ID: 1167078355

View in Genome Browser
Species Human (GRCh38)
Location 19:47262787-47262809
Sequence TTACTAGCTACTTGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167078352_1167078355 21 Left 1167078352 19:47262743-47262765 CCATCTAAAATTTTGTCACTAGC 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1167078355 19:47262787-47262809 TTACTAGCTACTTGGAATGCTGG 0: 1
1: 0
2: 2
3: 29
4: 399
1167078351_1167078355 22 Left 1167078351 19:47262742-47262764 CCCATCTAAAATTTTGTCACTAG No data
Right 1167078355 19:47262787-47262809 TTACTAGCTACTTGGAATGCTGG 0: 1
1: 0
2: 2
3: 29
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167078355 Original CRISPR TTACTAGCTACTTGGAATGC TGG Intronic
901336601 1:8454685-8454707 ATCCCAGCTACTTGGAAGGCTGG + Intronic
901613749 1:10520274-10520296 GTCCTAGCTACTTGGGAGGCTGG - Intronic
904506632 1:30961404-30961426 GTACCAGCTACTTGGGAAGCTGG + Intronic
904644915 1:31958431-31958453 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
904672644 1:32177662-32177684 ATCCTAGCTACTTGGGAGGCTGG + Intergenic
905138742 1:35823368-35823390 ATCCCAGCTACTTGGAAGGCTGG - Intronic
905427791 1:37897816-37897838 GTCCTAGCTACTTGGGAGGCTGG + Intronic
905733850 1:40313284-40313306 GTCCTAGCTACTTGGGAGGCTGG - Intronic
905815776 1:40949666-40949688 GTTCTAGCTACTTGGGAGGCTGG - Intergenic
906095442 1:43220604-43220626 GTTCTAGCTACTTGGGAGGCTGG + Intronic
906981149 1:50630918-50630940 ATCCCAGCTACTTGGGATGCTGG - Intronic
907125411 1:52046093-52046115 GTCCTAGCTACTTGGGAGGCAGG + Intronic
909913057 1:81284061-81284083 GTAAAAGCTCCTTGGAATGCAGG + Intergenic
910670224 1:89764696-89764718 GTCCTAGCTACTTGGGAGGCAGG + Intronic
911747548 1:101455832-101455854 GTCCTAGCTACTTGGGAGGCAGG + Intergenic
911770339 1:101732937-101732959 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
913522117 1:119654485-119654507 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
915151636 1:153837235-153837257 ATTCTAGCTACTTGGGAGGCTGG + Intronic
915156051 1:153877223-153877245 GTCCTAGCTACTTGGGAGGCTGG + Intronic
915200953 1:154228303-154228325 ATCCTAGCTACTTGGGAGGCTGG - Intronic
915501516 1:156322121-156322143 GTCCTAGCTACTTGGGAAGCTGG + Intronic
920252662 1:204632114-204632136 GTTCTAGCTACTTGGGAGGCTGG + Intronic
921654778 1:217721840-217721862 TTCCTACCTACTTGGGTTGCTGG - Intronic
922429191 1:225530378-225530400 TTACCAGATACTTGTTATGCTGG - Intronic
924245321 1:242078347-242078369 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
924679462 1:246217389-246217411 GTCCCAGCTACTTGGAAGGCTGG + Intronic
1063424436 10:5940471-5940493 TTCCCAGCTACTTGGGAGGCTGG + Intronic
1064405015 10:15053830-15053852 TTCCCAGCTAGTTGGAAGGCTGG - Intronic
1065029133 10:21567555-21567577 TAACTAGCCAATTGGAATGAAGG + Intronic
1065620116 10:27572253-27572275 GTACTAGCTACTTGGGAGGCTGG - Intergenic
1066113098 10:32214670-32214692 GTACCAGTTACTTGGAAGGCTGG - Intergenic
1069881106 10:71593979-71594001 GTCCTAGCTACTTGGAAGGTTGG + Intronic
1070107756 10:73451861-73451883 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1070633837 10:78108111-78108133 GTCCCAGCTACTTGGGATGCTGG - Intergenic
1071350861 10:84743159-84743181 GTCCTAGCTACTAGGAAGGCTGG - Intergenic
1071830560 10:89367934-89367956 GTTCTAGCTAATTGGAAGGCTGG - Intronic
1072111685 10:92327128-92327150 TTGCAAGCTACTTGCAATGAGGG + Intronic
1072698930 10:97625883-97625905 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1072908868 10:99482142-99482164 ATCCTAGCTACTTGGGAGGCTGG + Intergenic
1073359573 10:102886739-102886761 GTCCCAGCTACTTGGGATGCTGG - Intronic
1074324317 10:112433387-112433409 TTATCAGCAACTTGAAATGCTGG - Intronic
1074572874 10:114640407-114640429 GTCCCAGCTACTTGGAAGGCTGG + Intronic
1074742074 10:116495146-116495168 ATCCTAGCTACTTGGGAGGCAGG - Intergenic
1075543366 10:123334766-123334788 ATCCCAGCTACTTGGAAGGCTGG + Intergenic
1076154938 10:128196834-128196856 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
