ID: 1167086362

View in Genome Browser
Species Human (GRCh38)
Location 19:47312380-47312402
Sequence AAAGATAAGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1636
Summary {0: 1, 1: 1, 2: 9, 3: 177, 4: 1448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167086362_1167086367 11 Left 1167086362 19:47312380-47312402 CCAGCCTCCTTCTCCTTATCTTT 0: 1
1: 1
2: 9
3: 177
4: 1448
Right 1167086367 19:47312414-47312436 AATACTAGAATCTACATCATAGG 0: 1
1: 0
2: 12
3: 103
4: 732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167086362 Original CRISPR AAAGATAAGGAGAAGGAGGC TGG (reversed) Intronic
900017601 1:163821-163843 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
900047860 1:522417-522439 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
900070077 1:764281-764303 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
900572501 1:3365454-3365476 CAATATAAGGAGGAAGAGGCGGG - Intronic
900664424 1:3805106-3805128 AGTGATAAGGAGAAGAAGTCTGG + Intergenic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901217861 1:7564898-7564920 ATAGTCAAGGAGAAGGAGGGTGG + Intronic
901406545 1:9051188-9051210 AAAGAAAAAGAGAAGAAGGAAGG + Intronic
901692889 1:10985245-10985267 AAAGAAAAAGAGAAACAGGCTGG - Intergenic
901865806 1:12106013-12106035 AAACATGAAGAGAAGAAGGCAGG - Intronic
902159293 1:14516811-14516833 ATAGAAAAGAAGAAGAAGGCTGG - Intergenic
902755352 1:18545774-18545796 ACAGAGGAGGAGAGGGAGGCTGG - Intergenic
903021358 1:20397536-20397558 GAAGACAAGGAGAAGGGGGCTGG + Intergenic
903524647 1:23983903-23983925 AAAGAAAAGAAGAAAGAGGCCGG - Intergenic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904165291 1:28550712-28550734 AAAGAAAAGAAAAAAGAGGCTGG + Intergenic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904295747 1:29518784-29518806 GGAGAAAAGGAGAAGGAGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904357045 1:29947022-29947044 AAAGAGAAGGAGGAGGAGGTTGG - Intergenic
904357090 1:29947337-29947359 ATAGATAAGAAGACTGAGGCTGG - Intergenic
904381921 1:30117211-30117233 AGAGCTCTGGAGAAGGAGGCTGG - Intergenic
904455379 1:30644834-30644856 AAAGAAAAGGAAAAGGAGGGAGG - Intergenic
904541670 1:31238072-31238094 ACAGATAAGAAGACTGAGGCCGG + Intronic
904849779 1:33448592-33448614 AAAAAGAAGTAGAAGAAGGCAGG + Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904977347 1:34467100-34467122 AAAGATAGGGGAAAGGCGGCAGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905140933 1:35843737-35843759 ACAGTTAAGGAGAAGGTGGCAGG - Intronic
905566768 1:38971799-38971821 AAAGAAAAGAAAAAGGAGGCCGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905657460 1:39693958-39693980 AAAAATAAGGAGGCTGAGGCAGG + Intronic
905942920 1:41878686-41878708 AAAGAGAGGGAGGAGGAGGGAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906291720 1:44623736-44623758 CAAGATAAGGTCCAGGAGGCAGG + Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906335180 1:44923780-44923802 AGAGAGAAAGAGAAGGAGGGAGG - Intronic
906561747 1:46763353-46763375 AAAGATAAAGCCAAGGAGGGTGG + Intronic
906613834 1:47221742-47221764 ATAGCTAAGGAGACTGAGGCTGG + Intronic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
907248119 1:53120803-53120825 ACAGGAAAGGAGAAGAAGGCGGG - Intronic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907513225 1:54977877-54977899 AAAAAAAAGAAGAAGAAGGCAGG + Intergenic
907683057 1:56582008-56582030 ACAGATAAGGAAAAGCAGACAGG - Intronic
907982533 1:59498222-59498244 ACAAATGAGGAGAAGTAGGCTGG + Intronic
908247889 1:62242394-62242416 AAAGAAAAAGAGAAGGGTGCAGG + Intronic
908391941 1:63691123-63691145 GGAGACCAGGAGAAGGAGGCAGG + Intergenic
908515134 1:64884531-64884553 GAAGATAAGGTGAGGAAGGCTGG - Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
908741772 1:67336266-67336288 ACAGCTGAGGACAAGGAGGCTGG - Intronic
