ID: 1167078626

View in Genome Browser
Species Human (GRCh38)
Location 19:47264475-47264497
Sequence GCAAATGGTCAGATGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167078624_1167078626 -6 Left 1167078624 19:47264458-47264480 CCTGGAGCACGCTGAGAGCAAAT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1167078620_1167078626 22 Left 1167078620 19:47264430-47264452 CCAGCCAGCCTCATCAGTTCACT 0: 1
1: 1
2: 2
3: 17
4: 182
Right 1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1167078621_1167078626 18 Left 1167078621 19:47264434-47264456 CCAGCCTCATCAGTTCACTGCTG 0: 1
1: 0
2: 1
3: 14
4: 235
Right 1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1167078622_1167078626 14 Left 1167078622 19:47264438-47264460 CCTCATCAGTTCACTGCTGACCT 0: 1
1: 0
2: 1
3: 23
4: 198
Right 1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 148
1167078619_1167078626 27 Left 1167078619 19:47264425-47264447 CCTGGCCAGCCAGCCTCATCAGT 0: 1
1: 0
2: 0
3: 23
4: 232
Right 1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167078626 Original CRISPR GCAAATGGTCAGATGCCAGC AGG Intronic
901322014 1:8345783-8345805 GAAGATGGTCAGAGGCCAGATGG - Intergenic
902559958 1:17271120-17271142 GCAGATGGTCAGCTTGCAGCCGG - Exonic
905522430 1:38610565-38610587 AGACCTGGTCAGATGCCAGCAGG - Intergenic
906288731 1:44605404-44605426 CCAAAGAGGCAGATGCCAGCTGG - Intronic
907182789 1:52585636-52585658 GCTCATGGCCATATGCCAGCTGG + Intergenic
908006352 1:59732960-59732982 GCGAATGAACAGAAGCCAGCAGG - Intronic
910526291 1:88182660-88182682 TCAAAGGGTCACAGGCCAGCAGG - Intergenic
910958543 1:92734718-92734740 GAGAATGGTAAGCTGCCAGCTGG + Intronic
911097068 1:94063415-94063437 GGAAATGGTCAAATGCAAGGAGG + Intronic
912389490 1:109292497-109292519 GCAAATGGCCAGAGGACACCAGG + Exonic
914922821 1:151859139-151859161 GCTAAGGGTCAGAGGCAAGCTGG + Intergenic
915926313 1:160022574-160022596 GACAATGGCAAGATGCCAGCAGG + Intergenic
916744769 1:167676687-167676709 GCAAATTCCCAGGTGCCAGCAGG - Intronic
916890839 1:169110876-169110898 CCAAATGCTCAGATGCCTGAGGG - Intronic
918306528 1:183251671-183251693 GTAAATGAACAGATGCCACCAGG + Exonic
920413820 1:205784186-205784208 GCATAAGACCAGATGCCAGCTGG - Intergenic
921742570 1:218702922-218702944 GGAAATGAGAAGATGCCAGCTGG + Intergenic
923036437 1:230288042-230288064 GAAGTTGGTCCGATGCCAGCAGG + Intergenic
923649344 1:235858912-235858934 ACAAATGTACAGAGGCCAGCAGG - Intronic
924514056 1:244751632-244751654 GCACCTGGTCATATGTCAGCAGG - Intergenic
1065903990 10:30232232-30232254 GAAAAAGGTCATATGCCAGCCGG - Intergenic
1069898174 10:71691780-71691802 GCAGGTGGTCAGTGGCCAGCAGG + Intronic
1075477755 10:122751091-122751113 GCACATGGTCACATGCCATGAGG + Intergenic
1076117218 10:127908638-127908660 GCAAAAGGTCAGAGGCGAGGTGG + Intronic
1076182705 10:128422880-128422902 GCCGATGGGCAGGTGCCAGCGGG + Intergenic
1076571824 10:131438221-131438243 GCACATGGCCAGATGCCCGCTGG + Intergenic
1076783302 10:132736424-132736446 GTACATGCTCAGGTGCCAGCTGG + Intronic
1080581886 11:33651017-33651039 GCAAGAGGTTAGATGCCAGTGGG - Intronic
