
1033071493 7:138207444-138207466 AAACCCAAGCTGTCCTAGATTGG - Intergenic
1034548026 7:151801683-151801705 AAACTCATTCTGTTCTAGAGGGG + Intronic
1037546491 8:19929023-19929045 AAACTCATCTTCTGCTAAATGGG + Intronic
1038244422 8:25841545-25841567 AAAGTCATGCTCTCCTTTAAGGG + Intergenic
1042109633 8:65367184-65367206 AAACACCTGCTCACCTAGATTGG + Intergenic
1044194687 8:89360861-89360883 ACAGTCTTTCTCTCCTAGATTGG - Intergenic
1044382280 8:91548311-91548333 AAATTCAAGCTCTCCCTGATGGG + Intergenic
1044466273 8:92510125-92510147 AAACTTTTGTTCTCATAGATTGG - Intergenic
1045175843 8:99723995-99724017 ATTCTCATACTCTCCCAGATAGG + Intronic
1047326240 8:123838616-123838638 AGACTCCTGCTGGCCTAGATGGG + Intergenic
1055118772 9:72634511-72634533 AAACTAATGCCCTCCTTGGTGGG - Intronic
1188565172 X:31518760-31518782 AAACTCGTGGTTTCCTCGATAGG - Intronic
1190772243 X:53524914-53524936 AAACTCGTGATTTCCTTGATTGG - Intergenic
1190781258 X:53597987-53598009 AAACTCGTGATTTCCTTGATTGG - Intronic
1199205686 X:145146152-145146174 ATGCTCATGCTCTACTAAATTGG - Intergenic