ID: 1167075187

View in Genome Browser
Species Human (GRCh38)
Location 19:47244198-47244220
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075187_1167075199 17 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075199 19:47244238-47244260 GCGGAGGCCGGGCGGCCCCGTGG No data
1167075187_1167075196 6 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075196 19:47244227-47244249 GCTCGGGCCAGGCGGAGGCCGGG No data
1167075187_1167075193 -2 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data
1167075187_1167075195 5 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075195 19:47244226-47244248 CGCTCGGGCCAGGCGGAGGCCGG No data
1167075187_1167075202 27 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075202 19:47244248-47244270 GGCGGCCCCGTGGCTTCCGGAGG No data
1167075187_1167075197 9 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075197 19:47244230-47244252 CGGGCCAGGCGGAGGCCGGGCGG No data
1167075187_1167075192 -5 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075192 19:47244216-47244238 AGAGCTTTATCGCTCGGGCCAGG No data
1167075187_1167075201 24 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075201 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
1167075187_1167075194 1 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075194 19:47244222-47244244 TTATCGCTCGGGCCAGGCGGAGG No data
1167075187_1167075191 -10 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075191 19:47244211-47244233 GCACGAGAGCTTTATCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075187 Original CRISPR GCTCTCGTGCCGAACCAGGG CGG (reversed) Intergenic