ID: 1167074272

View in Genome Browser
Species Human (GRCh38)
Location 19:47239555-47239577
Sequence GCGGGGGCGCGGGCGTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167074251_1167074272 19 Left 1167074251 19:47239513-47239535 CCTGCAGGCCGGGAGGCTGGACC No data
Right 1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG No data
1167074269_1167074272 -8 Left 1167074269 19:47239540-47239562 CCGGGTGGGGGCTGGGCGGGGGC No data
Right 1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG No data
1167074255_1167074272 11 Left 1167074255 19:47239521-47239543 CCGGGAGGCTGGACCGGGGCCGG No data
Right 1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG No data
1167074264_1167074272 -2 Left 1167074264 19:47239534-47239556 CCGGGGCCGGGTGGGGGCTGGGC No data
Right 1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG No data
1167074248_1167074272 24 Left 1167074248 19:47239508-47239530 CCGGCCCTGCAGGCCGGGAGGCT No data
Right 1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG No data
1167074250_1167074272 20 Left 1167074250 19:47239512-47239534 CCCTGCAGGCCGGGAGGCTGGAC No data
Right 1167074272 19:47239555-47239577 GCGGGGGCGCGGGCGTCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167074272 Original CRISPR GCGGGGGCGCGGGCGTCCGC AGG Intergenic