ID: 1167064855

View in Genome Browser
Species Human (GRCh38)
Location 19:47177536-47177558
Sequence CTGTTTGTACAGATTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167064849_1167064855 4 Left 1167064849 19:47177509-47177531 CCACCATGTCCAGCTATTTTAAA 0: 1
1: 15
2: 283
3: 1682
4: 10852
Right 1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 205
1167064851_1167064855 -5 Left 1167064851 19:47177518-47177540 CCAGCTATTTTAAAAAATCTGTT 0: 1
1: 0
2: 11
3: 169
4: 1262
Right 1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 205
1167064850_1167064855 1 Left 1167064850 19:47177512-47177534 CCATGTCCAGCTATTTTAAAAAA 0: 1
1: 7
2: 176
3: 833
4: 2676
Right 1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167064855 Original CRISPR CTGTTTGTACAGATTGGGGC AGG Intronic
901820947 1:11829092-11829114 CTGTTTGGAGAAATCGGGGCTGG + Intronic
902321674 1:15672052-15672074 CTGTGTCTACAGCTTGGGGGAGG + Intergenic
903812186 1:26040918-26040940 ATGTTTGTAGAGATGGGGGGGGG - Intronic
904384255 1:30131321-30131343 CTCCTTGTACAGAGTGGGGAGGG - Intergenic
905446164 1:38029722-38029744 CTGTTTGTAGAGTAGGGGGCTGG + Intergenic
906112970 1:43336927-43336949 CTGTTTGCTCAGATTGGAGATGG - Intergenic
907200165 1:52719721-52719743 CTTTTTGTACAGACGGGGTCTGG - Intergenic
907504044 1:54904215-54904237 TTTTTTGTACAGATGGGGTCAGG + Intergenic
908797136 1:67841708-67841730 CTGTGTGTAGGGGTTGGGGCAGG + Intergenic
908998206 1:70184744-70184766 ATTTTTGTACAATTTGGGGCTGG - Intronic
910861776 1:91749123-91749145 CTGTTTTAATGGATTGGGGCAGG + Intronic
912399536 1:109378057-109378079 CTTTTTGTAGCGATGGGGGCGGG - Intronic
912696123 1:111843427-111843449 CTGTTTCTAGAAAGTGGGGCAGG + Intronic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
919741456 1:200983704-200983726 CTTTTTGGAAGGATTGGGGCAGG - Intronic
919958804 1:202445182-202445204 GTGTTTGCACTGATTGGTGCAGG - Intronic
922063639 1:222115334-222115356 CTTTTGGTACAGATGGGGTCTGG + Intergenic
923044420 1:230345049-230345071 CTGTTTGAACACGTTGGGCCAGG - Intronic
923986811 1:239390957-239390979 CTTTTTGTAGAGATGGGGTCTGG - Intronic
1063671380 10:8102670-8102692 TTTTTTGTAAAGATTGGGGTGGG - Intergenic
1064539072 10:16387862-16387884 GTGTTGGTAGAGATTGGGCCAGG - Intergenic
1065160587 10:22916974-22916996 TTTTTTGTAGAGATTGGGTCTGG + Intergenic
1065500189 10:26373501-26373523 AAGTTTGTAGAGTTTGGGGCTGG - Intergenic
1066547053 10:36511030-36511052 CTGTTTATGGAGATTGGGTCTGG + Intergenic
1067224266 10:44365152-44365174 CTGGGTGTACAGGTTTGGGCTGG + Intergenic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1071597167 10:86936717-86936739 ATGTCTGATCAGATTGGGGCTGG + Exonic
1073302574 10:102480057-102480079 GTGTTTGTTCAGTTAGGGGCTGG - Exonic
1073766376 10:106687154-106687176 CTGTGTGTCAAAATTGGGGCAGG + Intronic
1075113362 10:119605818-119605840 CTTTTTGTACAGATTTGGGGGGG - Intergenic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1075623593 10:123946175-123946197 AGGTTTCTCCAGATTGGGGCTGG - Intergenic
1076112742 10:127873339-127873361 CTGTTTGCAGGGTTTGGGGCAGG + Intergenic
1076696551 10:132249972-132249994 CTGTTTTGACAGATTCCGGCTGG - Intronic
