ID: 1167075208 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:47244259-47244281 |
Sequence | GGCTTCCGGAGGCGCCCGGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167075198_1167075208 | 2 | Left | 1167075198 | 19:47244234-47244256 | CCAGGCGGAGGCCGGGCGGCCCC | No data | ||
Right | 1167075208 | 19:47244259-47244281 | GGCTTCCGGAGGCGCCCGGGCGG | No data | ||||
1167075200_1167075208 | -9 | Left | 1167075200 | 19:47244245-47244267 | CCGGGCGGCCCCGTGGCTTCCGG | No data | ||
Right | 1167075208 | 19:47244259-47244281 | GGCTTCCGGAGGCGCCCGGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167075208 | Original CRISPR | GGCTTCCGGAGGCGCCCGGG CGG | Intergenic | ||