ID: 1167075191

View in Genome Browser
Species Human (GRCh38)
Location 19:47244211-47244233
Sequence GCACGAGAGCTTTATCGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075186_1167075191 -9 Left 1167075186 19:47244197-47244219 CCCGCCCTGGTTCGGCACGAGAG No data
Right 1167075191 19:47244211-47244233 GCACGAGAGCTTTATCGCTCGGG No data
1167075179_1167075191 22 Left 1167075179 19:47244166-47244188 CCCCACGCAGGGCAGACTTCAGG No data
Right 1167075191 19:47244211-47244233 GCACGAGAGCTTTATCGCTCGGG No data
1167075182_1167075191 20 Left 1167075182 19:47244168-47244190 CCACGCAGGGCAGACTTCAGGAA No data
Right 1167075191 19:47244211-47244233 GCACGAGAGCTTTATCGCTCGGG No data
1167075181_1167075191 21 Left 1167075181 19:47244167-47244189 CCCACGCAGGGCAGACTTCAGGA No data
Right 1167075191 19:47244211-47244233 GCACGAGAGCTTTATCGCTCGGG No data
1167075187_1167075191 -10 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075191 19:47244211-47244233 GCACGAGAGCTTTATCGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075191 Original CRISPR GCACGAGAGCTTTATCGCTC GGG Intergenic