1078502359 11:11893552-11893574 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1080079426 11:28198058-28198080 ATACTAACTACTAAGAATGCTGG - Intronic
1080545759 11:33316703-33316725 GTCCCAGCTACTTGGGATGCTGG + Intronic
1084362058 11:68675160-68675182 GTACCAGCTACTTGGGAGGCTGG - Intergenic
1085087679 11:73682203-73682225 ATCCTAGCTACTTGGAAGCCTGG + Intronic
1087419909 11:97908888-97908910 TTACTAGCAATTTGAAATGGAGG + Intergenic
1087576372 11:99994860-99994882 CTACTAGCTACTTGAATAGCAGG - Intronic
1087818719 11:102687830-102687852 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
1089809350 11:121118847-121118869 TTACAAGCTATTTGCAAGGCGGG - Intronic
1090262689 11:125332843-125332865 TAACTAGCTGCTTGGAGAGCTGG - Intronic
1090528399 11:127562522-127562544 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1091058513 11:132440791-132440813 TTCTTAACTACTTTGAATGCTGG + Intronic
1091430515 12:429876-429898 GTTCCAGCTACTTGGAAGGCTGG - Intronic
1091573052 12:1707580-1707602 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1092135957 12:6147340-6147362 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
1092642201 12:10526290-10526312 GTCCTAGCTACTTAGAAGGCTGG - Intergenic
1093021088 12:14205065-14205087 GTCCCAGCTACTTGGGATGCTGG - Intergenic
1093931341 12:24957533-24957555 GTCCTAGCTACTTGGGAAGCTGG - Intergenic
1095579954 12:43786147-43786169 ATCTTAGCTACTTGGAAGGCTGG - Intronic
1095601372 12:44016692-44016714 TTACGAGCTAATGGGAATGTAGG + Intronic
1096471775 12:51882427-51882449 ATCCCAGCTACTTGGAAGGCAGG + Intergenic
1096475352 12:51906341-51906363 AAACTACCTACTAGGAATGCAGG - Intergenic
1097462428 12:59878534-59878556 TTCCCAGCTACTTGGTAGGCTGG - Intergenic
1097527400 12:60754405-60754427 ATCCTAGCTACTCGGAAAGCTGG + Intergenic
1098601828 12:72340679-72340701 TTTCCTGCTGCTTGGAATGCAGG - Intronic
1100837480 12:98580343-98580365 ATCCTAGCTACTTGGAATGCTGG + Intergenic
1102654261 12:114467566-114467588 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1103496859 12:121369571-121369593 ATCCCAGCTACTTGGAAGGCTGG + Intronic
1103641142 12:122353494-122353516 GTCCTAGCTACTTGGGAAGCTGG + Intronic
1103992027 12:124805674-124805696 GTCCTAGCTACGTGGAAAGCTGG - Intronic
1105251358 13:18701249-18701271 TTATTAGGTATTTGGAATCCAGG - Intergenic
1105772963 13:23630183-23630205 ATTCTAGCTACTTGGGAGGCTGG + Intronic
1105793234 13:23823708-23823730 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1105866643 13:24466675-24466697 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1106137648 13:26985967-26985989 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
1106708537 13:32307379-32307401 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1108110982 13:47072422-47072444 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1108367080 13:49726823-49726845 GTCCCAGCTACTTGGGATGCTGG + Intronic
1110578490 13:77089698-77089720 TTATTATCTACTTAGAATGATGG + Intronic
1112498949 13:99927545-99927567 GTACCAGCTACTTGGGAGGCTGG - Intergenic
1113642443 13:111967383-111967405 TTACTAGCTCCATGCTATGCAGG - Intergenic
1114192898 14:20453899-20453921 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1115589758 14:34852499-34852521 TTCCCAGCTACTTGGGAGGCTGG + Intronic
1115626991 14:35203407-35203429 TTCCCAGCTACTTGGGAGGCTGG + Intronic
1115971171 14:38946371-38946393 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1117147038 14:52846025-52846047 GTCCTAGCTACTTGGAAGGCTGG - Intergenic
1118250644 14:64156940-64156962 TTAATAACTACAAGGAATGCTGG - Intronic
1118367563 14:65108736-65108758 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
1118585976 14:67353603-67353625 GTTCTAGCTACTTGGGAGGCTGG - Intronic
1118638840 14:67773432-67773454 GTCCTAGCTACTTGGGAAGCTGG + Intronic
1119354376 14:73993217-73993239 GTCCTAGCTACTTGGGAAGCTGG + Intronic
1121302572 14:92883445-92883467 GTCCCAGCTACTTGGGATGCTGG + Intergenic
