ID: 1167075190

View in Genome Browser
Species Human (GRCh38)
Location 19:47244210-47244232
Sequence GGCACGAGAGCTTTATCGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075181_1167075190 20 Left 1167075181 19:47244167-47244189 CCCACGCAGGGCAGACTTCAGGA No data
Right 1167075190 19:47244210-47244232 GGCACGAGAGCTTTATCGCTCGG No data
1167075186_1167075190 -10 Left 1167075186 19:47244197-47244219 CCCGCCCTGGTTCGGCACGAGAG No data
Right 1167075190 19:47244210-47244232 GGCACGAGAGCTTTATCGCTCGG No data
1167075182_1167075190 19 Left 1167075182 19:47244168-47244190 CCACGCAGGGCAGACTTCAGGAA No data
Right 1167075190 19:47244210-47244232 GGCACGAGAGCTTTATCGCTCGG No data
1167075179_1167075190 21 Left 1167075179 19:47244166-47244188 CCCCACGCAGGGCAGACTTCAGG No data
Right 1167075190 19:47244210-47244232 GGCACGAGAGCTTTATCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075190 Original CRISPR GGCACGAGAGCTTTATCGCT CGG Intergenic