ID: 1167072771

View in Genome Browser
Species Human (GRCh38)
Location 19:47230534-47230556
Sequence GGGCGCGCGCCCGCTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 8, 3: 36, 4: 358}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167072771_1167072793 28 Left 1167072771 19:47230534-47230556 CCGCCCCCAGCGGGCGCGCGCCC 0: 1
1: 0
2: 8
3: 36
4: 358
Right 1167072793 19:47230585-47230607 CCCCGCCCCTCCCGGACTTTGGG 0: 1
1: 0
2: 3
3: 9
4: 214
1167072771_1167072791 27 Left 1167072771 19:47230534-47230556 CCGCCCCCAGCGGGCGCGCGCCC 0: 1
1: 0
2: 8
3: 36
4: 358
Right 1167072791 19:47230584-47230606 CCCCCGCCCCTCCCGGACTTTGG 0: 1
1: 0
2: 0
3: 23
4: 277
1167072771_1167072795 29 Left 1167072771 19:47230534-47230556 CCGCCCCCAGCGGGCGCGCGCCC 0: 1
1: 0
2: 8
3: 36
4: 358
Right 1167072795 19:47230586-47230608 CCCGCCCCTCCCGGACTTTGGGG 0: 1
1: 0
2: 2
3: 8
4: 210
1167072771_1167072786 20 Left 1167072771 19:47230534-47230556 CCGCCCCCAGCGGGCGCGCGCCC 0: 1
1: 0
2: 8
3: 36
4: 358
Right 1167072786 19:47230577-47230599 TGCCGCCCCCCCGCCCCTCCCGG 0: 1
1: 0
2: 4
3: 69
4: 605
1167072771_1167072797 30 Left 1167072771 19:47230534-47230556 CCGCCCCCAGCGGGCGCGCGCCC 0: 1
1: 0
2: 8
3: 36
4: 358
Right 1167072797 19:47230587-47230609 CCGCCCCTCCCGGACTTTGGGGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167072771 Original CRISPR GGGCGCGCGCCCGCTGGGGG CGG (reversed) Intronic
900091773 1:923943-923965 TGGCGCGCGCCCGCCCGGCGGGG - Intergenic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
900164087 1:1237783-1237805 GGGTGCGGGGCCCCTGGGGGAGG - Intergenic
900522329 1:3111641-3111663 GGGCGCACGCCCCCTGGGGCGGG + Intronic
901084628 1:6602984-6603006 GAGCCCGCGCTCGCGGGGGGCGG - Intronic
901242868 1:7704958-7704980 GGGCGCGCGCGGGGCGGGGGCGG + Intronic
901433883 1:9234724-9234746 GGGGGCGCGCGCGGCGGGGGCGG - Intergenic
901506594 1:9689483-9689505 GGCGGGGCGCCGGCTGGGGGCGG - Intronic
901762659 1:11480658-11480680 GTGCACGCGCGCGCTGGGGGTGG - Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
902505964 1:16939191-16939213 GGGCTCGCGCCCTCCGGGTGGGG + Intronic
903154956 1:21436859-21436881 GGGCTCGCGCCCTCCGGGTGGGG + Intergenic
903349867 1:22711058-22711080 GGGCGGGCGGGCGATGGGGGCGG + Intronic
903724586 1:25431193-25431215 GGGCCCGCGCCCGCGGAGTGGGG - Intronic
903738160 1:25543522-25543544 GGGCGCGGCCCGTCTGGGGGCGG + Intergenic
903750343 1:25617249-25617271 GGGTGTGCGCGCGCTCGGGGCGG + Intergenic
904181349 1:28668858-28668880 GGGCGCGCGGGCGCGGGGTGGGG + Intronic
906027143 1:42682959-42682981 CGGCGCGCGGCCGCAGGGGGAGG - Intronic
907080437 1:51617024-51617046 GGGGGCGGGGCCGCAGGGGGCGG - Intronic
907278145 1:53328139-53328161 GGGAGCGCGCGCGCTGGCGGCGG - Intergenic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
907766974 1:57422501-57422523 GGGTGCGCGCCCGCGTGGGTCGG - Intronic
908355534 1:63322829-63322851 CGGAGCGCGGCCGCTGGGGGCGG + Intergenic
908534864 1:65067534-65067556 GGCCGAGCGCCCGCGGGAGGCGG - Intergenic
912401605 1:109397940-109397962 TGGCGCGCGCCGGCGGGGGTGGG - Exonic
912556457 1:110519740-110519762 GTGCGCGCGCACGCTGGAGGTGG + Intergenic
912576262 1:110675003-110675025 GGGCGCGCGCCCCGCAGGGGAGG - Exonic
914679256 1:149927605-149927627 GGTCTCGCGCCCTCTGGGGAAGG + Intronic
914869091 1:151458701-151458723 GGGCGGTGGCCCGCTGGGGAAGG - Intronic
915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG + Exonic
915214129 1:154328854-154328876 GGGCGCGCGCCCGACGGCTGGGG + Intronic
915722168 1:157993553-157993575 GGGCGCGGGCGGGCGGGGGGCGG + Intronic
918048344 1:180954403-180954425 GTGCGCGCGTGTGCTGGGGGCGG - Intergenic