1078149133 11:8743918-8743940 TTTTTTGTAGAGATGGGGGCGGG + Intronic
1078252446 11:9627451-9627473 TTTTTTGTAGAGATTGGGGGGGG + Intergenic
1079094998 11:17504362-17504384 CTGTTTGTCCAGAGAGGAGCAGG - Intronic
1079228094 11:18625742-18625764 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1082911715 11:58384471-58384493 CTGTTTGTAGGTAATGGGGCTGG - Intergenic
1083235880 11:61350475-61350497 CTGTCTGAACAGCTTGGGCCTGG - Intronic
1083428132 11:62600002-62600024 CTGTTTTTACATGTTGGGGTTGG - Intronic
1084895439 11:72263940-72263962 CTGCTAGTCCAGATTGGTGCAGG - Intergenic
1084985114 11:72862858-72862880 CTGTTTGTCCAGCTTGATGCCGG - Intronic
1088317818 11:108525275-108525297 CTTTTTGTCCAGATTGGTGTGGG - Intronic
1088474095 11:110217249-110217271 CTGTTTTTACAGGTCGGGGATGG + Intronic
1089001988 11:115059856-115059878 CTGTTTGTACTGCTGGAGGCTGG - Intergenic
1089696092 11:120217141-120217163 TCGTTTGTACAGACTTGGGCTGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1093134807 12:15437639-15437661 CTGTTCGTAGATATTGGTGCAGG + Intronic
1094009214 12:25788915-25788937 GAGTTTGTTCAGATTTGGGCAGG - Intergenic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1096298654 12:50406307-50406329 TTGTTTGTAGAGGTTGGGGGTGG - Intronic
1096855224 12:54476597-54476619 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1099529901 12:83765145-83765167 CTGTTATTACTTATTGGGGCAGG - Intergenic
1100989882 12:100240336-100240358 GTTTTTGTAGAGATAGGGGCAGG + Intronic
1102388943 12:112534342-112534364 TTGTTTGTAGAGATGGGGGGTGG + Intergenic
1102509313 12:113403539-113403561 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1103231045 12:119330672-119330694 GTGATTATACAGATAGGGGCAGG + Intergenic
1103322439 12:120099942-120099964 CTGATTGCACAGTGTGGGGCGGG - Intronic
1104588846 12:130068477-130068499 CTGGTTGTACAGATGCAGGCAGG - Intergenic
1104849624 12:131865790-131865812 CTTTTTGTAGAGATTGGGGGCGG - Intergenic
1105834624 13:24198345-24198367 CTGTTTGTACAGGAGTGGGCAGG - Intronic
1106523443 13:30518917-30518939 ATTTTTGTAGAGATGGGGGCTGG + Intronic
1106775234 13:33002401-33002423 CTGTTTGTAAAGATGGGAGGTGG - Intergenic
1107052893 13:36070939-36070961 CTCTTTATAAAGATGGGGGCCGG - Intronic
1107408111 13:40134132-40134154 CTGTTTGTACAGCTTGCCCCTGG + Intergenic
1107464265 13:40634971-40634993 TTGTTTTTAAAAATTGGGGCTGG - Intronic
1108263785 13:48684099-48684121 CTTTTTGTAGAGATCGGGGGGGG + Intronic
1108354412 13:49617442-49617464 TTTTTTGTAGAGATTGGGGTGGG - Intergenic
1109272563 13:60270874-60270896 CTCTATGTAAAGATTGGGGAAGG - Intergenic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1112015850 13:95330794-95330816 TTGTTTGTAGAGATGGGGTCTGG - Intergenic
1114313027 14:21485088-21485110 TTTTTTGTAGAGATTGGGTCTGG - Intronic
1114660295 14:24339414-24339436 CTTTTTGGCCAGATTGCGGCTGG + Intronic
1118812870 14:69288228-69288250 TTGTTTGGACAGACTAGGGCTGG + Intronic
1124606703 15:31174767-31174789 CTGTGTGTACTCATAGGGGCTGG + Intergenic
1125961692 15:43835313-43835335 CTTTTTATAGAGATTGGGGTGGG - Intronic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1129095754 15:73205715-73205737 CTGTCTCTACAGTTTGGGGTGGG + Intronic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1131846521 15:96495102-96495124 CTATTTACAAAGATTGGGGCAGG + Intergenic