910125125 1:83832196-83832218 AAAAATGAGGAAAAGGATGCAGG + Intergenic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
910228576 1:84962783-84962805 AAAGACAAGTTGAAGGAGACTGG + Intronic
910744445 1:90558234-90558256 AAAGATAAGGAGTTGGAGCTTGG - Intergenic
910963171 1:92783515-92783537 AAAGAAAAGAAAAAGAAGGCCGG + Intronic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912327444 1:108781441-108781463 AAAGATAAGGGGAATCAGTCAGG + Intronic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912602864 1:110955889-110955911 ATACACAATGAGAAGGAGGCAGG + Intronic
913008866 1:114662957-114662979 AAAGAAAAGGAAAAGGAAGAAGG + Intronic
913177302 1:116286541-116286563 AAAGATAAGGTGTGGGGGGCTGG + Intergenic
913403520 1:118462385-118462407 AAAGATAAGGCCAGGGAGGGAGG - Intergenic
913556075 1:119968492-119968514 GAAGATAAGAAGACGGAGACAGG + Intronic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914001244 1:143696562-143696584 AAAGAAAAGAAAAAGAAGGCCGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914513286 1:148352971-148352993 GCAGAGAAGGAGGAGGAGGCAGG + Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914805908 1:150991529-150991551 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915213912 1:154327972-154327994 AGAGACTGGGAGAAGGAGGCTGG + Intronic
915614753 1:157028868-157028890 AAAGATATGGAGAAACTGGCTGG + Intronic
916105190 1:161424527-161424549 AAAGAAAAAGGGAGGGAGGCAGG - Intergenic
916350395 1:163842990-163843012 AAAGCTAAGGAAAAGAAGTCTGG + Intergenic
916431094 1:164729368-164729390 AAAGATAAGGAAAAAAAGGAAGG - Intronic
916607313 1:166355774-166355796 AAACATGATGAGAAGGGGGCAGG - Intergenic
916616257 1:166444168-166444190 AGAGAGAAGGAGAAGGAGAAAGG + Intergenic
916664166 1:166950399-166950421 AAAGAGAAGGAGAAGGAGAGAGG + Intronic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
917138049 1:171806709-171806731 AAAGAAAAAGAGAAAGAGGAAGG - Intronic
917191642 1:172424685-172424707 AGAGATAAGAACAAGGAGGCCGG - Intronic
917606799 1:176639560-176639582 AAAGATGGGAAGAAGTAGGCAGG - Intronic
917695600 1:177520082-177520104 AAAGAAAAGCAGAATGAGCCTGG + Intergenic
918739559 1:188110745-188110767 AAAGATAAGGAGAGGGATGAAGG + Intergenic
918876362 1:190049597-190049619 AAAGATAGGGAGCAGGATGAAGG + Intergenic
919016764 1:192048504-192048526 AAAAAGAAGGAGAAGGAGAAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919045149 1:192441953-192441975 AAAGATAAGGGGAAGGCACCCGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919511462 1:198470718-198470740 AGAGAGAAGGAGAAAGAGTCAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919868531 1:201802482-201802504 AAAGAAAAGAAAAAGGAGGCCGG + Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920222805 1:204416658-204416680 AAAGAAAAGAAGAAAGAGGGAGG + Intergenic
920654777 1:207867393-207867415 TGAGATCAGGAGAAGGAGCCAGG + Intergenic
920916595 1:210262578-210262600 AAAAATGAGGAGAAGGAAGGAGG - Intergenic
921038794 1:211409014-211409036 AAAAATAAAGAGAAGAAGTCTGG + Intergenic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
921713182 1:218393460-218393482 CAAGATCAGTAGAAGGAAGCCGG - Intronic
921718401 1:218443350-218443372 AAAGAGCAGCATAAGGAGGCGGG + Exonic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
921972033 1:221160303-221160325 ATAGATAAGGAAACTGAGGCTGG - Intergenic
922105446 1:222509737-222509759 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
922209497 1:223476717-223476739 AGAGAAGAGGAGAAGGAGGAGGG + Intergenic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922867873 1:228875940-228875962 AATAATAAGGAGGAGGAGGGAGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
922902244 1:229146228-229146250 GAAGTGCAGGAGAAGGAGGCAGG + Intergenic
922963569 1:229668395-229668417 GGAGCTAAGGAAAAGGAGGCTGG - Intergenic
923005158 1:230043759-230043781 AAAGATCAGCTGGAGGAGGCAGG + Intergenic