918480679 1:184974129-184974151 CGGAGCGCGCCGGCTGGGGCAGG + Intronic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
923490486 1:234479214-234479236 GGGCGCGCGGCCGCAGAGAGGGG + Intergenic
924527071 1:244863053-244863075 GAGCGCGGGCCCGCGGGGGAGGG - Intronic
1062874124 10:931582-931604 GGGCGGGCGCGAGCTGGCGGCGG + Exonic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1065025061 10:21534011-21534033 GGGGGCGCGCACGCGGGGGCGGG - Intergenic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065342892 10:24723398-24723420 CGGCGGGCGCCCGGCGGGGGCGG - Intronic
1066370461 10:34815003-34815025 GGGCGCGGGCCCGCCCGCGGCGG - Exonic
1067116251 10:43437328-43437350 GGGACTGGGCCCGCTGGGGGTGG + Intronic
1069991628 10:72319882-72319904 GGGAGGGCGCCCGGTGCGGGGGG + Intergenic
1071309389 10:84328596-84328618 GGGCGGGCGCCGGCCGAGGGAGG + Exonic
1071529279 10:86376915-86376937 GCGCGCGCGGCCTCTGGGGAGGG - Intergenic
1071573701 10:86711435-86711457 GGGCGGGCGCGCGCTGGAGTCGG + Intronic
1071997735 10:91163561-91163583 GGGCGCGCGGCTGCCGGCGGGGG - Intronic
1073146739 10:101286133-101286155 GCCTGCCCGCCCGCTGGGGGTGG + Intergenic
1073287951 10:102399653-102399675 GGACGCGCGCGCGCTGCTGGCGG + Exonic
1076409065 10:130232991-130233013 AGGCGCGTGCCCGATGGGGATGG + Intergenic
1076707024 10:132307757-132307779 GGGCGCGCGCGGCCGGGGGGCGG + Exonic
1076792917 10:132786248-132786270 GGGGGCGCGCGGGCGGGGGGGGG - Intergenic
1076889550 10:133276959-133276981 GGGCGCGCGGCACCTGGGGGCGG + Intergenic
1077021060 11:417341-417363 GGGCTCGCGCCGGGCGGGGGCGG + Intronic
1077383210 11:2257145-2257167 TGCCGCCCGCCCGCTGGGGCTGG - Intergenic
1077495277 11:2884211-2884233 GGGCGCGGGCCGGCCGGGGTGGG + Intronic
1077505851 11:2929682-2929704 GGGCGAGCGCCCGGGCGGGGCGG - Intergenic
1079251553 11:18791349-18791371 GGGCGCCCGCATGCTGGGGGAGG - Intronic
1081528279 11:43942078-43942100 GCGCGCGCGCCTGCGGAGGGGGG + Intronic
1083657001 11:64234604-64234626 GGGCGGGCGGCCGGTGGCGGCGG - Exonic
1083747636 11:64744645-64744667 CGGCGCGGGCGGGCTGGGGGCGG - Intronic
1083753614 11:64777794-64777816 GTGCGCACGCGCGCTGTGGGGGG - Intronic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084736521 11:71108924-71108946 GGGGGGGGGCCCGCTGGGTGTGG - Intronic
1084792664 11:71484460-71484482 GGGCCGGCGTCCCCTGGGGGTGG + Intronic
1085165899 11:74398761-74398783 GGGCACGCGCCGGTTGGGGGAGG + Intergenic
1086424679 11:86672042-86672064 GGGGACGCGCCCTCTGGGAGAGG + Intronic
1088869025 11:113875648-113875670 GTGCGCGCGCATGCCGGGGGCGG - Intergenic
1091976837 12:4832347-4832369 GGGCGCACTGCCGCTGGGGTGGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092843342 12:12562956-12562978 GGGCGCGCGGGCGCGGGAGGAGG - Intergenic
1093464860 12:19439410-19439432 GGGCGGGCGCCGGGCGGGGGCGG + Intronic
1096710632 12:53452629-53452651 GGGCGCGCGCGCGGTAGGGGGGG + Intronic
1096980966 12:55728233-55728255 GGGGGCGCGCCGGCAGGGTGCGG - Intronic
1097981718 12:65742452-65742474 GGGCGCTCCCCGGCGGGGGGAGG + Intergenic
1098369188 12:69739077-69739099 GGGCGCGCGGGCGCCGAGGGGGG - Intronic
1100565323 12:95789845-95789867 GGGCGCGCGTGGGCTGGGGCCGG - Intronic
1100632006 12:96399516-96399538 GGGCGCGGGTCCGCGGGAGGTGG - Intronic
1101679997 12:106955741-106955763 GGGCGTGTGCCCGGTGGGCGCGG + Exonic
1102025800 12:109713883-109713905 CTGCGCGCGCCGGCCGGGGGAGG + Intergenic
1103348365 12:120265789-120265811 GGGCGCGCGTGCACAGGGGGCGG - Intergenic
1104929376 12:132329787-132329809 GGGCGCGCGGGCGCGGGGAGCGG + Intergenic
1106109041 13:26760828-26760850 GGGCGCGCGCGGGGCGGGGGCGG - Intergenic
1107770933 13:43786985-43787007 GCGCGCGCGCCCACGGGGTGGGG + Intergenic
