ID: 1167075208

View in Genome Browser
Species Human (GRCh38)
Location 19:47244259-47244281
Sequence GGCTTCCGGAGGCGCCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075198_1167075208 2 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075208 19:47244259-47244281 GGCTTCCGGAGGCGCCCGGGCGG No data
1167075200_1167075208 -9 Left 1167075200 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
Right 1167075208 19:47244259-47244281 GGCTTCCGGAGGCGCCCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075208 Original CRISPR GGCTTCCGGAGGCGCCCGGG CGG Intergenic