1081351620 11:42060314-42060336 GCCCATCGTTAGATGCCAGCTGG - Intergenic
1083194047 11:61072426-61072448 GCATGTGGCCAGATGCCAGGGGG + Intergenic
1085808754 11:79660998-79661020 GCCAATGGGGAGATGCCAGCAGG - Intergenic
1090725020 11:129517475-129517497 GGCACTGGTCTGATGCCAGCTGG + Intergenic
1090917192 11:131175951-131175973 GCAAATGCTCAGATAGAAGCAGG - Intergenic
1091256119 11:134187535-134187557 GCAAAAGCTCAGAGGCCAGAAGG - Intronic
1097763274 12:63493517-63493539 GGCACTGGCCAGATGCCAGCTGG + Intergenic
1099991140 12:89721642-89721664 GTAAATGGTCAGAACCCGGCAGG - Intergenic
1103912277 12:124359130-124359152 GCAAAGGGCGAGAGGCCAGCAGG - Intronic
1104729823 12:131098574-131098596 GCCAGTGGTGAGAAGCCAGCAGG + Intronic
1107826652 13:44334480-44334502 TCAAATGTTCTGATCCCAGCAGG + Intergenic
1112493427 13:99886851-99886873 GCAAATGGTAAGCTCCCAGAGGG + Intronic
1113351753 13:109536219-109536241 GGAGATGCTGAGATGCCAGCTGG + Intergenic
1118758929 14:68866024-68866046 GCAGAGGCTCAAATGCCAGCAGG - Intergenic
1122873452 14:104651813-104651835 GCACGTGGTCAGATGCTTGCGGG - Intergenic
1123809098 15:23905376-23905398 GCACACTGACAGATGCCAGCAGG - Intergenic
1126289660 15:47059244-47059266 GCAATGGGTCAGATGGCAGAAGG - Intergenic
1129287250 15:74535569-74535591 GCAGTTGGTCAGATGTCAGATGG + Intergenic
1130722969 15:86408040-86408062 TCACATGGTCAGCTCCCAGCAGG + Intronic
1132291757 15:100708840-100708862 GCTAATGGACAGAGCCCAGCAGG + Intergenic
1132783476 16:1641709-1641731 GCAACTGGGCAGATGTCAACTGG - Intronic
1137247553 16:46717922-46717944 GCAAATGCTCATTTGGCAGCGGG + Intronic
1138146921 16:54620866-54620888 GCAAAAACTCAGATACCAGCAGG + Intergenic
1139366095 16:66434403-66434425 GCAGAGGGTCTGATGCCACCAGG + Intronic
1139570304 16:67807283-67807305 ATCAATGGTCAGAGGCCAGCAGG - Exonic
1141632184 16:85294135-85294157 GCAGCTGGAGAGATGCCAGCTGG - Intergenic
1142714087 17:1738522-1738544 GCAAATTGTGAGAAGGCAGCAGG - Exonic
1142821822 17:2475036-2475058 GGATATGGTCAGATGAGAGCAGG - Intronic
1143011966 17:3870904-3870926 GGAAATGGACAGAAGCCAGCTGG + Intronic
1145882966 17:28365159-28365181 GCAAAGGGTAAGGTGCCAGAGGG + Exonic
1146058502 17:29592903-29592925 GCAAAAGGCAAAATGCCAGCGGG + Intronic
1151700421 17:75739926-75739948 CCAAGTGGTCAGAGGCCATCAGG - Exonic
1152330175 17:79668220-79668242 GTAAATGGTCACCTGCCACCTGG + Intergenic
1154219840 18:12442287-12442309 TCAAATGTTCAGATGCAGGCCGG - Intergenic
1156896049 18:42246866-42246888 GCAAAAGGTTAAATGGCAGCAGG + Intergenic
1157618371 18:49001316-49001338 GCAAAGGGCACGATGCCAGCTGG - Intergenic
1160075874 18:75676235-75676257 GCAAAAGGTAAAATGTCAGCTGG - Intergenic
1160601946 18:80020464-80020486 GCAACTGCTCAGAGGCAAGCTGG + Intronic
1164938069 19:32230335-32230357 CCAAAGGAGCAGATGCCAGCAGG + Intergenic
1166826597 19:45613689-45613711 GGAAGTGGTAAGATGTCAGCTGG + Intronic
1167078626 19:47264475-47264497 GCAAATGGTCAGATGCCAGCAGG + Intronic
1168126496 19:54286253-54286275 GTGAGTGGTCAGGTGCCAGCAGG - Intergenic
1168175397 19:54624610-54624632 GTGAGTGGTCAGGTGCCAGCAGG + Intronic