1121366254 14:93313849-93313871 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1123702257 15:22923823-22923845 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1125305564 15:38308978-38309000 ATAGTGGCTACTTGAAATGCTGG - Intronic
1125594586 15:40876236-40876258 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
1125687953 15:41574835-41574857 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1126076980 15:44921154-44921176 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1126081731 15:44969674-44969696 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1126158208 15:45585050-45585072 ATCCTAGCTACTTGGGAGGCTGG - Intergenic
1126650836 15:50919957-50919979 TTCCCAGCTACTTGGGAGGCTGG + Intronic
1128102206 15:65011612-65011634 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1128437938 15:67673964-67673986 CTCCCAGCTACTTGGAAGGCTGG - Intronic
1128927915 15:71675629-71675651 TCACTAGATGCTTGGAATCCTGG + Intronic
1129370177 15:75088288-75088310 ATCCTAGCTACTTGGAAGGCTGG - Intronic
1130076299 15:80693823-80693845 GTCCTAGCTACTTGGGAGGCAGG + Intronic
1131124113 15:89843688-89843710 ATTCTAGCTACTTGGGAGGCTGG + Intronic
1131736475 15:95338211-95338233 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
1132086942 15:98916377-98916399 ATCCCAGCTACTCGGAATGCTGG - Intronic
1132926962 16:2435465-2435487 GTCCTAGCTACTTGGGATGCCGG + Intronic
1133452549 16:5916006-5916028 TTACTAGCTGCTGTGAAGGCTGG - Intergenic
1134318436 16:13140604-13140626 GTACTAGGTACTGGGGATGCAGG + Intronic
1134555854 16:15164157-15164179 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
1134916436 16:18075868-18075890 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
1135090514 16:19511218-19511240 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1135538692 16:23313727-23313749 GTACCAGCTACTTGGGAGGCTGG - Intronic
1135711012 16:24717200-24717222 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1135752000 16:25065684-25065706 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1136047477 16:27625965-27625987 GTTCTAGCTACTTGGGAGGCTGG - Intronic
1137736840 16:50731050-50731072 TTCCTAGCCACTTGGGAGGCTGG + Intronic
1138132657 16:54494288-54494310 ATCCCAGCTACTTGGAAGGCTGG + Intergenic
1138217817 16:55220301-55220323 TTACTAGCCACTATAAATGCAGG + Intergenic
1139552154 16:67680011-67680033 GTCCTTGCTACTTGGAAAGCTGG - Intronic
1141062672 16:80888767-80888789 TTCCCAGCTACTTGGGAGGCTGG + Intergenic
1141081763 16:81059201-81059223 ATACAAGCTACTTGGGAGGCTGG + Intronic
1142578599 17:926302-926324 GTCCTAGCTACTTGGAGGGCTGG - Intronic
1143194994 17:5069301-5069323 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
1143862728 17:9902678-9902700 TTAATAGCTGCTTGGAATTCTGG - Intronic
1145931003 17:28685599-28685621 GTCCCAGCTACTTGGAAGGCAGG - Intronic
1145957794 17:28866684-28866706 TTCCTAGCTACTTGGGAGGCTGG + Intergenic
1146650902 17:34605612-34605634 TTCCTAGATGCTTGGAATCCTGG - Intronic
1146781689 17:35680017-35680039 TTCCCAGCTACTTGGAACCCGGG - Intronic
1148528117 17:48362234-48362256 TTACCAGATTCTTGAAATGCTGG - Intronic
1148573741 17:48692407-48692429 TTCCTTGCTACTTGGGAGGCTGG + Intergenic
1149481537 17:57007495-57007517 GTACTAGCTACTTGGGAGGCTGG - Intergenic
1149615885 17:57998096-57998118 ATACCAGCTACTTGGGAGGCAGG + Intronic
1149919492 17:60643263-60643285 GTCCCAGCTACTTGGAAGGCAGG + Intronic
1150356749 17:64493299-64493321 GTCCCAGCTACTTGGAAAGCTGG + Intronic
1150622291 17:66816993-66817015 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
1153300943 18:3591583-3591605 GTCCCAGCTACTTGGAAGGCTGG + Intronic
1153884329 18:9449808-9449830 GTCCTAGCTACTCGGAAGGCTGG - Intergenic
1154360887 18:13659386-13659408 ATCCTAGCTACTTGGGAGGCTGG + Intergenic
1154437576 18:14358704-14358726 TTATTAGGTATTTGGAATCCAGG + Intergenic
1154993872 18:21621516-21621538 ATCCCAGCTACTTGGAAGGCTGG - Intronic
1155065874 18:22268399-22268421 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
1155146460 18:23087931-23087953 GTCCTAGCTACTTGGGAGGCTGG + Intergenic
1159046688 18:63375584-63375606 GTCCTAGCTACTTGGAAGGCTGG + Intergenic
