ID: 1167075200

View in Genome Browser
Species Human (GRCh38)
Location 19:47244245-47244267
Sequence CCGGAAGCCACGGGGCCGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075200_1167075208 -9 Left 1167075200 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
Right 1167075208 19:47244259-47244281 GGCTTCCGGAGGCGCCCGGGCGG No data
1167075200_1167075214 17 Left 1167075200 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
Right 1167075214 19:47244285-47244307 GAGCTCACTGCGAGTTGGCCAGG No data
1167075200_1167075209 -8 Left 1167075200 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
Right 1167075209 19:47244260-47244282 GCTTCCGGAGGCGCCCGGGCGGG No data
1167075200_1167075213 12 Left 1167075200 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075200 Original CRISPR CCGGAAGCCACGGGGCCGCC CGG (reversed) Intergenic