ID: 1167066062

View in Genome Browser
Species Human (GRCh38)
Location 19:47186987-47187009
Sequence GTCCCCACCACAGCTAGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167066059_1167066062 3 Left 1167066059 19:47186961-47186983 CCTGGGGCTGTCTGGGTCGCTTC 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1167066062 19:47186987-47187009 GTCCCCACCACAGCTAGCATAGG 0: 1
1: 0
2: 2
3: 17
4: 121
1167066053_1167066062 21 Left 1167066053 19:47186943-47186965 CCGCGTGTGAGGGCAAGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1167066062 19:47186987-47187009 GTCCCCACCACAGCTAGCATAGG 0: 1
1: 0
2: 2
3: 17
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167066062 Original CRISPR GTCCCCACCACAGCTAGCAT AGG Intronic
900592155 1:3464938-3464960 GACCCCACCTCAGCCACCATCGG - Intronic
902538834 1:17138066-17138088 GTTCACACCAAAGCTAGCATCGG - Intergenic
904493050 1:30871904-30871926 CTCCCCACCGCAGCTGGCAGAGG - Intronic
904617328 1:31756842-31756864 GCCCCCAGCACAGCCAGCATGGG + Intronic
905456680 1:38092810-38092832 GTGCCCAGCACAGCTAGGAGGGG + Intergenic
905890841 1:41517389-41517411 TTCCCCCCCAAAGCTAGAATGGG - Intronic
906524745 1:46487618-46487640 GTCCCCACCTCAGATAGCACAGG - Intergenic
908130474 1:61070126-61070148 GTCTCCACCACACCCAGCCTCGG + Intronic
910700371 1:90067938-90067960 GTTCCCACCACGGCTAGCTGTGG + Intergenic
915590600 1:156868235-156868257 GCACCTACCACAGCTGGCATTGG - Exonic
916454234 1:164953983-164954005 GTCCCCTCCATAGCCAGCAGGGG - Intergenic
916824351 1:168429916-168429938 CTCCCCACCACAGCCAGCTCTGG + Intergenic
920046156 1:203133881-203133903 GTCCCCACCCTGGCTAGCCTGGG + Intronic
924609628 1:245563045-245563067 CTCCCCAGCACAGCCAGCATAGG + Intronic
1066061227 10:31725285-31725307 CTCCCCACCACAACTACCCTTGG - Intergenic
1067068309 10:43115811-43115833 GTCACCTCCACAGCTGGCACTGG - Intronic
1067659606 10:48224439-48224461 CTCCCCACCCCAGCATGCATAGG - Intronic
1069014810 10:63418254-63418276 GTCCCCAGACCAGGTAGCATTGG - Intronic
1072910667 10:99497960-99497982 GTCACCACCAGAGCTAGGCTTGG + Intergenic
1076316289 10:129544302-129544324 GTTGCCGCCACAGCCAGCATCGG + Intronic
1076896441 10:133315020-133315042 GGCCCCACCACAGCCACCCTCGG - Intronic
1077219819 11:1410937-1410959 GCCCCCACCCCAGCCAGCAAGGG - Intronic
1077662371 11:4081099-4081121 GTCCTCTCCACAGCTAAGATAGG - Intronic
1081244169 11:40743831-40743853 GTCCACAGCAAAGCTAGCACAGG - Intronic
1081673066 11:44952302-44952324 GTCCTCACCAGAGCTGGGATTGG + Intergenic
1081723464 11:45307004-45307026 GGCCCCACCTCAAGTAGCATGGG - Intergenic
1082806981 11:57457951-57457973 GTCCCCACCCCACCTAGCTCCGG - Intergenic