1161174793 19:2835114-2835136 GTACTAGCTACCTGGGAGGCTGG - Exonic
1162251052 19:9443991-9444013 ATACTAGCTACTGGGGAGGCTGG - Intergenic
1162467294 19:10849945-10849967 ATCCTAGCTACTTGGGAGGCTGG + Intronic
1164430463 19:28183753-28183775 ATACTAGCTACTTGCAAGGATGG + Intergenic
1165492142 19:36130096-36130118 CTCCTAGCTACTTGGGAGGCTGG - Intergenic
1166566305 19:43767536-43767558 TCACCAGCTACTTGGACTGCTGG + Exonic
1166599118 19:44078577-44078599 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1166796979 19:45432386-45432408 ATCCTAGCTACTTGGGAGGCTGG - Intronic
1166865360 19:45832905-45832927 ATCCCAGCTACTTGGAAGGCAGG + Intronic
1167024044 19:46901438-46901460 GTTCCAGCTACTTGGAAGGCTGG + Intergenic
1167078355 19:47262787-47262809 TTACTAGCTACTTGGAATGCTGG + Intronic
1167387699 19:49173773-49173795 TTCCCAGCTACTTGGAAGGCTGG - Intronic
1167825578 19:51970008-51970030 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1167903981 19:52643234-52643256 ATCCTAGCTACTTGGGAGGCTGG + Intronic
927106183 2:19829442-19829464 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
927700567 2:25265699-25265721 ATCCTAGCTACTTGGGAGGCTGG + Intronic
927821143 2:26266146-26266168 GTCCTAGCTACTTGGGAGGCTGG + Intronic
927887988 2:26730278-26730300 TCACTAGCTACTTGGGACACAGG - Exonic
927934151 2:27066139-27066161 GTCCCAGCTACTTGGGATGCAGG + Intronic
929149129 2:38732172-38732194 ATCCTAGCTACTTGGAAGGCTGG - Intronic
929410961 2:41697030-41697052 TTACTAGCTATTTCTTATGCTGG - Intergenic
929499410 2:42477543-42477565 TGACCAGCTACTTGGGAGGCTGG - Intronic
929534691 2:42773702-42773724 TTCCCAGCTACTTGGGAGGCTGG - Intronic
930146941 2:48017052-48017074 GTTCCAGCTACTTGGAAGGCTGG - Intergenic
931183686 2:59929177-59929199 GTCCTAGCTACTTGGGAGGCAGG - Intergenic
931323616 2:61196196-61196218 GTCCCAGCTACTTGGGATGCTGG - Intronic
931486263 2:62695828-62695850 GTCCCAGCTACTTGGAAGGCTGG - Intronic
931545030 2:63373365-63373387 GTCCCAGCTACTTGGAAGGCTGG - Intronic
932240402 2:70151892-70151914 GTCCCAGCTACTTGGAAGGCTGG - Intronic
934960233 2:98666573-98666595 GTCCTAGCTACTTGGGAGGCTGG + Intronic
935043036 2:99452912-99452934 TTGCTAGTTACTTGGATTTCAGG + Intronic
935233904 2:101121946-101121968 GTCCCAGCTACTTGGAAGGCTGG + Intronic
935258666 2:101335601-101335623 GTCCTAGCTACTTGGGAGGCTGG + Intergenic
935332787 2:101989328-101989350 GTCCCAGCTACTTGGAAAGCTGG - Intergenic
936288371 2:111199147-111199169 TCACTAGCAACCTGGAATGGTGG - Intergenic
936459016 2:112697583-112697605 ATCCGAGCTACTTGGAAGGCTGG + Intergenic
936602118 2:113907367-113907389 GTCCTAGCTACTTGGGAGGCAGG - Intronic
938853186 2:135283165-135283187 TTCCCAGCTACTTGGGAGGCTGG + Intronic
940356870 2:152753018-152753040 TCACCAGCTACTTGGGAGGCTGG + Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941161252 2:162037043-162037065 TTAGTGGTTATTTGGAATGCAGG + Intronic
941196584 2:162459974-162459996 GTCCCAGCTACTTGGAAGGCTGG + Intronic
941376688 2:164740243-164740265 GTCCTAGCTACTTGGGAGGCTGG + Intronic
941676012 2:168344241-168344263 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
942867515 2:180693028-180693050 ATCCCAGCTACTTGGAAGGCTGG + Intergenic
942954105 2:181753884-181753906 ATATGAGCTCCTTGGAATGCTGG + Intergenic
943321296 2:186446303-186446325 GTTCTAGCTACTTGGGAGGCTGG + Intergenic
945068753 2:205970142-205970164 GTCCTAGCTACTTGGGAAGCTGG + Intergenic
947413213 2:229865192-229865214 TTCCTAGCTACTCGGGAAGCTGG + Intronic
947630573 2:231650057-231650079 ATCCTAGCTACTTGGGAGGCTGG - Intergenic
948553705 2:238793004-238793026 ATCCCAGCTACTTGGAAGGCTGG - Intergenic
948812661 2:240492108-240492130 GTACTAGCTGCTTGGGAGGCTGG - Intronic
948956159 2:241293492-241293514 GTCCCAGCTACTTGGAAGGCTGG + Intronic
1171471130 20:25372303-25372325 GTCCTAGCTACTTGGGAGGCAGG - Intronic
1172138674 20:32706078-32706100 ATCCCAGCTACTTGGAAGGCTGG + Intronic
1172158109 20:32843969-32843991 ATCCTAGCTACTTGGGAGGCTGG - Intronic