1133818835 16:9218429-9218451 TTTTTTGTAGAGATTGGGGTTGG - Intergenic
1140375528 16:74442657-74442679 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1140838256 16:78815437-78815459 CTGTTTGTAAAGGTCGGTGCAGG - Intronic
1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG + Intronic
1142978900 17:3660327-3660349 CTGTTTGTACAGAAAGAGACCGG + Exonic
1145933516 17:28702037-28702059 CTATTTATTCAGTTTGGGGCAGG + Exonic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1147191420 17:38740230-38740252 CTCTGTGCCCAGATTGGGGCGGG - Intronic
1147271400 17:39274454-39274476 CTTTTTGTAGAGATGGGGTCAGG - Intronic
1148956238 17:51355869-51355891 CTGTTTCTGCAGACTGGCGCTGG - Intergenic
1151766795 17:76137111-76137133 CTGTGTGTACAAGGTGGGGCTGG + Exonic
1152181977 17:78828044-78828066 TTGTTTGTAGAGATGGGGTCTGG - Intronic
1152814414 17:82398985-82399007 TTTTTTGTAGAGGTTGGGGCGGG + Intronic
1153387899 18:4519970-4519992 CTGTTTGTAATGATTGGCCCAGG + Intergenic
1154047404 18:10919560-10919582 CTCTTTGTAGAGACTAGGGCAGG + Intronic
1154129769 18:11726894-11726916 CTGGTTGGACAGAATGGGACAGG + Intronic
1154173911 18:12069566-12069588 CTCTTTGTAGAGACTAGGGCAGG - Intergenic
1155313287 18:24545595-24545617 CTTTTAGTGCAGACTGGGGCGGG + Intergenic
1157889441 18:51401066-51401088 CTGAATGTACAAACTGGGGCAGG - Intergenic
1159062400 18:63529709-63529731 CTGTATGTATAGTTTGGGGTGGG + Intergenic
1159519324 18:69497367-69497389 GTGTTTCCAGAGATTGGGGCTGG - Intronic
1160272775 18:77403222-77403244 CTGTTTCTTCAGATTTGGGGTGG - Intergenic
1160522991 18:79519509-79519531 TTGTTTGTAGAGATGGGGGGTGG + Intronic
1161204461 19:3033838-3033860 CTTTTTGTAGAGATGGGGGGTGG - Intronic
1163535786 19:17875594-17875616 TTTTTTGTAGAGATGGGGGCGGG - Intronic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1164781059 19:30893242-30893264 CTGTGTTTTCAGATTGGGACTGG - Intergenic
1164867596 19:31617665-31617687 CTGGTTGTACAGATGAGGACAGG + Intergenic
1164957775 19:32401952-32401974 TTTTTTGTAAAGATTGGGGGTGG - Intergenic
1165584242 19:36899265-36899287 CTGTTTATAGAGATCGGGGGGGG - Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167620469 19:50557322-50557344 CTGTGAGTGGAGATTGGGGCTGG - Intronic
1167806407 19:51789377-51789399 CTTTTTGGACACATTGGAGCTGG + Intronic
925907605 2:8548508-8548530 CTGTTTGCACCTAGTGGGGCAGG - Intergenic
927528211 2:23768391-23768413 CTTTTTGTACAGGGTGGAGCAGG - Intronic
929403580 2:41613895-41613917 CTGTTTGTATACATGGTGGCTGG - Intergenic
930056739 2:47258022-47258044 CTGTGTCTACAGACTGTGGCTGG - Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
932050456 2:68393098-68393120 TTGTTTGTACAGAGTGATGCTGG + Intronic
932161659 2:69465778-69465800 CTGCTTGTACAGAATGGGACAGG + Intronic
932245594 2:70193641-70193663 TTTTTTGTAGAGATTGGGGGTGG + Intronic
933330651 2:80889124-80889146 AGGTTTGTACAGGTTTGGGCAGG + Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938985487 2:136571343-136571365 CTGTTGGGCCAGATTTGGGCAGG - Intergenic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
942657779 2:178231839-178231861 CTTTTTGTAGAGATAGGGTCTGG + Intronic
