ID: 1167075206

View in Genome Browser
Species Human (GRCh38)
Location 19:47244255-47244277
Sequence CCGTGGCTTCCGGAGGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075198_1167075206 -2 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075206 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data
1167075189_1167075206 30 Left 1167075189 19:47244202-47244224 CCTGGTTCGGCACGAGAGCTTTA No data
Right 1167075206 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075206 Original CRISPR CCGTGGCTTCCGGAGGCGCC CGG Intergenic