1172341467 20:34161337-34161359 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1172483379 20:35284717-35284739 TTACTGGTTACTTGGTAAGCTGG - Exonic
1172652584 20:36514526-36514548 TTCCCAGCTACTTGGGAGGCTGG - Intronic
1173420654 20:42898324-42898346 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1173509828 20:43618326-43618348 GTCCTAGCTACTTGGGAAGCTGG - Intronic
1176836880 21:13801133-13801155 TTATTAGGTATTTGGAATCCAGG - Intergenic
1177496708 21:21900615-21900637 ATCCTAGCTACTTGGGAAGCTGG - Intergenic
1178433680 21:32538249-32538271 ATCCTAGCTACTTGGGAGGCTGG + Intergenic
1180819501 22:18816232-18816254 TTTGTAGCTAGTTGGACTGCAGG - Intergenic
1180848935 22:19001698-19001720 TTACTTGGTACTTAGAATGCAGG + Intergenic
1180897772 22:19349686-19349708 TGACTAGGTACTTTGAATCCTGG - Intronic
1181205726 22:21250677-21250699 TTTGTAGCTAGTTGGACTGCAGG - Intergenic
1181664132 22:24379574-24379596 TTACTTGGTACTTAAAATGCAGG + Intronic
1181833392 22:25580995-25581017 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1182345323 22:29659423-29659445 TCCCCAGCTACTTGGAAGGCTGG - Intronic
1182657947 22:31904623-31904645 ATCCTAGCTACTTGGGAGGCTGG + Intronic
1183497639 22:38157916-38157938 ATTCCAGCTACTTGGAAGGCTGG + Intronic
1184346275 22:43915273-43915295 GTCCCAGCTACTTGGGATGCTGG + Intergenic
1184350536 22:43940689-43940711 CTCCCAGCTACTTGGAAGGCTGG + Intronic
1203221197 22_KI270731v1_random:44736-44758 TTTGTAGCTAGTTGGACTGCAGG + Intergenic
1203269628 22_KI270734v1_random:42085-42107 TTTGTAGCTAGTTGGACTGCAGG - Intergenic
949472794 3:4414211-4414233 GTCCCAGCTACTTGGAAGGCTGG + Intronic
950039839 3:9913284-9913306 ATCCTAGCTACTTGGGAGGCTGG + Intronic
950603735 3:14058867-14058889 ATCCTAGCTACTTGGGAGGCTGG + Intronic
952372481 3:32736655-32736677 GTACCAGCTACTTGGGAGGCTGG + Intronic
952702450 3:36341394-36341416 TTACTAGCAACTTCAATTGCAGG - Intergenic
954094841 3:48317856-48317878 GTCCTAGCTACTTGGAAGTCAGG - Intronic
954234882 3:49248613-49248635 ATCCTAGCTACTTGGGAGGCAGG + Intronic
955328655 3:58028962-58028984 ATCCTAGCTACTTGGGAGGCTGG + Intronic
955370577 3:58348023-58348045 GTCCTAGCTACTTGGGAGGCAGG - Intronic
957075271 3:75597624-75597646 ATCCCAGCTACTTGGAAGGCTGG + Intergenic
957139799 3:76338553-76338575 GTACTATCTACTTGGGAGGCTGG + Intronic
957785161 3:84873286-84873308 ATGCCAGCTACTTGGAAGGCTGG - Intergenic
958893617 3:99806512-99806534 GTACCAGCTACTTGGGAGGCTGG + Intergenic
958921443 3:100110421-100110443 TGACTAGGAAATTGGAATGCAGG - Intronic
959700038 3:109290104-109290126 GTCCTAGCTACTTGGGAGGCTGG + Intergenic
960462372 3:117952121-117952143 TAACTAGCTACTCTGAAGGCTGG - Intergenic
960884217 3:122377728-122377750 GTCCTAGCTACTTGGGATGCTGG + Intronic
961607809 3:128110166-128110188 GTCCTAGCTACTTGGGAGGCTGG + Intronic
961635915 3:128332567-128332589 ATCCCAGCTACTTGGGATGCTGG - Intronic
962589135 3:136871280-136871302 GTCCTAGCTACTTGCAAGGCTGG + Intronic
962796010 3:138850215-138850237 ATACTAGCTACTTGGGAGGCTGG + Intergenic
964074915 3:152682231-152682253 GTTCTAGCTACTTGGGAGGCTGG + Intergenic
964498284 3:157318792-157318814 ATACTAGCTACTTGGGAGGCAGG + Intronic
965211738 3:165798729-165798751 ATCCTAGCTACTTGGGAAGCTGG + Intronic
965518961 3:169653830-169653852 TTACTAGCTGGTTGAAATGAAGG - Intronic
965751967 3:171984699-171984721 TTTCTAGATACTGGGAATACAGG + Intergenic
967731742 3:192913277-192913299 CTCCTAGCTACTTGGGAGGCTGG + Intronic
968336241 3:197916088-197916110 GTACTAGCTACTTGGGAAGATGG - Intronic
968842046 4:3014677-3014699 GTCCCAGCTACTTGGGATGCTGG + Intronic
970329184 4:14961780-14961802 ATCCTAGCTACTTGGGAGGCTGG - Intergenic
970664841 4:18324860-18324882 ATAATACTTACTTGGAATGCAGG - Intergenic
971272921 4:25167828-25167850 GTCCCAGCTACTTGGAAGGCTGG + Intronic
973888695 4:55347510-55347532 GTGCCAGCTACTTGGAATGAAGG + Intronic
974933499 4:68387106-68387128 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
974993483 4:69123731-69123753 ATCCCAGCTACTTGGCATGCTGG + Intronic
975026770 4:69558755-69558777 ATACCAGCTACTTGGAAGGCTGG - Intergenic