943046936 2:182870894-182870916 CTGATAGTACAGAATGGGCCTGG - Intergenic
944255058 2:197617055-197617077 CTGTGTGTACATATTTGGCCTGG + Intronic
945339464 2:208634682-208634704 CAGTTTGTTCAGAATGAGGCAGG - Intronic
948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG + Intergenic
948622574 2:239245865-239245887 CTGCTTGAACACATAGGGGCTGG - Intronic
948665867 2:239534651-239534673 CTGTTTCTACAGTCTGGGCCAGG - Intergenic
1169208065 20:3750933-3750955 CTGTTTGTTCATGTAGGGGCGGG - Intronic
1173064732 20:39699536-39699558 CTGTTTTTCCAGTTTGGGGGTGG - Intergenic
1173515426 20:43662345-43662367 TTTTTTGTACAGACGGGGGCGGG + Intergenic
1174794803 20:53513073-53513095 TTTTTTGTAGAGATTGGGGGGGG - Intergenic
1178392019 21:32206369-32206391 CTCTTTGTATAGACTGGAGCCGG + Intergenic
1180932090 22:19599181-19599203 TTGTTTGTAGAGATAGGGTCTGG + Intergenic
1183773167 22:39944431-39944453 CTGTTTGTTCAGGGTGGGGTGGG - Intronic
949504182 3:4711258-4711280 TTGTTTGTTTAGCTTGGGGCTGG + Intronic
953931863 3:47009564-47009586 CTTTTTGCACAGTCTGGGGCGGG + Exonic
954659094 3:52217142-52217164 CTCTCTGTACAGAGTTGGGCTGG + Intergenic
956696961 3:71926703-71926725 CTGTTTCTAAAGATGTGGGCAGG + Intergenic
961291265 3:125848645-125848667 ATTTTTTTAGAGATTGGGGCAGG + Intergenic
964519721 3:157551843-157551865 CTGTGTGTCCTGAGTGGGGCAGG + Intronic
965696117 3:171410135-171410157 CTCTTTTTACAGATAGGTGCTGG - Intronic
966297552 3:178441428-178441450 CTGTTTATAGAGATTTTGGCAGG - Intronic
967965429 3:194956732-194956754 CTGTTTCCCCAGGTTGGGGCTGG - Intergenic
972131232 4:35836491-35836513 CTGATAGTACAGATTAAGGCAGG + Intergenic
976670143 4:87643233-87643255 TTTTTTGTAGAGATGGGGGCTGG - Intergenic
977923585 4:102672852-102672874 GTTTTTCTACAGATTGGGGGTGG - Intronic
979343996 4:119563796-119563818 CTGTTTGTAAAAATGGGGACTGG + Intronic
989119108 5:37985770-37985792 CTGTCTGTGCTGATTGGGACTGG - Intergenic
991065451 5:62419814-62419836 CTTTTTGTAGAGATGGGGTCTGG - Intronic
992408266 5:76480093-76480115 CTGTTTGTGTAGGTGGGGGCTGG + Intronic
992482546 5:77166392-77166414 CTGTGTGTACTCACTGGGGCAGG - Intergenic
992756227 5:79908985-79909007 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
996559836 5:124816821-124816843 CTTTTTGTAGAGATAGGGGGTGG - Intergenic
997774509 5:136588869-136588891 CTGTTGGAACAGAGTGGGGCAGG + Intergenic
998186013 5:139980706-139980728 CTGATTGTAGAGATTAGTGCTGG - Intronic
998659886 5:144224529-144224551 GTGTTTTTACAGAATAGGGCTGG - Intronic
999812919 5:155144907-155144929 CAGTAGGTTCAGATTGGGGCTGG + Intergenic
1000011775 5:157239902-157239924 CTGTCTTGACAGATTGGGCCTGG - Intronic
1000141855 5:158412611-158412633 CTGTTTGTTGAGAGTGGGGCTGG + Intergenic
1002853867 6:1020717-1020739 CTGCTTGTACACAGTGGGGCAGG - Intergenic
1004002400 6:11607266-11607288 CAGTTTGCACCGATTGGGGCAGG + Intergenic
1007843010 6:44731981-44732003 CTGTGTGTAGAGAGTGGTGCAGG + Intergenic
1008218866 6:48829711-48829733 TTGTTTGAACAGATAGTGGCAGG - Intergenic
1008491159 6:52088603-52088625 GTGCTTGGCCAGATTGGGGCAGG + Intergenic
1013179500 6:107706325-107706347 ATGCTTGGACAGATTTGGGCAGG - Intronic