923148791 1:231216141-231216163 AGAGAGAAAGAGAAGGAGGGAGG - Exonic
923566508 1:235080410-235080432 AAAGAGAAGGGAAGGGAGGCAGG + Intergenic
923959434 1:239060025-239060047 AGAGAATAGGAAAAGGAGGCTGG - Intergenic
924347621 1:243087268-243087290 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924628276 1:245713758-245713780 ACAGATGAGGAGATGGAGCCTGG - Intergenic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1063218093 10:3942219-3942241 AAAGAAAAAGAGAGAGAGGCAGG + Intergenic
1063435999 10:6031288-6031310 AAAGATAAGCATAAGGAAGCTGG + Intronic
1063487412 10:6432898-6432920 AAAGATGAGGGGAGGGAAGCAGG - Intronic
1063503796 10:6579093-6579115 AAAGAAAAGGTCAAAGAGGCCGG + Intronic
1063524840 10:6775376-6775398 AAAGATAAGGAGAAGAGAGATGG - Intergenic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063559668 10:7114405-7114427 AAAGCGCCGGAGAAGGAGGCAGG - Intergenic
1063611646 10:7567888-7567910 ACAGATAAGGAAATTGAGGCAGG - Intronic
1063623987 10:7672149-7672171 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
1063890732 10:10625667-10625689 AAAGAGAAGTTGAAGGAAGCTGG - Intergenic
1063917880 10:10902959-10902981 GAAGATAAGGAGAAGAAGGGAGG + Intergenic
1063923110 10:10951143-10951165 AAAGAAAAGAAAAAGGAGGATGG - Intergenic
1064294766 10:14068877-14068899 AAAGAGAGGGAGAGGGAGGGAGG - Intronic
1064294774 10:14068907-14068929 AAAGAGAGGGAGAGGGAGGGAGG - Intronic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1064355528 10:14614375-14614397 AAAGAGACAGAGAAGGAGTCAGG + Intronic
1065492921 10:26300534-26300556 AAAGTCAAGGACAAGGTGGCAGG + Intronic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066176205 10:32909538-32909560 AATGATAAGGAGACACAGGCTGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066371526 10:34821991-34822013 AAAGAAAAGGGGAGGGAGGAAGG + Intergenic
1066728733 10:38417616-38417638 AAAGAAAAAGAGAAAGAAGCAGG - Intergenic
1067028150 10:42861556-42861578 AAAGATTAGCAAATGGAGGCTGG - Intergenic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1067291321 10:44945403-44945425 AAAGATAAGGACAGGGAGCAGGG - Intergenic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1067739039 10:48881019-48881041 AAAGATAACAGAAAGGAGGCTGG - Intronic
1067846189 10:49723594-49723616 AAATATACAGAAAAGGAGGCTGG - Intergenic
1067973052 10:50992886-50992908 AAAGATTAAGAGAGGTAGGCGGG - Intronic
1068550712 10:58404830-58404852 AAAGAAAGGCAGAAGGAGTCTGG - Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1068942472 10:62693142-62693164 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
1069055862 10:63844088-63844110 AAGGATAAGGAGAAGGAAATAGG - Intergenic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069455390 10:68549924-68549946 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1069555832 10:69397604-69397626 AAAGATAAGGCAACTGAGGCTGG - Intronic
1069683248 10:70300144-70300166 ACAGATGAGGAGAAGGTGGGAGG + Exonic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069786893 10:70994225-70994247 AAAGATTAGGAAAAGCAGACTGG + Intergenic
1069972896 10:72188514-72188536 AAAGAAAAGGAAAAGGAGAAAGG + Intronic
1070215878 10:74380055-74380077 AAAGACAAAGAGTGGGAGGCAGG - Intronic
1070307744 10:75249690-75249712 CAAGAAAAGGAGAGGAAGGCTGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070397384 10:76023322-76023344 AAAGATGAAGAAAAGCAGGCGGG + Intronic
1070518817 10:77233729-77233751 AGAGATAACGAGAAAGGGGCAGG - Intronic
1070605768 10:77897669-77897691 AAAGAGAAAGAGAAGGAGAGGGG + Intronic
1070981189 10:80649557-80649579 GAAGCTGAGGAGGAGGAGGCTGG + Intergenic
1071083591 10:81841699-81841721 AGAGCTAAGTAGAAGAAGGCAGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071262835 10:83936435-83936457 ACAGCAAAGGATAAGGAGGCTGG + Intergenic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072066038 10:91872667-91872689 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1072088868 10:92107357-92107379 AATCATAAGGAGCAGGAAGCAGG + Intronic
