ID: 1167075205

View in Genome Browser
Species Human (GRCh38)
Location 19:47244255-47244277
Sequence CCGGGCGCCTCCGGAAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075205_1167075216 30 Left 1167075205 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data
Right 1167075216 19:47244308-47244330 ATTTCATCAGCTTCCTCCTGCGG No data
1167075205_1167075213 2 Left 1167075205 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075205_1167075214 7 Left 1167075205 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data
Right 1167075214 19:47244285-47244307 GAGCTCACTGCGAGTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075205 Original CRISPR CCGGGCGCCTCCGGAAGCCA CGG (reversed) Intergenic