1083031894 11:59600233-59600255 GTCCCCAGTGCATCTAGCATAGG + Intronic
1083129861 11:60615413-60615435 GTACCCACCACATCTTGCAGAGG + Intergenic
1083133232 11:60646945-60646967 GTACCCACCACATCTTGCAGAGG + Intergenic
1083765591 11:64840049-64840071 GTCCCCAGCACAGCTGGCAGGGG + Intronic
1084117536 11:67050730-67050752 GTCCCCACCACGGCTGTCCTGGG - Exonic
1086062432 11:82713623-82713645 GGCCCCACCGCAGATTGCATTGG + Intergenic
1087282387 11:96226130-96226152 TTCCCCACCACAGATAGCATGGG + Intronic
1089813107 11:121147797-121147819 GTCCCCACCCCAGCCACCCTGGG - Intronic
1091308675 11:134557766-134557788 CTCCCCACCCCAGCCAGCAGGGG + Intergenic
1094676060 12:32621394-32621416 GACACCACTACAGCTAGGATTGG - Intronic
1098633883 12:72757348-72757370 GACCCCACCACCTCTAGCAGTGG + Intergenic
1099045548 12:77713016-77713038 GTCACCACAAAAGCTAGCTTAGG + Intergenic
1102425925 12:112844355-112844377 GTCCCTACCCCAGCTACCAGAGG - Intronic
1103487990 12:121296120-121296142 GTCCCCACAACTGCTGGCCTAGG + Intronic
1105072354 12:133242432-133242454 ATCCACACCACAGCAAGCAGGGG + Intergenic
1105723655 13:23140311-23140333 GCCCCCACCACAGTTGGCATTGG - Intergenic
1107790532 13:43997932-43997954 GTCCTCACCACAGTTGGCAAAGG + Intergenic
1117488761 14:56225545-56225567 GCCACCCCCACAGCTAGCACAGG - Intronic
1118457568 14:65958585-65958607 GCTCCCACCCCAGCTAGCATGGG + Intronic
1118700411 14:68427250-68427272 GTCCCCTCTACACCTAGTATAGG + Intronic
1121338485 14:93091406-93091428 CTCCCCTCCACAGCTGGCCTCGG + Intronic
1127097768 15:55530175-55530197 GTTCCCACCACTGGTAACATTGG + Intergenic
1128313745 15:66647360-66647382 GTCCCCACCCCAGCCAGCCTCGG + Intronic
1130611575 15:85366008-85366030 GTCCCCACCAGAACTGGAATTGG - Intergenic
1131566004 15:93486036-93486058 CTCCCCATCCTAGCTAGCATGGG - Intergenic
1132586903 16:709551-709573 GACCCCTCCACAGCCAGAATGGG + Intronic
1134190227 16:12115246-12115268 GTCCCTACCACAGATAGGATGGG - Intronic
1138459000 16:57137026-57137048 GTCCCTGCCATGGCTAGCATAGG - Intronic
1139263798 16:65621320-65621342 GTCCCCACCACAGCTGACCCAGG + Intergenic
1141428137 16:83956822-83956844 TTCCCCACACCAGCTAGCAGCGG - Intronic
1141496298 16:84412715-84412737 CTCCCCACCCCTGCTAACATTGG + Intronic
1142372579 16:89691314-89691336 GTCCCCACCTCAGGGAGAATTGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1146920148 17:36704652-36704674 CTCCCCACCTCAGCTGGCATGGG - Intergenic
1151169125 17:72231920-72231942 TTCCCCAGGACAGTTAGCATTGG - Intergenic
1151501939 17:74495707-74495729 CTTGCCACCACAGCTTGCATAGG - Intergenic
1152375546 17:79917069-79917091 GTTCCCAGCACTGCCAGCATTGG + Intergenic
1152575111 17:81136504-81136526 GACCCCACCTCAGCTACCCTGGG + Intronic