1013417577 6:109938630-109938652 CTGTCTGTCCAGATTAGTGCAGG - Intergenic
1013627098 6:111949365-111949387 CTGATTGTCCAGTTTGGGTCAGG - Intergenic
1015565279 6:134563583-134563605 CTGTTCATACAGATTGATGCTGG - Intergenic
1019985119 7:4650072-4650094 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1020524242 7:9238304-9238326 CTATATGTAAAAATTGGGGCCGG + Intergenic
1020653466 7:10902969-10902991 CTTTTTGTAGAGATAGGGTCTGG + Intergenic
1022426627 7:30275040-30275062 CTGTTTGTACAGGTCAGGTCTGG + Intergenic
1023573543 7:41599193-41599215 CTTTTTGTACAGATGGGATCGGG - Intergenic
1026450364 7:70523901-70523923 CAGTTTCTACTGCTTGGGGCAGG - Intronic
1029478245 7:100797947-100797969 GTTTTTGTAGAGATGGGGGCGGG + Intergenic
1029521115 7:101063151-101063173 CTTTTGGTAGAGATTGGGGCAGG - Intergenic
1030272197 7:107681933-107681955 TTTTTTGTAGAGATTGGGGCGGG - Intronic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1033629457 7:143142329-143142351 CTTTTTGTAGAGATTGGGCAGGG + Intergenic
1033954983 7:146835898-146835920 GAGTTTCTACAGGTTGGGGCAGG + Intronic
1034279472 7:149842723-149842745 CAGCCTGTCCAGATTGGGGCAGG - Intronic
1034655068 7:152722653-152722675 TTGTTTGTAGAGATGGGGTCTGG + Intergenic
1035896756 8:3411080-3411102 CTGTTTGTGCAGAGTGATGCAGG + Intronic
1037163105 8:15796058-15796080 CTGTTTGTTCAGCTTCTGGCAGG + Intergenic
1039379872 8:37075357-37075379 CTGTGTTTACAGGTTGGGGCAGG - Intergenic
1040955808 8:52978733-52978755 CAGTTTCAACAGATTGGGGCTGG + Intergenic
1041913581 8:63116101-63116123 TTTTTTGTACAGATGGGGTCTGG + Intergenic
1043172580 8:76983837-76983859 CTGTTTGTACAATTGGTGGCAGG - Exonic
1047211378 8:122842927-122842949 CTGATTCAACAGGTTGGGGCAGG + Intronic
1052636517 9:31113153-31113175 CTGCTTGCACAGATTGCTGCTGG - Intergenic
1053419945 9:37970935-37970957 CTGATTGTGCAGATTTGGCCTGG - Intronic
1053761130 9:41350581-41350603 CTGTTTGTCCACATTAGGCCTGG - Intergenic
1060030069 9:120206893-120206915 CTCTTTGTACAGATTTAGGTGGG - Intergenic
1060248040 9:121962889-121962911 CTGTCTGTAAACTTTGGGGCAGG - Intronic
1061123486 9:128658899-128658921 GTTTTTGTAGAGATGGGGGCAGG + Intergenic
1061494546 9:130964504-130964526 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1061675820 9:132215063-132215085 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1061905095 9:133692645-133692667 CTGTATGTCCAGACGGGGGCAGG - Intronic
1062525347 9:136976026-136976048 CTGTTGGAACAGATAGGGGTGGG - Intergenic
1186874079 X:13799879-13799901 ATGTTTATACAGACTGTGGCAGG + Intronic
1187365063 X:18659953-18659975 CTGTTTGTTCAGATTCGTGTTGG - Intronic
1187887448 X:23902863-23902885 ATGTTTGTGCAGAGTGGGGATGG - Intronic
1189204122 X:39223021-39223043 ATGTTTGTAAGGATTGGGGTGGG - Intergenic
1189247623 X:39575951-39575973 CTGTGTGTACAAATGAGGGCTGG - Intergenic
1189368331 X:40407372-40407394 TTTTTTGTAGAGATCGGGGCTGG + Intergenic
1192477232 X:71453392-71453414 TTGTTTGTAGAGATTGGGGGTGG - Intronic
1197008182 X:121529375-121529397 ATTTTTCTACAGATGGGGGCAGG - Intergenic
1197699715 X:129589822-129589844 CTGTTTTTAAAAATAGGGGCAGG - Intronic
1199805316 X:151294078-151294100 CTGTCTGGTGAGATTGGGGCTGG + Intergenic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic