ID: 1167075209

View in Genome Browser
Species Human (GRCh38)
Location 19:47244260-47244282
Sequence GCTTCCGGAGGCGCCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075198_1167075209 3 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075209 19:47244260-47244282 GCTTCCGGAGGCGCCCGGGCGGG No data
1167075200_1167075209 -8 Left 1167075200 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
Right 1167075209 19:47244260-47244282 GCTTCCGGAGGCGCCCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075209 Original CRISPR GCTTCCGGAGGCGCCCGGGC GGG Intergenic