ID: 1167075204

View in Genome Browser
Species Human (GRCh38)
Location 19:47244254-47244276
Sequence CGGGCGCCTCCGGAAGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075204_1167075213 3 Left 1167075204 19:47244254-47244276 CCCGTGGCTTCCGGAGGCGCCCG No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075204_1167075214 8 Left 1167075204 19:47244254-47244276 CCCGTGGCTTCCGGAGGCGCCCG No data
Right 1167075214 19:47244285-47244307 GAGCTCACTGCGAGTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075204 Original CRISPR CGGGCGCCTCCGGAAGCCAC GGG (reversed) Intergenic