ID: 1167075207

View in Genome Browser
Species Human (GRCh38)
Location 19:47244256-47244278
Sequence CGTGGCTTCCGGAGGCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075198_1167075207 -1 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075207 19:47244256-47244278 CGTGGCTTCCGGAGGCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075207 Original CRISPR CGTGGCTTCCGGAGGCGCCC GGG Intergenic