1113868514 13:113544225-113544247 AGGCTCGTGCCCGCTGGGTGAGG + Intronic
1115651295 14:35404353-35404375 GGACGCGCGCGGCCTGGGGGTGG - Intronic
1117392068 14:55271646-55271668 GGGCGCGGGGCGGGTGGGGGTGG + Intronic
1117902555 14:60550656-60550678 GGGTGTGTGCCTGCTGGGGGTGG + Intergenic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1119296505 14:73537608-73537630 GAGCGCGCGCCCGCGCTGGGCGG + Exonic
1119300750 14:73569613-73569635 GAGCGCGCGCCCGCGCTGGGCGG + Exonic
1119306590 14:73612758-73612780 GAGCGCGCGCCCGCGCTGGGAGG + Intronic
1121671594 14:95714364-95714386 AGGCGCGGGCCAGCTGGGGCCGG - Intergenic
1122137953 14:99645469-99645491 GGGCGCGCGGCCACCGGGCGGGG + Intronic
1122719894 14:103716086-103716108 GGGCGGGGGCCGGCTGGGGAAGG - Intronic
1122743610 14:103885642-103885664 GGGCACTCGCCCGCTGGAGCAGG - Intergenic
1123037942 14:105478905-105478927 GGGCACGCGCGGGCTGGGGCTGG + Intronic
1202872460 14_GL000225v1_random:177333-177355 GGGCGTTCGCCCGCGGAGGGCGG - Intergenic
1123758837 15:23417111-23417133 GGCCTCGGGCCGGCTGGGGGCGG + Intergenic
1124922219 15:34038606-34038628 GGGGGCGCGCCTGGTGGCGGGGG - Intronic
1125503353 15:40252854-40252876 GGGCGGGCGCCCGCGGAGGGAGG - Exonic
1125541146 15:40470924-40470946 GGGCGGGCCCACGCCGGGGGCGG - Intergenic
1126055845 15:44729065-44729087 GGACGCGCCCAGGCTGGGGGCGG - Exonic
1128067880 15:64775644-64775666 GGGCGGGCGCCGGCGGCGGGGGG + Intergenic
1128087285 15:64894826-64894848 GGGAGGGAGCCCACTGGGGGAGG + Intronic
1128089812 15:64911865-64911887 AGGCGCGCGTCCGCCGGGGCGGG - Intronic
1128733012 15:70033693-70033715 GCCCGCCCGCCCGCTGGGGTAGG - Intergenic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129983550 15:79896714-79896736 GGGCGTGCGCGCGCCGGGAGGGG + Intronic
1130023698 15:80252106-80252128 GGGCGCGGGCTCGCGGGGCGCGG + Intergenic
1130540336 15:84817335-84817357 GGGCGCGCGTCAGCCGCGGGCGG + Exonic
1131839120 15:96417175-96417197 GGGTGGCCGCGCGCTGGGGGAGG - Intergenic
1132163990 15:99566515-99566537 GGGCGCGCACCCCTTGGGGCCGG + Intronic
1132558616 16:583552-583574 GGGCCCGGGCCCGCTGGGGACGG - Exonic
1132719653 16:1309491-1309513 GGGCGCGCGGCGGCGGGGCGCGG + Intronic
1132838129 16:1964888-1964910 CGGCCCGCTCCCGCTTGGGGCGG - Intergenic
1133156436 16:3880059-3880081 GGGCGCAGGCCGGGTGGGGGAGG + Exonic
1133219926 16:4315653-4315675 GGGGGCGGGGCCGCGGGGGGGGG + Intronic
1133784447 16:8963629-8963651 GGCCGCGGGCCGGCCGGGGGCGG + Intronic
1134053177 16:11151822-11151844 GGGCGGGGGCCGGCTGGGGAAGG + Intronic
1136540008 16:30923814-30923836 GGGTGCGCGCGGGCTGGGGGGGG + Intronic
1136636855 16:31529593-31529615 GGGCGGGGGCGCGCGGGGGGAGG + Intergenic
1137531725 16:49282299-49282321 GTGGGCGCGCCCGTTGGGAGGGG + Intergenic
1137787757 16:51151892-51151914 GCGCGCCGGCCCGCGGGGGGAGG + Intergenic
1138360807 16:56425616-56425638 GGCGGCGCGACCGCTGGGGGCGG - Intergenic
1139496937 16:67326772-67326794 GGCGGCGCGCGCGCGGGGGGCGG + Intergenic
1139664507 16:68447083-68447105 GGGGGCGCGGCCGCGGAGGGGGG - Intronic
1140462249 16:75148966-75148988 GGGCGCGCGCGCGCGGGACGAGG + Intronic
1140481639 16:75265665-75265687 GAGAGCGCACCGGCTGGGGGAGG - Intronic
1141828647 16:86497636-86497658 AGGGGCGCGCCGGCTGGGGCCGG - Intergenic
1141920732 16:87133786-87133808 GGTCGCGCTCCCTCTAGGGGAGG + Intronic
1142374778 16:89701344-89701366 GGGCGCCCAGCCGCTGGGGGCGG - Intronic
1142429746 16:90019569-90019591 GGGCGCGCGCGGGCCGGGGCGGG - Intronic
1142863348 17:2776607-2776629 GGGCGCGCCCCGGGTGGCGGAGG + Intergenic
1143099796 17:4498819-4498841 GGGCGCGGGCCTGGTGGGCGGGG + Exonic
1143548616 17:7614909-7614931 GGGCACCCGCCCGCTGCGCGCGG + Intronic