975487403 4:74949428-74949450 GTACCAGCTACTTGGGAGGCAGG - Intronic
975675133 4:76820525-76820547 TTCCTAGCTACTTGGAAGGCTGG + Intergenic
976004207 4:80408961-80408983 TTCCTAGCTACTTGGGAGGCTGG + Intronic
976224870 4:82787917-82787939 GTCCTAGCTACTTGGGAGGCTGG + Intronic
976241532 4:82962175-82962197 GTTCCAGCTACTTGGAAGGCTGG - Intronic
976520750 4:86022620-86022642 GTCCTAGCTACTTGGGAGGCTGG - Intronic
976784473 4:88802330-88802352 TAACTTGCTACATGGAATGGTGG + Intronic
978378181 4:108097425-108097447 TTACCAGCAGCTTGGAATGGGGG + Intronic
978855601 4:113390707-113390729 TTCCCAGCTACCTGGAAGGCTGG + Intergenic
979178964 4:117701599-117701621 GATCTAGCTACTTGTAATGCAGG + Intergenic
979960464 4:127013962-127013984 GTCCTGGCTACTTGGAAGGCTGG + Intergenic
980035296 4:127876751-127876773 ATACCAGCTACTTGGGAGGCTGG + Intergenic
980140407 4:128909365-128909387 GTTCTAGCTACTTGGGAGGCTGG - Intronic
980976533 4:139616457-139616479 ATCCCAGCTACTTGGAAGGCTGG + Intergenic
981052782 4:140327545-140327567 GTCCTAGCTACTTGGGAGGCTGG + Intronic
981711721 4:147715649-147715671 ATCCTAGCTACTTGGGAGGCTGG - Intergenic
982456661 4:155618317-155618339 GTCCCAGCTACTTGGGATGCTGG + Intergenic
983761550 4:171413732-171413754 GTACTAGCTACTTGGGAGGCTGG + Intergenic
984342369 4:178473279-178473301 GTCCCAGCTACTTGGGATGCTGG - Intergenic
985244295 4:187964444-187964466 TTACTAGCTTCTTAGAATGAAGG - Intergenic
986340731 5:6786987-6787009 GTTCCAGCTACTTGGAAGGCTGG + Intergenic
987358509 5:17085564-17085586 GTCCCAGCTACTTGGAAGGCAGG + Intronic
988567099 5:32328120-32328142 GTCCTAGCTACTTGGGAGGCTGG + Intergenic
990011112 5:50999532-50999554 GTCCTAACTACTTGGGATGCTGG - Intergenic
990081336 5:51917754-51917776 TTACTAGCTATTTGGTATAGAGG - Intergenic
990102073 5:52202854-52202876 GTCCTAGCTACTTGGGAGGCTGG + Intergenic
990380079 5:55214205-55214227 TTTCTTCCTACTTTGAATGCAGG + Intergenic
991533929 5:67645706-67645728 ATTCTAGCTACTTGGGAGGCTGG - Intergenic
991993078 5:72360800-72360822 TTCCCAGCTACTTGGGAGGCTGG - Intergenic
993625646 5:90221716-90221738 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
994743496 5:103649882-103649904 TCACTTGCAACTTAGAATGCAGG + Intergenic
995241678 5:109892018-109892040 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
995360633 5:111292811-111292833 GTTCTAGCTACTTGGGAGGCTGG + Intronic
995466538 5:112455376-112455398 TGATTAGTTACTTGGAATACTGG - Intergenic
995485055 5:112631914-112631936 TTACTAAATACTAGGAATTCTGG + Intergenic
995524857 5:113042355-113042377 GTCCTAGCTACTTGGGAGGCTGG + Intronic
995884468 5:116878188-116878210 TTAATTGCTATTAGGAATGCAGG - Intergenic
996375679 5:122804481-122804503 GTCCTAGCTACTCGGAAGGCTGG - Intronic
996552153 5:124742358-124742380 TCACTGGCTGCTTGGAATGTGGG - Intronic
997332524 5:133075710-133075732 GTCCTAGCTACTTGGGATGCTGG + Intronic
997488466 5:134252087-134252109 ATCCTAGCTACTTGGGAGGCTGG - Intergenic
997635923 5:135405575-135405597 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
998049587 5:139021011-139021033 TTCCTATCTACTTGGAATAAGGG + Intronic
998065686 5:139156440-139156462 ATCCCAGCTACTTGGAAGGCTGG + Intronic
998574498 5:143299129-143299151 TTCCTAGCTACTTGGGAGGCTGG - Intronic
999007669 5:148000697-148000719 TTATTAGCTACATTGAATGCAGG - Intergenic
999334827 5:150706470-150706492 TTACTAGCTGCTTGGTAGGCTGG + Intergenic
1000022726 5:157332760-157332782 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1000623462 5:163511379-163511401 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1001073941 5:168610083-168610105 TACATAGCTTCTTGGAATGCAGG - Intergenic
1001844667 5:174911156-174911178 GTACCAGCTACTTGGGAGGCTGG - Intergenic
1002980899 6:2136783-2136805 GTCCTAGCTACTTGGAAAGCTGG + Intronic
1004966820 6:20861345-20861367 TTATTTGCCACTTGGAGTGCTGG + Intronic
1005464358 6:26097633-26097655 TTACCAGCTATTTGAATTGCTGG + Exonic
1006480595 6:34290348-34290370 GTCCTAGCTACTTGGAAGGCTGG - Intronic
1006833367 6:36982503-36982525 TTCCCAGCTACTTGGGAGGCTGG - Intronic