1156494451 18:37516786-37516808 CTCACCCCCACAGCTGGCATGGG + Intronic
1157861060 18:51140442-51140464 CTCCCCTGCACAGCTAGCAAGGG + Intergenic
1160946942 19:1648079-1648101 TTCCCGACCAAAGCTAGCCTGGG + Intronic
1161338178 19:3725870-3725892 GGCCCCGCCATAGCTAGCACGGG + Intronic
1161766438 19:6211399-6211421 TTCCCCAGGACAGCTGGCATTGG + Intergenic
1162926104 19:13931206-13931228 TCCCCCCCCACAGCAAGCATGGG - Intronic
1166127027 19:40721117-40721139 TTCCCCAGCAAAGCTAACATAGG - Intronic
1166501906 19:43347854-43347876 TTCCACAGCACTGCTAGCATTGG + Intergenic
1167066062 19:47186987-47187009 GTCCCCACCACAGCTAGCATAGG + Intronic
929043741 2:37771340-37771362 CTCCCCATGACAGCTAGCAAGGG + Intergenic
930801909 2:55451689-55451711 GTTCCTGCCACAGCTAACATCGG - Intergenic
934871394 2:97869621-97869643 GTCCACACCACAGGAAGCAAAGG + Intronic
937473568 2:122194480-122194502 GCACCCACCACAACCAGCATGGG - Intergenic
938058430 2:128233695-128233717 GTCCCCACCGCGGCCAGCAGAGG - Intergenic
942982470 2:182099135-182099157 GTCAACATCACAGCTAGCACTGG - Intronic
947499745 2:230663285-230663307 GCACCCACCCCAGCTAGCCTAGG - Intergenic
948368082 2:237471693-237471715 GTCCCCACCCTAGCTGGCTTGGG + Intergenic
948383047 2:237564274-237564296 CCCCCCACCCCACCTAGCATGGG + Intergenic
949036320 2:241817116-241817138 GCCCCCCCCACAGCTATCGTGGG - Exonic
1169111737 20:3038573-3038595 ATCCCCACCACTGATATCATGGG + Exonic
1172034528 20:32001819-32001841 GGCCCCACCACAGCTTGAACTGG - Exonic
1172272165 20:33660714-33660736 GTCCCAGCCACAGCTAGGCTGGG + Intronic
1172476006 20:35238270-35238292 GTCACCCCAACAGCTAGCACAGG - Intronic
1175953666 20:62596969-62596991 GGCCCCACGACAGCAAGCGTTGG - Intergenic
1176136267 20:63523369-63523391 GTCCCCACCACACATGGCCTGGG + Intergenic
1178632736 21:34276888-34276910 GACCCCACCACAACGAGAATCGG - Intergenic
1179173552 21:38991399-38991421 GTCCCCTCCTCAGCTTGCAGAGG - Intergenic
1179502227 21:41817053-41817075 CTCCCCACCACAGCCAGCATTGG + Intronic
1180173298 21:46072342-46072364 TTCACCACCACACCCAGCATGGG - Intergenic
1181115816 22:20632058-20632080 GTCCCCACCACCCCAACCATAGG - Intergenic
1181442634 22:22944683-22944705 CTTCCCAGCACTGCTAGCATGGG + Intergenic
1184067700 22:42129720-42129742 GTCCCCACCGCTGCTTGCCTTGG + Exonic
1184853889 22:47136179-47136201 GCCCCCACCGCAGCTGGCACTGG - Intronic
1203295875 22_KI270736v1_random:42760-42782 TTCCCCATGACAGCTAGCAAGGG + Intergenic
952874981 3:37937247-37937269 GTCCCCACCAAAGCTCATATTGG + Intronic
953012475 3:39040050-39040072 GTGCCCACCACAGCTGGCAATGG + Intergenic
954457655 3:50608564-50608586 GTCCGCTCCACAGCCAGCAAAGG + Exonic
955185540 3:56711681-56711703 GGTCCCACCACAGCAAGCACCGG - Intergenic