1143749980 17:9021230-9021252 AGGCGCGCACCCCGTGGGGGAGG - Intergenic
1144172833 17:12676226-12676248 GTGCGTGCGCGCGCAGGGGGAGG - Intronic
1144565137 17:16353478-16353500 GGGCGCGCGCAGGCCGGCGGGGG - Exonic
1144816597 17:18039597-18039619 GGGCGCGCACGCGCGGGGTGGGG - Exonic
1145962892 17:28897664-28897686 GGGCGGCCGGCCGCTGGGGGTGG - Exonic
1147028310 17:37609024-37609046 GAGCGCGCGCCCAGTGTGGGAGG - Intronic
1147286002 17:39402532-39402554 GGGCGCGCGTCCGTGGGGGTGGG + Intergenic
1147690609 17:42312536-42312558 GGACGCGCGCTCCCTGGGCGGGG + Intergenic
1147914938 17:43880540-43880562 GGGTGCACGCCCTCTGTGGGTGG - Intronic
1147969157 17:44210506-44210528 GAGCGCGCGCCCCCTGGGGGTGG - Intronic
1147987035 17:44312710-44312732 GGGGGAGGGACCGCTGGGGGAGG - Intronic
1148013358 17:44503461-44503483 CTGCGCGCGCCCGGTGGGCGTGG - Intergenic
1148271746 17:46266968-46266990 CGGCGCGCGGCCGGTTGGGGTGG - Intergenic
1148284092 17:46372782-46372804 GGGCGCGCGCGCGGCGGGGGCGG + Intergenic
1148306313 17:46590703-46590725 GGGCGCGCGCGCGGCGGGGGCGG + Exonic
1148331913 17:46818439-46818461 GTGGGGGCGCCGGCTGGGGGTGG - Intronic
1148722457 17:49763819-49763841 GGGCGCGTGACCGCGGGAGGGGG - Intronic
1148936190 17:51166282-51166304 GGGCGCGCCCCGGCTGGGCGTGG + Intronic
1149772421 17:59332044-59332066 GGGCCCGCGGCCGCTCGCGGAGG + Intronic
1150268004 17:63843069-63843091 GGGGCGGTGCCCGCTGGGGGCGG - Intergenic
1150764640 17:67993586-67993608 CGGCGCGCGGCCGGTTGGGGTGG + Intronic
1151490925 17:74432025-74432047 GTGCGCGCGCCCGCATGCGGGGG + Exonic
1152364058 17:79844940-79844962 GGGAGCCCGCCCCCTAGGGGAGG - Intergenic
1152628851 17:81400579-81400601 GCGCGGGCGCGGGCTGGGGGTGG + Intronic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1153219161 18:2847165-2847187 CGGGGCGCGCCCGCTGCGCGCGG + Exonic
1153805223 18:8705090-8705112 GGGCGGGCGCCCGGCAGGGGCGG - Intergenic
1154210882 18:12377470-12377492 GGGCGAGCGAGAGCTGGGGGCGG + Intergenic
1156275875 18:35581989-35582011 GGGCGCGGGCACGCTCGGCGCGG + Intronic
1157763608 18:50282083-50282105 GGGCGCGCCCCTGCAGGAGGCGG + Intergenic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160630977 18:80246617-80246639 GGGGGCGCGCCCGTGGGGGTGGG + Intronic
1160724823 19:613500-613522 GGGGGCGCGCCTGGAGGGGGAGG + Intronic
1160726789 19:620967-620989 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160726800 19:620988-621010 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160778325 19:866795-866817 GGGTGCGGGCCCGCGGCGGGTGG - Intergenic
1160778341 19:866846-866868 GGGTGCGGGCCCGCAGTGGGCGG - Intergenic
1160778356 19:866897-866919 GGGTGCGGGCCCGCAGTGGGTGG - Intergenic
1160778371 19:866948-866970 GGGTGCGGGCCCGCAGTGGGTGG - Intergenic
1160856186 19:1219010-1219032 GGGCCCGAGCCTGCTTGGGGGGG + Intronic
1160952922 19:1676079-1676101 GGGCTCGTTCCCGGTGGGGGGGG + Intergenic
1160967547 19:1753307-1753329 CCGCCCGCGCCCGCTGGGGCAGG - Exonic
1160976841 19:1796893-1796915 GGGCACGGGCCGGCTGTGGGTGG + Intronic
1160991982 19:1863780-1863802 CCGCGCGCGGCCGCCGGGGGCGG + Intergenic
1161063761 19:2227825-2227847 GGGCCCGAGCCCGCTGCAGGCGG + Intronic
1161153443 19:2721062-2721084 GGGCGCCCTCCGGGTGGGGGAGG + Intronic
1161793214 19:6373100-6373122 GGGCGGGGACACGCTGGGGGCGG + Intronic
1161793290 19:6373319-6373341 GGGCGGGGGCACTCTGGGGGCGG + Intronic
1161793304 19:6373365-6373387 GGGCGTGGCCACGCTGGGGGCGG + Intronic
1162103324 19:8354016-8354038 GGCTGCCCGCCCGCTGTGGGAGG - Intronic
1162339855 19:10086014-10086036 GGGGGAGCGCGCGCTGGGTGGGG + Intergenic
1162915591 19:13872979-13873001 GGGGGCGTGCCCGGTCGGGGCGG + Intronic
1163551149 19:17967096-17967118 GGGCGAGCGCCCGCCCGGGCCGG - Intronic