925505254 2:4555082-4555104 GCAAATGGGAAGAGGCCAGGAGG + Intergenic
925722469 2:6842459-6842481 GCAACTGTTCAGAGGCAAGCTGG + Intronic
925937554 2:8780175-8780197 GTGAAAGGTCAGATGCCATCAGG - Intronic
926942032 2:18148552-18148574 GCATGTGCTCAGATGCCATCAGG + Intronic
927136160 2:20097917-20097939 GCAAAGTGTGAGATGTCAGCCGG + Intergenic
927376242 2:22417862-22417884 GCACATGTTCATATGGCAGCAGG - Intergenic
933166558 2:79083145-79083167 GGCACTGGCCAGATGCCAGCTGG + Intergenic
933703649 2:85273943-85273965 GCTCCTGGTCAGAGGCCAGCAGG + Intronic
934516288 2:94989258-94989280 GCAACAGGTCAGCTGACAGCTGG + Intergenic
937324023 2:120978353-120978375 GCAGGTGGTCAGCTGACAGCAGG + Intronic
941299090 2:163778479-163778501 GCACATGGTTAGTAGCCAGCAGG + Intergenic
942407300 2:175669067-175669089 GGCACTGGCCAGATGCCAGCTGG - Intergenic
945563894 2:211371855-211371877 CCAAATGGTCAGGTACCAGATGG + Intergenic
945699057 2:213148818-213148840 GCAAATGATCTGATTCCTGCTGG + Intronic
947245248 2:228039964-228039986 GCAAGGGGTCAGATGACAGCAGG + Intronic
947958945 2:234218467-234218489 TCATATGGACAAATGCCAGCTGG - Intergenic
1170769519 20:19319843-19319865 TCAAATGGGCACAGGCCAGCTGG - Intronic
1177879390 21:26674101-26674123 AGAAATGTACAGATGCCAGCAGG + Intergenic
1179017931 21:37609799-37609821 GCAAATTGTCAGTAGCCTGCTGG + Exonic
1179642573 21:42757104-42757126 GCCACTGGTCAGCTGCCACCTGG - Intronic
1180979588 22:19872335-19872357 GCAGGTGGGCAGAGGCCAGCAGG + Intergenic
1180982233 22:19884252-19884274 GACACTGGTCAGATGACAGCCGG + Intronic
1184207666 22:43015183-43015205 GCCAATGGACAGAGCCCAGCGGG - Intergenic
952694018 3:36244876-36244898 GCAAATGGTGAGATGACAGTTGG + Intergenic
955790081 3:62579930-62579952 GCCAATGGTGAGATGGAAGCAGG + Intronic
961404430 3:126668273-126668295 GCACATTGTGAGATGCAAGCAGG + Intergenic
961518666 3:127454692-127454714 GCAAATGGTCAGAGGGCTCCAGG - Intergenic
961637448 3:128342307-128342329 GCACATGGGCAGATCCCAGCTGG - Intronic
961968939 3:130938542-130938564 GCAAATGATCTGATTCCAACTGG - Intronic
977046980 4:92079739-92079761 GGCACTGGCCAGATGCCAGCTGG - Intergenic
978198873 4:106001548-106001570 ACAAATGGTAAGTGGCCAGCAGG + Intronic
978650097 4:110992892-110992914 GCAAATGGTAACACGCCAACTGG + Intergenic
981690083 4:147498645-147498667 GCAGTTGGTGAGATGCCACCAGG - Intronic
983840941 4:172455951-172455973 GGTAACCGTCAGATGCCAGCTGG - Intronic
985608427 5:871938-871960 GCAACTGGTCATATTCCAGGTGG - Intronic
986179948 5:5384224-5384246 GCAAATGTTCTGATGCCTGTAGG - Intergenic
992412963 5:76525253-76525275 GGAAATTGTTACATGCCAGCCGG + Intronic
993924152 5:93844684-93844706 GAAAATGCTAAGATGACAGCTGG + Intronic
996771317 5:127088804-127088826 TCAAGTTGTCAGACGCCAGCAGG + Intergenic
997732385 5:136191171-136191193 GCAAAAGGGAAGATGCCAGGTGG + Intergenic
1001150233 5:169220923-169220945 GTGAAGGGTCAGATGCCAGAAGG - Intronic
1004419947 6:15460308-15460330 CAACATGGTCAGAGGCCAGCTGG - Intronic
1004760855 6:18664452-18664474 GGAAATGATGAGATTCCAGCTGG - Intergenic
1006406501 6:33848757-33848779 ACAAATGGCCAGATGGCAGAGGG - Intergenic