960352114 3:116606720-116606742 CTGGCCACCCCAGCTAGCATCGG + Intronic
972347663 4:38206608-38206630 ATCCCTACCATAGCAAGCATTGG - Intergenic
973644816 4:52939969-52939991 GTCCCCAGCCCAGCTGGCTTAGG + Intronic
978491434 4:109315556-109315578 GTCCCCACCACAGATTGGACAGG - Intergenic
981469662 4:145116909-145116931 TCCCCTACTACAGCTAGCATGGG + Intronic
994958022 5:106560572-106560594 GTGCCCACCACATCAAGGATGGG + Intergenic
999325252 5:150639783-150639805 GTCCCCACCACATCTTCCATTGG - Intronic
1002211559 5:177602402-177602424 GGCCCCAGCACAGCAAGCACAGG - Intronic
1007228076 6:40328684-40328706 TTCCCCAGCACAGCTAGGAGTGG - Intergenic
1008355529 6:50548086-50548108 ATTCTCACCACAGCAAGCATTGG + Intergenic
1009623703 6:66108125-66108147 GGCCCCACCTCAGTTATCATGGG + Intergenic
1010808076 6:80262196-80262218 ATCCCTTCCACAGCTACCATAGG - Intronic
1012387118 6:98695180-98695202 GTTCTCCCCACAGCTAGCCTGGG - Intergenic
1016394554 6:143609258-143609280 GTCCTCGGCACAGGTAGCATAGG + Intronic
1016412171 6:143794989-143795011 TTCCCCACCACAACCAGCAAGGG - Intronic
1018054800 6:160042510-160042532 GTCACCAGCACAGCAAGCAAGGG - Intronic
1018501398 6:164414373-164414395 GTCCCCACCACTGTCATCATCGG + Intergenic
1020409073 7:7870606-7870628 GCCCCCACCACTGCTTCCATTGG + Intronic
1024554109 7:50588625-50588647 GGCCTCAGCACAGCTAGCAAAGG - Intergenic
1028880150 7:95871180-95871202 GTCCCCACAACAGCTTGTATAGG - Intronic
1031857762 7:126942651-126942673 GTCCCCAGTGCAGCTAGGATTGG + Intronic
1032471548 7:132182613-132182635 GTCCCCACCACATCCTGCAGGGG + Intronic
1035492950 7:159295873-159295895 ATCCACACCACAGCAAGCAGGGG + Intergenic
1038697754 8:29821122-29821144 GTCCCCCCCACATCTAAAATTGG - Intergenic
1039723302 8:40188003-40188025 ATCCCCAGCACACCTTGCATGGG - Intergenic
1040534584 8:48297607-48297629 GACACCACCACAGCTGGCAAAGG + Intergenic
1045904502 8:107327308-107327330 GTGGCCACCTCAGCTAGCATGGG + Intronic
1045912414 8:107425900-107425922 GTGCTCACCAAAGCAAGCATCGG + Intronic
1047094086 8:121605415-121605437 GTCTCCCCCACACCTAGCATAGG - Intergenic
1048605426 8:135963511-135963533 GTCTCCATCACAGCTATCAAGGG - Intergenic
1049248661 8:141576591-141576613 GTCCCGACCACAGCTCTCAGGGG + Intergenic
1049312733 8:141942057-141942079 TTTCCCACCACAGCCAGCATGGG - Intergenic
1051182912 9:14429743-14429765 CTCCCCACCACTGCTACCATGGG + Intergenic
1051869005 9:21715100-21715122 GTCCCCACAACTGCTCTCATGGG + Intergenic
1186388385 X:9133149-9133171 GGCTCCACCACCTCTAGCATTGG + Intronic
1193643437 X:84039622-84039644 GTCCCCACAGCTGCTATCATGGG + Intergenic
1199846680 X:151696519-151696541 GTCCCCCACACACCTAGCCTTGG - Intronic
1200224236 X:154408440-154408462 GTCCCCATCACAGGTTGCAATGG - Intronic