1163577213 19:18117958-18117980 GGGGGCGGGGCCGTTGGGGGCGG - Intronic
1163636012 19:18437519-18437541 GGGCGGGAGCCTGCAGGGGGCGG - Intronic
1163725154 19:18919186-18919208 GGGCGCGGGGACGCTGGGGGCGG - Intronic
1164648133 19:29873738-29873760 GGGCGCGGGGGCGCTGGGTGGGG - Intergenic
1164713303 19:30374793-30374815 GCCCGGGCGCCGGCTGGGGGTGG - Intronic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165431388 19:35775487-35775509 CGGCGCGCGCCCCACGGGGGCGG - Intronic
1166064327 19:40348323-40348345 GGGCGCGGGCCCGGTGGGCCAGG - Intronic
1166094449 19:40530440-40530462 GGGCGCGCGGCCGCCGCGCGGGG + Intronic
1166306904 19:41940412-41940434 GGGCGCGCGGCGGCGGGGGAGGG - Intergenic
1167001201 19:46746511-46746533 GGGCGCGCGCGCGGTGGTTGCGG - Exonic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167232137 19:48291411-48291433 GGGAGCGCGCCACCTGGCGGCGG + Intergenic
1167311224 19:48739033-48739055 GGGCGCGGCCCGGCTGGGCGCGG - Exonic
1167757594 19:51422092-51422114 GGTGGAGCGCCCCCTGGGGGCGG - Intergenic
1168343748 19:55640855-55640877 GGGAGCGGGGCCGCCGGGGGCGG + Intronic
925984674 2:9206533-9206555 GGCCTCGGGCCGGCTGGGGGCGG + Intergenic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
926051208 2:9746003-9746025 GGGCTCAGGACCGCTGGGGGTGG + Intergenic
926268239 2:11344871-11344893 GGCCGAGCTCCTGCTGGGGGAGG + Intronic
927168737 2:20350848-20350870 CTGCGCGCGCCCGGTGGGCGGGG - Intronic
928928054 2:36598145-36598167 GGGCGCGCGACTGCTCCGGGCGG - Exonic
929313284 2:40450370-40450392 GCACGCGCGCGCGCTGGTGGGGG + Intronic
931348970 2:61471282-61471304 GGGCGAGCGCGCGGAGGGGGTGG - Intergenic
933278052 2:80303697-80303719 CTGCGGGCACCCGCTGGGGGCGG + Exonic
933791827 2:85889098-85889120 GGCCGCGCGCCCGGGGGCGGGGG - Intergenic
934716985 2:96550137-96550159 CGGCGGGCGCCCCCTGGCGGCGG - Intronic
934921250 2:98346908-98346930 GGGCTGGCTCCCGCTGGGGACGG + Intronic
935746571 2:106194335-106194357 GGGCGCGCGGCGGCAGGAGGCGG - Exonic
941021024 2:160407904-160407926 GAGAGCGCGCCGGCCGGGGGCGG + Intronic
945119510 2:206443569-206443591 GCGGCCGCGCCCGCCGGGGGAGG + Exonic
947754324 2:232550795-232550817 GCGCCCGCCCCCGCTGGGGCTGG + Intronic
1168965093 20:1894256-1894278 GGGCGCGGGGGCGCGGGGGGCGG - Exonic
1169164114 20:3407683-3407705 GCGCGCGGGCCCGGCGGGGGCGG + Intergenic
1169244593 20:4015577-4015599 AGGGGCGGGCCCGCCGGGGGAGG + Intronic
1169557552 20:6767482-6767504 GGGCGCGCGGCCGCCAAGGGGGG - Intergenic
1170558022 20:17531149-17531171 GGGCGCGGGCCCGCTGGACGTGG + Exonic
1170999436 20:21397431-21397453 GGGCGCGCGCCGGCAGGACGCGG + Exonic
1172529308 20:35619114-35619136 GGGGGCGCGGGGGCTGGGGGCGG - Intronic
1173516173 20:43667028-43667050 TGGCGCGCGGGCGCCGGGGGAGG - Intronic
1174298890 20:49568184-49568206 AGGGGCGCGCCGGGTGGGGGCGG - Intergenic
1175428738 20:58888769-58888791 CGGCGCGCGCCCGCCGAGGTAGG - Intronic
1175429600 20:58891944-58891966 GAGCGCGCGCCCGGGGCGGGGGG - Intronic
1175847312 20:62065562-62065584 GGGCGCGCCCTCGGCGGGGGCGG + Exonic
1175847420 20:62065932-62065954 GGGCGCGCGGCCGGGGGGCGGGG + Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176242403 20:64081129-64081151 GGGCGGGGGCCCGAAGGGGGAGG + Intronic
1176341069 21:5696639-5696661 GAGTCCGCGACCGCTGGGGGTGG - Intergenic
1176414465 21:6466992-6467014 AGGTGGGTGCCCGCTGGGGGAGG - Intergenic
1176473323 21:7128792-7128814 GAGTCCGCGACCGCTGGGGGTGG - Intergenic
1176503758 21:7627817-7627839 GAGTCCGCGACCGCTGGGGGTGG + Intergenic
1176550108 21:8217233-8217255 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176567880 21:8396415-8396437 GGGCGCGCGTACGCGCGGGGAGG - Intergenic