1007463041 6:42031905-42031927 ATCCTAGCTACTTGGGAGGCTGG - Intronic
1007508118 6:42353063-42353085 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1008835467 6:55821822-55821844 TTACTAGCTACTTAGGTAGCAGG - Intronic
1008904202 6:56658183-56658205 TTCCTAGCTACTCGGGAGGCTGG - Intronic
1008954714 6:57201978-57202000 TTATTATGGACTTGGAATGCTGG - Intronic
1011943873 6:92876490-92876512 GTCCTAGCTACTAGGGATGCTGG + Intergenic
1013265918 6:108498854-108498876 ATCCCAGCTACTTGGAAAGCTGG + Intronic
1013391804 6:109692816-109692838 ATCCTAGCTACTTGGGAGGCTGG - Intronic
1013399115 6:109773924-109773946 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1014741982 6:125156346-125156368 GGCCTAGCTACTTGGAAGGCTGG + Intronic
1015986398 6:138888426-138888448 GTCCTAGCTACTTGGGAGGCAGG - Intronic
1016315315 6:142779181-142779203 TTAGGAGCTACTTGGGAAGCAGG - Intronic
1016422682 6:143901375-143901397 ATCCAAGCTACTTGGAAGGCTGG - Intronic
1016925443 6:149341728-149341750 TTGCTAGTTACTGGAAATGCAGG + Intronic
1017424711 6:154308230-154308252 GTCCCAGCTACTTGGAAAGCTGG - Intronic
1018030547 6:159837779-159837801 GTCCTAGCTACTTGGGATGCTGG + Intergenic
1019569205 7:1701682-1701704 GTTCTAGCTACTTGGGAGGCTGG + Intronic
1021205457 7:17774544-17774566 TTAAGAGCAACTTGGAATTCTGG + Intergenic
1022432010 7:30333485-30333507 ATCCCAGCTACTTGGAAGGCTGG - Intronic
1023083066 7:36544062-36544084 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1023407577 7:39851085-39851107 ATACCAGCTACTTGGATAGCTGG - Intergenic
1023793049 7:43769143-43769165 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1025038334 7:55617040-55617062 TTACTAGATCCTTGGAAGGATGG - Intergenic
1025856510 7:65284863-65284885 ATCCTAGCTACTTGGGAGGCTGG + Intergenic
1026235505 7:68523256-68523278 GTCCAAGCTACTTGGAAGGCTGG + Intergenic
1026572045 7:71539816-71539838 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1026823671 7:73567378-73567400 ATCCTAGCTACTTGGGAGGCTGG + Intergenic
1027217481 7:76193367-76193389 CTTCAAGCTACTTGGAAGGCTGG - Intergenic
1027656416 7:80935845-80935867 GTCCTAGCTACTTGGGAGGCAGG + Intergenic
1028151021 7:87371874-87371896 CTCCCAGCTACTTGGAAGGCTGG + Intronic
1028408436 7:90501550-90501572 GTACTAGCTACTTGGGAGGCTGG + Intronic
1028524644 7:91770062-91770084 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1029116510 7:98240529-98240551 ATCCTAGCTACTTGGGAGGCAGG - Intronic
1029478075 7:100797017-100797039 GTCCCAGCTACTTGGAAAGCAGG + Intronic
1030377750 7:108772988-108773010 ATCCTAGCTACTTGGAAGGTTGG + Intergenic
1032153578 7:129450698-129450720 ATCCTAGCTACTTGGGAGGCTGG - Intronic
1033263952 7:139868599-139868621 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1033335069 7:140445292-140445314 GTTCTAGCTACTTGGGAGGCTGG + Intergenic
1034263210 7:149769796-149769818 TTCCCAGCTACTTGGGAGGCTGG - Intronic
1034666678 7:152823811-152823833 AGAGTAGCTACTTGTAATGCTGG - Intronic
1035790111 8:2296850-2296872 GTACCAGCTACTTGGGAGGCTGG + Intergenic
1035802694 8:2424855-2424877 GTACCAGCTACTTGGGAGGCTGG - Intergenic
1036290804 8:7487969-7487991 TTGCTGGTTACCTGGAATGCTGG + Intronic
1036330685 8:7823568-7823590 TTGCTGGTTACCTGGAATGCTGG - Intronic
1036600753 8:10258365-10258387 TCACTGGCTAATTGGAAAGCAGG + Intronic
1040568466 8:48587611-48587633 TAACAAGCTGCCTGGAATGCAGG + Intergenic
1041733737 8:61088533-61088555 TTAATAGATACTTGGATTACTGG + Intronic
1042247605 8:66723559-66723581 TTCCCAGCTACTTGGGAGGCTGG - Intronic
1042278627 8:67030627-67030649 ATCCTAGCTACTCGGAAGGCTGG + Intronic
1042428462 8:68676214-68676236 GTCCCAGCTACTTGGAAGGCTGG + Intronic
1042813204 8:72848287-72848309 TTAGTAGCTACTTGAATTGTTGG + Intronic
1042923611 8:73943806-73943828 GTTCTAGCTACTTGGGAGGCTGG + Intronic
1043293988 8:78641358-78641380 ATCCCAGCTACTTGGAAGGCTGG + Intergenic
1043851840 8:85224866-85224888 TTTCTACCTTCTTGAAATGCTGG - Intronic
1044990779 8:97793923-97793945 GTCCTAGCTACTTGGCAGGCTGG - Intronic
