ID: 1167075198

View in Genome Browser
Species Human (GRCh38)
Location 19:47244234-47244256
Sequence GGGGCCGCCCGGCCTCCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075198_1167075214 28 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075214 19:47244285-47244307 GAGCTCACTGCGAGTTGGCCAGG No data
1167075198_1167075213 23 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075198_1167075207 -1 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075207 19:47244256-47244278 CGTGGCTTCCGGAGGCGCCCGGG No data
1167075198_1167075206 -2 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075206 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data
1167075198_1167075202 -9 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075202 19:47244248-47244270 GGCGGCCCCGTGGCTTCCGGAGG No data
1167075198_1167075209 3 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075209 19:47244260-47244282 GCTTCCGGAGGCGCCCGGGCGGG No data
1167075198_1167075208 2 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075208 19:47244259-47244281 GGCTTCCGGAGGCGCCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075198 Original CRISPR GGGGCCGCCCGGCCTCCGCC TGG (reversed) Intergenic