ID: 1167075199

View in Genome Browser
Species Human (GRCh38)
Location 19:47244238-47244260
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075189_1167075199 13 Left 1167075189 19:47244202-47244224 CCTGGTTCGGCACGAGAGCTTTA No data
Right 1167075199 19:47244238-47244260 GCGGAGGCCGGGCGGCCCCGTGG No data
1167075187_1167075199 17 Left 1167075187 19:47244198-47244220 CCGCCCTGGTTCGGCACGAGAGC No data
Right 1167075199 19:47244238-47244260 GCGGAGGCCGGGCGGCCCCGTGG No data
1167075188_1167075199 14 Left 1167075188 19:47244201-47244223 CCCTGGTTCGGCACGAGAGCTTT No data
Right 1167075199 19:47244238-47244260 GCGGAGGCCGGGCGGCCCCGTGG No data
1167075186_1167075199 18 Left 1167075186 19:47244197-47244219 CCCGCCCTGGTTCGGCACGAGAG No data
Right 1167075199 19:47244238-47244260 GCGGAGGCCGGGCGGCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075199 Original CRISPR GCGGAGGCCGGGCGGCCCCG TGG Intergenic