ID: 1167075213

View in Genome Browser
Species Human (GRCh38)
Location 19:47244280-47244302
Sequence GGGATGAGCTCACTGCGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075210_1167075213 -7 Left 1167075210 19:47244264-47244286 CCGGAGGCGCCCGGGCGGGATGA No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075203_1167075213 4 Left 1167075203 19:47244253-47244275 CCCCGTGGCTTCCGGAGGCGCCC No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075200_1167075213 12 Left 1167075200 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075198_1167075213 23 Left 1167075198 19:47244234-47244256 CCAGGCGGAGGCCGGGCGGCCCC No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075205_1167075213 2 Left 1167075205 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data
1167075204_1167075213 3 Left 1167075204 19:47244254-47244276 CCCGTGGCTTCCGGAGGCGCCCG No data
Right 1167075213 19:47244280-47244302 GGGATGAGCTCACTGCGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075213 Original CRISPR GGGATGAGCTCACTGCGAGT TGG Intergenic