1176569036 21:8400268-8400290 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1176575784 21:8440634-8440656 GGGCGCGCGTACGCGCGGGGAGG - Intergenic
1176576950 21:8444503-8444525 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1177782845 21:25639360-25639382 AGGCGCGGGCAGGCTGGGGGTGG - Exonic
1179689963 21:43075314-43075336 AGGTGGGTGCCCGCTGGGGGAGG - Intronic
1179785801 21:43728995-43729017 GGGCGCACGCCTGCAGGTGGGGG + Intronic
1180014637 21:45074383-45074405 GGGCGCGGGGCCGTTGGGGCTGG - Intronic
1180064298 21:45405066-45405088 GGGCGGGCGCGGGCAGGGGGCGG - Intergenic
1180082706 21:45494008-45494030 GGGCGGCTGCCTGCTGGGGGTGG - Intronic
1180156249 21:45978489-45978511 GGGAGCTCACCCGCTGTGGGTGG + Intergenic
1182355364 22:29720312-29720334 GGGCGCGCGGCTGCGGAGGGCGG - Exonic
1182429014 22:30289375-30289397 GGGCGCGCACCGGCTGCGGCGGG + Exonic
1183264507 22:36817105-36817127 GGGCGCACGCCCGCCGGGCCTGG + Intronic
1183476492 22:38038785-38038807 GTGCGGGCGCCGGCGGGGGGAGG - Intronic
1183605877 22:38866518-38866540 CGGCTCGCGCCAGCTGGGGGCGG + Exonic
1183649444 22:39145652-39145674 GTGCGCGCGGCCGGCGGGGGCGG - Intronic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1184418163 22:44364050-44364072 GGGCGAGCCCCCCCAGGGGGAGG - Intergenic
1184523001 22:45007086-45007108 GGGCGCGCGGCCGGGGGCGGGGG + Intronic
1184593820 22:45502726-45502748 GGGCGCGCGCCCACGGCTGGGGG - Intronic
1184639320 22:45860754-45860776 GGGCCCGCCCCCGTTGGGGAGGG - Intergenic
1184759516 22:46536843-46536865 GCGTGCGCGCCCGCAGGCGGCGG + Exonic
1203240335 22_KI270733v1_random:11097-11119 GAGTCCGCGACCGCTGGGGGTGG - Intergenic
1203255000 22_KI270733v1_random:133562-133584 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203263056 22_KI270733v1_random:178641-178663 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
949559478 3:5188326-5188348 GGGCGCGCGGCCCCGGGCGGCGG - Intronic
950345319 3:12287838-12287860 GCGCGGGCGCCGGCTGGGGGTGG - Intronic
951544481 3:23810795-23810817 GGGCGCGCGCGGGGTGGGGGCGG + Intronic
954186272 3:48919153-48919175 GGGCGCCCGGCCGCTGACGGCGG - Exonic
954663668 3:52239157-52239179 GGGCGGGGCGCCGCTGGGGGCGG - Exonic
956605005 3:71065074-71065096 GGGCGCGCGGGCGCGGGGCGCGG - Intronic
956867397 3:73383724-73383746 GGGCGCGCTCCCGCAGCAGGCGG + Exonic
959539414 3:107523299-107523321 GGGAGCGGGCCGGCTGGCGGCGG - Intronic
960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG + Intronic
961347101 3:126270377-126270399 GGCCGGGCGCCCGCCTGGGGAGG - Intergenic
961664652 3:128488066-128488088 GGGGGCCCGCCGGCTGAGGGGGG - Intronic
963160757 3:142149144-142149166 GGGCGCGGGCCCGCGCGCGGAGG - Intronic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
965590558 3:170357368-170357390 GGGCGCGCGCCTGGGGGGAGGGG + Intergenic
966593003 3:181702016-181702038 GTGCGCGCGCGCGCATGGGGGGG - Intergenic
966764433 3:183447463-183447485 GGGCTCGTGCCCGCGGGGTGTGG - Intergenic
967596217 3:191329328-191329350 GCGGGCGGGCCGGCTGGGGGAGG - Exonic
968585514 4:1414425-1414447 GGGCGCGTGTCCGCGGGAGGGGG + Intergenic
968585531 4:1414486-1414508 GGGCGCGTGTCCGCGGGAGGTGG + Intergenic
968585555 4:1414547-1414569 GGGCGCGTGTCCGCGGGAGGGGG + Intergenic
968585572 4:1414608-1414630 GGGCGCGTGTCCGCGGGAGGTGG + Intergenic
968585594 4:1414669-1414691 GGGCGCGTGTCCGCGGGAGGTGG + Intergenic
968585606 4:1414700-1414722 GGGCGCGTGTCCGCGGGAGGTGG + Intergenic
968674602 4:1870979-1871001 GGGCGCGCGGCCGCGGAGGCTGG - Intergenic
968831403 4:2934464-2934486 GGGGGCGCGCGGGGTGGGGGCGG - Intronic
969239237 4:5888338-5888360 GTCAGCGCGCCCGCTGGGAGCGG - Intronic
969271350 4:6105434-6105456 GGCCGCGTGCCCGCGGGCGGGGG + Intronic