1045094846 8:98786428-98786450 GTTCTAGCTACTTGGGAGGCTGG + Intronic
1045308516 8:100980335-100980357 GTCCTAGCTACTTGGGAGGCTGG + Intergenic
1045573004 8:103389127-103389149 ATCCTAGCTACTGGGAAGGCTGG - Intergenic
1045983702 8:108222295-108222317 ATCCCAGCTACTTGGAAGGCTGG - Intronic
1047246763 8:123152751-123152773 ATCCCAGCTACTTGGAAGGCAGG + Intergenic
1047286272 8:123489843-123489865 ATCCTAGCTACTTGGGAAGCTGG + Intergenic
1047851383 8:128861192-128861214 TTGGTAGTTACTTGGAATTCAGG - Intergenic
1047970533 8:130080590-130080612 GTCCCAGCTACTTGGGATGCTGG - Intronic
1048022506 8:130553070-130553092 GTCCTAGCTACTTGGGATGCTGG - Intergenic
1048267963 8:133004288-133004310 CTACTAGCTGCTGGGAATGAGGG + Intronic
1049975763 9:860177-860199 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1050092300 9:2027322-2027344 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1050346513 9:4694195-4694217 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1050463996 9:5901634-5901656 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1051565946 9:18498452-18498474 ATCCTAGCTACTTGGGAGGCTGG - Intronic
1051620657 9:19046746-19046768 ATCCTAGCTACTTGGGAGGCTGG + Intronic
1052577398 9:30307407-30307429 ATCCCAGCTACTTGGAATCCAGG - Intergenic
1052980095 9:34441839-34441861 GTCCTAGCTACTTGGCAGGCAGG - Intronic
1053186975 9:36024520-36024542 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
1053215875 9:36270077-36270099 GTCCCAGCTACTTGGGATGCTGG - Intronic
1055919170 9:81439614-81439636 ATCCTAGCTACTTGGGAGGCTGG - Intergenic
1056207063 9:84329779-84329801 GTCCCAGCTACTTGGAAGGCTGG + Intronic
1058042351 9:100316717-100316739 GTACTAGCTACTTGGAAGGTTGG - Intronic
1058697681 9:107573647-107573669 GTCCTAGCTACTTGGGAGGCTGG - Intergenic
1058909362 9:109506718-109506740 GTCCCAGCTACTTGGAAGGCTGG - Intergenic
1059723290 9:116982681-116982703 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1060753052 9:126186798-126186820 ATCCCAGCTACTTGGAAGGCTGG + Intergenic
1061267768 9:129517599-129517621 GTTCTAGCTACTTGGGAGGCTGG - Intergenic
1061350753 9:130062839-130062861 GTACTAGCTACTAGGCAGGCAGG - Intronic
1061672320 9:132195744-132195766 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1186568852 X:10693310-10693332 GTCCCAGCTACTTGGAAGGCTGG - Intronic
1187024573 X:15420717-15420739 GTCCTAGCTACTTGGGAGGCTGG + Intronic
1187339491 X:18408587-18408609 GTCCTAGCAACTGGGAATGCTGG - Intergenic
1189299911 X:39944944-39944966 GTCCCAGCTACTTGGAAGGCTGG + Intergenic
1189791977 X:44613160-44613182 GTCCTAGCTACTTGGGAGGCTGG + Intergenic
1190172513 X:48122756-48122778 TTCCCAGCTACTCGGAAGGCTGG - Intergenic
1190771997 X:53522587-53522609 TTCCCAGCTACTTGGGAAGCTGG + Intergenic
1190826983 X:54026712-54026734 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1193023798 X:76822048-76822070 ATCCTAGCTACTTGGGAGGCTGG - Intergenic
1194124693 X:90001456-90001478 TTACTAGAGGCTTGGAATGGGGG + Intergenic
1194125353 X:90009628-90009650 GTCCTAGCTACTTGGGAGGCAGG - Intergenic
1194723330 X:97365817-97365839 GTCCTAGCTACTTGGGAGGCTGG - Intronic
1195121219 X:101754980-101755002 ATACTAGTTACTTTGAATGGTGG + Intergenic
1195861136 X:109384636-109384658 TTCCAAGCTACTTGGATTGAGGG + Intronic
1196428791 X:115600237-115600259 GTCCTAGCTACTAGGAAGGCTGG - Intronic
1196860172 X:120019932-120019954 TTGTGAGCCACTTGGAATGCCGG - Intergenic
1198449794 X:136755476-136755498 TTAGTAGCTGCTAGGAAAGCAGG - Intronic
1198717645 X:139577088-139577110 TTTTTAGCTAATTGTAATGCAGG - Intergenic
1199752181 X:150830432-150830454 GTTCCAGCTACTTGGAAGGCTGG + Intronic
1200045634 X:153399882-153399904 TTACTAGCCATTTGGAAGGAAGG - Intergenic
1200477587 Y:3659067-3659089 TTACTAGAGGCTTGGAATGGGGG + Intergenic
1202171532 Y:22050667-22050689 ATACTAGCTACTGGGGAGGCTGG - Intergenic
1202219830 Y:22535705-22535727 ATACTAGCTACTGGGGAGGCTGG + Intergenic
1202323347 Y:23660378-23660400 ATACTAGCTACTGGGGAGGCTGG - Intergenic
1202547424 Y:26009676-26009698 ATACTAGCTACTGGGGAGGCTGG + Intergenic