1072119481 10:92393981-92394003 AAAAAAAAGGACAAAGAGGCTGG - Intergenic
1072129776 10:92483074-92483096 AAAGAAAAGGAGAGGTTGGCCGG - Intronic
1072145653 10:92634277-92634299 AAAGAAAAGGAGAGGCTGGCTGG - Intronic
1072167001 10:92823441-92823463 GAAGATAAAGAAAAAGAGGCCGG + Intergenic
1072248280 10:93562004-93562026 AAAGAGAGAGAGAAGGAGGGAGG + Intergenic
1072270200 10:93768800-93768822 ACAGATGAGGAGACTGAGGCTGG - Intronic
1072302508 10:94075039-94075061 GAAGAGAAGGGGAAGAAGGCAGG - Intronic
1072328813 10:94325300-94325322 AAAGAAAAAGGGAAAGAGGCTGG + Intronic
1072441424 10:95459524-95459546 GAAGAAAAGGAGGAGCAGGCGGG + Intronic
1072476710 10:95768438-95768460 AAAGAAAGAGGGAAGGAGGCAGG - Intronic
1072713121 10:97731012-97731034 AAAGAGAGAGAGATGGAGGCTGG + Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072921062 10:99577686-99577708 ACAGATGAGGAAATGGAGGCAGG - Intergenic
1073057428 10:100711353-100711375 CAAGAAATGGAGTAGGAGGCTGG - Intergenic
1073060221 10:100729510-100729532 AAAGAAGAGGAGAAAGAAGCGGG - Intergenic
1073100422 10:101003654-101003676 GAAGAGGAGGAGGAGGAGGCAGG - Exonic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1074088264 10:110225226-110225248 ATACATAAGGAAAATGAGGCTGG + Intronic
1074211967 10:111343486-111343508 AAACACAAGGAGAGGGAGTCTGG - Intergenic
1074236810 10:111592950-111592972 AAAGATCAGGATAAGGGGACTGG + Intergenic
1074569341 10:114610519-114610541 AAAGAAAGGGAGTAGGAGGTGGG - Intronic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075125571 10:119696474-119696496 AAAGGAAAGGAGAAGGATGATGG - Intergenic
1075224106 10:120610135-120610157 AGAGATAGGGAAAGGGAGGCGGG + Intergenic
1075452517 10:122561827-122561849 ACAGAGAAGGAGGAGGAGGGAGG - Intronic
1075556547 10:123436421-123436443 AAAGACAAGTAGAAAGAGGAGGG - Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076272409 10:129165934-129165956 AAAGAAGAGAAGAAGGAGGAAGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076604303 10:131679241-131679263 ATAGATTAGGAGAGGCAGGCTGG + Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1076843829 10:133059474-133059496 AAAGACATGGAAATGGAGGCCGG - Intergenic
1076974197 11:159027-159049 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
1077693432 11:4370466-4370488 AGAGAAAAGGAGCAGGAGGAAGG - Intergenic
1077707054 11:4497025-4497047 AGTGATAAGGAGAAGAAGTCTGG + Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1077882178 11:6359813-6359835 TAACACAAAGAGAAGGAGGCTGG + Intergenic
1078030779 11:7748912-7748934 TGAGAGAAGGAGAAGGAGGTAGG - Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078984127 11:16574191-16574213 AAAAATAAGAATAAGGTGGCAGG + Intronic
1079386858 11:19988164-19988186 AAAGAAAAGGATGAGGAGGATGG - Intronic
1079388055 11:19998292-19998314 AGAGAGAAGGAGAGGGAGGTGGG - Intronic
1079522382 11:21343365-21343387 AAAGATAAGGAAAGAGAGGGAGG - Intronic
1079556309 11:21761874-21761896 AAAGACAAGGAGAAGGGGCAAGG + Intergenic
1079638262 11:22772724-22772746 AGAGATGAGTAGAAGGAGGGAGG + Intronic
1080225703 11:29957593-29957615 AGAGGGAGGGAGAAGGAGGCGGG - Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1080562182 11:33474046-33474068 AGAGAGAGGGAGAAGGTGGCAGG + Intergenic
1081494815 11:43597929-43597951 AAAGAAAAGCAGGAGGGGGCTGG - Intronic
1081589585 11:44411911-44411933 AAAGAGAAGGTGAAACAGGCAGG + Intergenic
1081608442 11:44542830-44542852 ACAGATAATGAGGAGGAGGATGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081613103 11:44575196-44575218 AAAGAGAAGGAGATGGAGAAAGG + Intronic
1081781830 11:45718428-45718450 AATGAGGAGTAGAAGGAGGCAGG - Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1081889796 11:46531411-46531433 AAAGATTAACAGAATGAGGCTGG + Intronic
1081982583 11:47277591-47277613 AAATATATGTAGAAAGAGGCTGG - Intronic