969350306 4:6594471-6594493 GGGCGCTCGCCCAGTGGGGGTGG - Intronic
969394117 4:6909709-6909731 GGGCGCGGGCCGGCAGGGGGCGG + Intronic
969613232 4:8238416-8238438 GGGCGGGCGCCTGCTGGGCAAGG - Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970637140 4:18021835-18021857 GAGCGCGCGCCCCCCGGAGGGGG + Exonic
971195792 4:24471155-24471177 GGGAGCTGGCCCGCTAGGGGTGG - Intergenic
977848170 4:101790924-101790946 GGGCGCTGGGCCGCAGGGGGCGG - Exonic
978749532 4:112231710-112231732 GGGCCTGGGCGCGCTGGGGGCGG + Intergenic
983238630 4:165207431-165207453 GGGCGGGCGCCAGCCGGGTGCGG - Intronic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
985129024 4:186723629-186723651 GGGCGCGGGCCGGCGGGCGGGGG - Intronic
988559309 5:32266132-32266154 AGGCGCCCACCCTCTGGGGGAGG - Intronic
992487527 5:77210686-77210708 GCGCGCTCCCCCGCTCGGGGAGG + Intronic
992627430 5:78648460-78648482 GGGCCCGCGCGCGCTGCGGGAGG - Intronic
993519463 5:88883240-88883262 GGGAGCGCGCGCGAGGGGGGGGG + Intronic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
995512444 5:112922316-112922338 GGGCGCGCGGCGGCCGGGCGGGG - Exonic
997727323 5:136132798-136132820 GGGAGGACGCCCGCTGGGGTCGG - Intergenic
998371523 5:141665005-141665027 GGGGGCGCGGCTGGTGGGGGCGG - Exonic
999375108 5:151081123-151081145 GGGCCCGCGGCCGCCTGGGGTGG + Intronic
1000014554 5:157266038-157266060 GGGCGGGCGCTGGGTGGGGGCGG + Intergenic
1002487610 5:179550519-179550541 GGGCGGGCGCGGGGTGGGGGCGG - Intergenic
1002527284 5:179821583-179821605 GGGCGAGCGCCGGCGAGGGGAGG + Intronic
1002580881 5:180208963-180208985 GGGCGCGGGCTCGCGGGGGCTGG - Intronic
1002638917 5:180621382-180621404 CGGCGCGCCTCCGCAGGGGGCGG + Intronic
1004561805 6:16759969-16759991 GTGCGCGCGCGCGCCGGGCGGGG - Intronic
1005825202 6:29628083-29628105 CGGCGCGCGGCAGCGGGGGGTGG + Intronic
1005964878 6:30720285-30720307 GGGCGCGCGTGCGCCGGGGCTGG - Exonic
1006083529 6:31580995-31581017 GGCCGGGCGCCCCCTGGCGGCGG - Exonic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1007693601 6:43718122-43718144 GGGCGCGCCCTGGCTGGGAGAGG + Intergenic
1008160479 6:48069176-48069198 GGGCGGGAGCACGTTGGGGGTGG + Intergenic
1011277399 6:85643643-85643665 GGGCGGGAGCTCGGTGGGGGTGG - Intronic
1012245787 6:96924493-96924515 GGGAGCGAGCGCGCTGGCGGCGG + Intergenic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1015366372 6:132401538-132401560 GGCCGCGCGCCCGCCCGGGAGGG + Exonic
1016340893 6:143060762-143060784 GGGCGCGCGCCCCCGGGGACTGG - Intronic
1017737946 6:157381020-157381042 GGGCGCCCGCCCGAGGGGGCTGG + Intergenic
1018757488 6:166862733-166862755 GGGTGTGCGCGTGCTGGGGGTGG - Intronic
1019111961 6:169724076-169724098 GGGCGCGCGGCGGCAGGGGCCGG - Intronic
1019196616 6:170286898-170286920 TGGCACGCGCGAGCTGGGGGCGG + Intronic
1019689619 7:2403469-2403491 GGGCGCAGGCGCGCTGAGGGCGG + Intergenic
1020278219 7:6637276-6637298 CCGCCCGCGCCCGCGGGGGGAGG - Intergenic
1022721258 7:32943212-32943234 CGGGGAGCGCCCGCTGGCGGCGG + Intergenic
1024930682 7:54664456-54664478 GGGCGCGCGGCCGCGAGGGTCGG + Intergenic
1025033017 7:55572501-55572523 GAGCGCGCGGCGGCCGGGGGCGG - Exonic
1025078665 7:55964463-55964485 GGGCGCGCGGCCGCGGGGGTCGG - Intronic
1025901820 7:65751007-65751029 CGGCGCGGGCACGCTAGGGGCGG + Intergenic
1026850323 7:73719573-73719595 GGGCGGCCGCGCGCTGGGGCCGG + Intronic
1028593986 7:92528535-92528557 GGGGGCGGGGCCGCAGGGGGCGG - Intergenic
1028841550 7:95434791-95434813 GGGAGGGCGCAGGCTGGGGGAGG - Intronic
1030820501 7:114086476-114086498 GGGGGCGCGCCCGGGGAGGGGGG - Intronic
1033300079 7:140177301-140177323 GGGCGCGCGGCCGCAGCCGGAGG + Intergenic