1007004835 6:38351292-38351314 GCAAATGGTCAGATAGCATCAGG - Intronic
1008329795 6:50231161-50231183 TCAAATGGTGACATGCCATCAGG - Intergenic
1008448299 6:51619272-51619294 GCAGTTGCTCAGATACCAGCTGG - Exonic
1009655107 6:66534004-66534026 GCAAAAGGGCAGCTGCCAACAGG - Intergenic
1011298860 6:85853272-85853294 GGCAATTGCCAGATGCCAGCTGG + Intergenic
1013360068 6:109385597-109385619 GGAGTTGGTCAGATGCCAGAAGG - Intergenic
1017960976 6:159220289-159220311 GCACATGTTCAGATGGCAGCAGG - Intronic
1018808178 6:167277348-167277370 CCCCATGGTCAGAGGCCAGCTGG - Intronic
1018915336 6:168129411-168129433 TCAGATGGTCAGATGGCGGCCGG + Intergenic
1019273331 7:162903-162925 CCCCATGGCCAGATGCCAGCAGG + Intergenic
1020613358 7:10428104-10428126 GCAACAGGTTAAATGCCAGCAGG - Intergenic
1021654801 7:22864452-22864474 GCAAAGGACCAGAGGCCAGCAGG + Intergenic
1022302004 7:29110515-29110537 GTAAATTGGCAGAAGCCAGCAGG - Intronic
1023094174 7:36643434-36643456 GCAAAAGGTCAGATACCAAGGGG + Intronic
1023866034 7:44238880-44238902 GCCCATGGTCACAAGCCAGCAGG + Intronic
1025628365 7:63244327-63244349 GCAAATGGTCAGCTCCCTGTAGG + Intergenic
1032384176 7:131510022-131510044 GCATATGGTCTGAAGTCAGCAGG - Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1035060714 7:156067262-156067284 GCAACTGGACATATGCCTGCGGG + Intergenic
1035651969 8:1273331-1273353 GCAAATGCTCAGCTGGCAACAGG - Intergenic
1035775187 8:2182377-2182399 CCAAATGCTCAGAGGCCACCTGG - Intergenic
1036766581 8:11553440-11553462 CCAAATTGTCAGAAGCCATCAGG + Intronic
1038006480 8:23434752-23434774 GTACATGGTGAAATGCCAGCTGG - Intronic
1039331177 8:36538758-36538780 GCTCATAGGCAGATGCCAGCAGG - Intergenic
1041582466 8:59477426-59477448 GCAACTGGGCAGAGGCCATCAGG + Intergenic
1042055164 8:64756640-64756662 GCAGATTGTGAGATGCTAGCGGG - Intronic
1043310646 8:78855178-78855200 GCAAAATTTCAGATCCCAGCAGG - Intergenic
1043647166 8:82535751-82535773 GGCACTGGCCAGATGCCAGCAGG + Intergenic
1048048907 8:130798642-130798664 GCTAATGGTGAGATGCAGGCAGG + Intronic
1053415434 9:37944351-37944373 GTCAGTGGTCAGCTGCCAGCCGG + Intronic
1055385634 9:75759146-75759168 GCAAATGATAAGAAGCCAGATGG + Intergenic
1056184907 9:84125064-84125086 GCCTATGGTCAGGTGTCAGCTGG - Intergenic
1056249311 9:84731901-84731923 GCAGATCTTCAGATGTCAGCAGG + Intronic
1056427339 9:86490455-86490477 GCATATGGTCAGACGCCTGCAGG - Intergenic
1056479750 9:86989397-86989419 GGACATGGTCAGATTCCAGATGG - Intergenic
1057894253 9:98894480-98894502 ACAAATTTACAGATGCCAGCTGG + Intergenic
1059531486 9:115039538-115039560 GGAAATGGTCAGATTCATGCTGG - Intronic
1203496692 Un_GL000224v1:158308-158330 ACAAATATTCAGATGACAGCAGG + Intergenic
1203497092 Un_GL000224v1:162230-162252 ACAAATATTCAGATGACAGCAGG + Intergenic
1203509315 Un_KI270741v1:100230-100252 ACAAATATTCAGATGACAGCAGG + Intergenic
1186140620 X:6568014-6568036 GGAGATGGGGAGATGCCAGCAGG - Intergenic
1193394555 X:80968356-80968378 GGAACTAGCCAGATGCCAGCCGG - Intergenic
1193807330 X:86010868-86010890 TCAAATGGACAGATCACAGCAGG - Intronic
1201622059 Y:15970230-15970252 GGAGATGGGGAGATGCCAGCAGG - Intergenic