ID: 1167075216

View in Genome Browser
Species Human (GRCh38)
Location 19:47244308-47244330
Sequence ATTTCATCAGCTTCCTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167075211_1167075216 12 Left 1167075211 19:47244273-47244295 CCCGGGCGGGATGAGCTCACTGC No data
Right 1167075216 19:47244308-47244330 ATTTCATCAGCTTCCTCCTGCGG No data
1167075205_1167075216 30 Left 1167075205 19:47244255-47244277 CCGTGGCTTCCGGAGGCGCCCGG No data
Right 1167075216 19:47244308-47244330 ATTTCATCAGCTTCCTCCTGCGG No data
1167075212_1167075216 11 Left 1167075212 19:47244274-47244296 CCGGGCGGGATGAGCTCACTGCG No data
Right 1167075216 19:47244308-47244330 ATTTCATCAGCTTCCTCCTGCGG No data
1167075210_1167075216 21 Left 1167075210 19:47244264-47244286 CCGGAGGCGCCCGGGCGGGATGA No data
Right 1167075216 19:47244308-47244330 ATTTCATCAGCTTCCTCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167075216 Original CRISPR ATTTCATCAGCTTCCTCCTG CGG Intergenic