1034879168 7:154750515-154750537 GGGAGCGCCCCCGCCGTGGGAGG - Intronic
1037811471 8:22089395-22089417 GGGCGCGGGCCCCCTCGGGCAGG + Intronic
1037826861 8:22165021-22165043 GGCCGCGCGCCAGCCGGGGCGGG - Exonic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038008839 8:23457699-23457721 CGGAGCGCGCCCGCTGGCGGCGG + Intergenic
1040032974 8:42842956-42842978 GGGCGCGCGGCCGGCGGGGCCGG - Intronic
1040501377 8:48008336-48008358 CGCCCCGCGCCCGCCGGGGGCGG + Intergenic
1041068159 8:54101907-54101929 GAGCGTGCGCCCGGTGGGGCCGG - Exonic
1042155426 8:65840926-65840948 GGGCGCGCGGGAGCTGGGGGAGG + Intronic
1044988656 8:97776270-97776292 GGGCCAGCGCCGACTGGGGGAGG + Intronic
1047961726 8:130016255-130016277 GGGCGCGCGCGTGATGGGTGCGG - Intronic
1049212182 8:141391917-141391939 GGGCGCGCGGCCGCGGCGTGGGG + Intergenic
1049218594 8:141418694-141418716 GGCCGCGGGCCTGGTGGGGGTGG + Intronic
1049396443 8:142403194-142403216 GGGGGCGCGCACGCCGGCGGCGG - Intronic
1049548537 8:143246097-143246119 GGGCGCGCACGCGGTGGCGGCGG + Intergenic
1049548647 8:143246458-143246480 CGGGGCGGGGCCGCTGGGGGCGG + Intergenic
1049645500 8:143733963-143733985 GGGCGCGCGGCCGCAGGGCACGG - Intergenic
1051206406 9:14693403-14693425 GCCCGCGCGCCCGCGTGGGGAGG + Exonic
1051513645 9:17906610-17906632 GGGAGCGCGTGCGCTGGGGGTGG - Intergenic
1051897970 9:22008744-22008766 GGGCGCGCGAACGCGGGGCGCGG - Intronic
1054820629 9:69517042-69517064 GGGCTCGCCCGCGCTGGTGGCGG + Exonic
1056386303 9:86099672-86099694 GGGCGCGCGCACCGTGGGGCCGG - Intronic
1056481521 9:87011634-87011656 AGGGGAGCGCCCGCAGGGGGAGG - Intergenic
1057337399 9:94166529-94166551 GGCCACCCGCCCGCTGGAGGGGG - Intergenic
1057995609 9:99819940-99819962 GGGCGCGAGCCCGCCGCGTGAGG - Intergenic
1058058547 9:100473236-100473258 GGGCGCGCGCGCGGCGGGCGGGG - Exonic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060514559 9:124257874-124257896 GCGCGCACGAGCGCTGGGGGCGG + Intronic
1061095938 9:128456744-128456766 GGGCCCTCGCCCGGCGGGGGGGG + Intronic
1061449320 9:130660047-130660069 GGGCGCGCGACGGCAGCGGGCGG + Intergenic
1061976101 9:134068537-134068559 GGGAGCGCGCGCGCGGGGCGGGG + Intergenic
1062230524 9:135479599-135479621 GGGCGCGCTCTCGCGGGCGGGGG + Intronic
1062461962 9:136665953-136665975 GGCAGCGCGACCGCTGGGGCCGG + Intronic
1203421998 Un_GL000195v1:1354-1376 GAGTCCGCGACCGCTGGGGGTGG + Intergenic
1203731990 Un_GL000216v2:99209-99231 GGGCGTTCGCCCGCGGAGGGCGG + Intergenic
1203470235 Un_GL000220v1:112836-112858 GGGCGCGCGTACGCGCGGGGAGG - Intergenic
1203471401 Un_GL000220v1:116705-116727 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1203478056 Un_GL000220v1:156808-156830 GGGCGCGCGTACGCGCGGGGAGG - Intergenic
1203479222 Un_GL000220v1:160677-160699 GCGCGCGCGTCCGCTGGGGGCGG + Intergenic
1185463045 X:341088-341110 GCGTGCGCGCCCGGTGGGGGCGG - Intronic
1185778812 X:2828859-2828881 GGACCCGCGCCCGCGGGGGCTGG + Exonic
1186669961 X:11758204-11758226 CGGAGCGCGCGCGGTGGGGGAGG - Exonic
1187067416 X:15854599-15854621 GGGCGCGCGCGGGGTGGCGGGGG + Intronic
1187172932 X:16869780-16869802 GGGAGCGCAGCCGCTGGAGGAGG + Exonic
1187507264 X:19887750-19887772 GGACGCGCGGCCGCCGGGCGGGG + Intergenic
1187675774 X:21715316-21715338 GCGCGCTCGCGCGCTGGTGGGGG + Intronic
1189325192 X:40107414-40107436 GGGAGCGCGCGCGCTTGGGTGGG - Intronic
1195334078 X:103832264-103832286 GCGCCCGCGCCCGCCAGGGGAGG + Intergenic
1195680639 X:107543524-107543546 CGGCGCCCGGCCACTGGGGGAGG - Intronic
1200129016 X:153830953-153830975 GGGCGCACGCGCGCCGGGAGGGG + Intergenic
1200229436 X:154436839-154436861 GGGCGGGCGCGCGCGGGGCGGGG + Intergenic
1200361641 X:155612918-155612940 GGGCCCGAGCGGGCTGGGGGAGG - Exonic