ID: 1167075210

View in Genome Browser
Species Human (GRCh38)
Location 19:47244264-47244286
Sequence TCATCCCGCCCGGGCGCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075210_1167075214 -2 Left 1167075210 19:47244264-47244286 CCGGAGGCGCCCGGGCGGGATGA No data
Right 1167075214 19:47244285-47244307 GAGCTCACTGCGAGTTGGCCAGG No data
1167075210_1167075216 21 Left 1167075210 19:47244264-47244286 CCGGAGGCGCCCGGGCGGGATGA No data
Right 1167075216 19:47244308-47244330 ATTTCATCAGCTTCCTCCTGCGG No data
1167075210_1167075213 -7 Left 1167075210 19:47244264-47244286 CCGGAGGCGCCCGGGCGGGATGA No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075210 Original CRISPR TCATCCCGCCCGGGCGCCTC CGG (reversed) Intergenic