ID: 1167075197

View in Genome Browser
Species Human (GRCh38)
Location 19:47244230-47244252
Sequence CGGGCCAGGCGGAGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075189_1167075197 5 Left 1167075189 19:47244202-47244224 CCTGGTTCGGCACGAGAGCTTTA No data
Right 1167075197 19:47244230-47244252 CGGGCCAGGCGGAGGCCGGGCGG No data
1167075188_1167075197 6 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075197 19:47244230-47244252 CGGGCCAGGCGGAGGCCGGGCGG No data
1167075187_1167075197 9 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075197 19:47244230-47244252 CGGGCCAGGCGGAGGCCGGGCGG No data
1167075186_1167075197 10 Left 1167075186 19:47244197-47244219 CCCGCCCTGGTTCGGCACGAGAG No data
Right 1167075197 19:47244230-47244252 CGGGCCAGGCGGAGGCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075197 Original CRISPR CGGGCCAGGCGGAGGCCGGG CGG Intergenic