ID: 1167074990

View in Genome Browser
Species Human (GRCh38)
Location 19:47243228-47243250
Sequence CGCCGCAGCCGCGGGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167074979_1167074990 19 Left 1167074979 19:47243186-47243208 CCCGAATCCTGCGGTAACTTGGT No data
Right 1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG No data
1167074980_1167074990 18 Left 1167074980 19:47243187-47243209 CCGAATCCTGCGGTAACTTGGTA No data
Right 1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG No data
1167074981_1167074990 12 Left 1167074981 19:47243193-47243215 CCTGCGGTAACTTGGTAACTTGG No data
Right 1167074990 19:47243228-47243250 CGCCGCAGCCGCGGGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167074990 Original CRISPR CGCCGCAGCCGCGGGGCTCC GGG Intergenic
No off target data available for this crispr