ID: 1167075188

View in Genome Browser
Species Human (GRCh38)
Location 19:47244201-47244223
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075188_1167075196 3 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075196 19:47244227-47244249 GCTCGGGCCAGGCGGAGGCCGGG No data
1167075188_1167075199 14 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075199 19:47244238-47244260 GCGGAGGCCGGGCGGCCCCGTGG No data
1167075188_1167075201 21 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075201 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
1167075188_1167075202 24 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075202 19:47244248-47244270 GGCGGCCCCGTGGCTTCCGGAGG No data
1167075188_1167075192 -8 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075192 19:47244216-47244238 AGAGCTTTATCGCTCGGGCCAGG No data
1167075188_1167075195 2 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075195 19:47244226-47244248 CGCTCGGGCCAGGCGGAGGCCGG No data
1167075188_1167075194 -2 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075194 19:47244222-47244244 TTATCGCTCGGGCCAGGCGGAGG No data
1167075188_1167075197 6 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075197 19:47244230-47244252 CGGGCCAGGCGGAGGCCGGGCGG No data
1167075188_1167075193 -5 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075188 Original CRISPR AAAGCTCTCGTGCCGAACCA GGG (reversed) Intergenic