ID: 1167075193

View in Genome Browser
Species Human (GRCh38)
Location 19:47244219-47244241
Sequence GCTTTATCGCTCGGGCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075186_1167075193 -1 Left 1167075186 19:47244197-47244219 CCCGCCCTGGTTCGGCACGAGAG No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data
1167075182_1167075193 28 Left 1167075182 19:47244168-47244190 CCACGCAGGGCAGACTTCAGGAA No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data
1167075188_1167075193 -5 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data
1167075189_1167075193 -6 Left 1167075189 19:47244202-47244224 CCTGGTTCGGCACGAGAGCTTTA No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data
1167075187_1167075193 -2 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data
1167075179_1167075193 30 Left 1167075179 19:47244166-47244188 CCCCACGCAGGGCAGACTTCAGG No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data
1167075181_1167075193 29 Left 1167075181 19:47244167-47244189 CCCACGCAGGGCAGACTTCAGGA No data
Right 1167075193 19:47244219-47244241 GCTTTATCGCTCGGGCCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075193 Original CRISPR GCTTTATCGCTCGGGCCAGG CGG Intergenic