1082720203 11:56665013-56665035 AAAAACATGGAGAATGAGGCTGG + Intergenic
1082821080 11:57545131-57545153 TAAGAAAGGGACAAGGAGGCCGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1083478334 11:62928001-62928023 CCAGAAGAGGAGAAGGAGGCAGG - Intergenic
1083482395 11:62957992-62958014 AAAAAAAAGAAGAAAGAGGCTGG - Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084019221 11:66407810-66407832 ACAGATAAGGAGACTGAGACTGG - Intergenic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084390291 11:68871113-68871135 AAAGTTCAGGAGAAGGTGGAAGG + Intergenic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084676776 11:70639936-70639958 AGACATAAGGAGGAGGGGGCAGG + Intronic
1084751769 11:71208718-71208740 ACAGATAAGGAAACTGAGGCTGG - Intronic
1084931370 11:72559168-72559190 AGAGATTGGGAGAAAGAGGCAGG - Intergenic
1085158343 11:74317520-74317542 AAAGAGAAAGAGAAGGAAGGAGG - Intergenic
1085435350 11:76494626-76494648 AAAGGAAAGGAGAGGAAGGCAGG - Intronic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086092059 11:83014783-83014805 AAAGAGAAGGGGAGGGAGGGAGG + Intronic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086338041 11:85818966-85818988 AGAGATAAGGACACCGAGGCAGG - Intergenic
1086694053 11:89823119-89823141 AAAGAAATGGAGTGGGAGGCAGG + Intergenic
1087009020 11:93496168-93496190 GAAGAAAAGGGGAAGCAGGCAGG + Intronic
1087414707 11:97839309-97839331 GAAGAAAAGGAAAAGGAGGGTGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087558967 11:99759730-99759752 AGAGAGAAGGAGAGGGAGGGAGG + Intronic
1087768496 11:102181514-102181536 AGAAATAAGGAGTAGGTGGCAGG - Intronic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1087973739 11:104517890-104517912 AAAAAAAAGGAGTAGGAAGCAGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088105654 11:106204072-106204094 AAATAAAAGGAGAATAAGGCAGG + Intergenic
1088301946 11:108367281-108367303 AAAAATGAGGGGAATGAGGCCGG - Exonic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088413779 11:109567198-109567220 AAAGATCATCAGATGGAGGCAGG + Intergenic
1088429192 11:109739518-109739540 AAAGAGAAGGAGAAGGACATAGG + Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088818268 11:113435805-113435827 AAAGTAAAGGTCAAGGAGGCTGG - Intronic
1089286292 11:117409996-117410018 GAAGAGGAGGAGGAGGAGGCAGG - Intronic
1089348948 11:117810497-117810519 AGAGATACGGAGAAGGGGGTGGG - Intronic
1089452229 11:118606839-118606861 ACAGATTGGGAGATGGAGGCAGG - Intronic
1089575640 11:119440910-119440932 AAAAAACAGAAGAAGGAGGCCGG - Intergenic
1089723394 11:120450966-120450988 AAAGATGAGGAGATGGAGGAGGG - Intronic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090142012 11:124275548-124275570 AAAGAGAAGGAAAAGGATCCAGG - Intergenic
1090266151 11:125354128-125354150 AAAGATAAAGGGAAGAAGTCAGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1090730402 11:129568851-129568873 ACAGATAAGGAAACTGAGGCCGG - Intergenic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1091046285 11:132328723-132328745 AAAGATAACTGGAAGGAGGAAGG - Intronic
1091294906 11:134466864-134466886 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1091511967 12:1136336-1136358 AAAGATGAGCAGAAGATGGCTGG - Intronic
1091631350 12:2163332-2163354 AAAGATAAGGAAGCGGATGCTGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092119239 12:6032341-6032363 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1092366869 12:7883560-7883582 AAAGAAAAAGAAAAAGAGGCCGG - Intronic
1092393609 12:8104524-8104546 AAAGATATGGTGGAGAAGGCAGG - Intergenic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092756392 12:11767217-11767239 AGAGATAAGGAAACTGAGGCTGG - Intronic
1093166595 12:15810929-15810951 AAAAATAAGGAGAAATAGCCAGG - Intronic
1094363744 12:29658453-29658475 AATGATCAGGAGAAGAAGGAAGG - Intronic
1095201850 12:39393916-39393938 AAATATAAATAGAAGTAGGCGGG + Intronic
1095417812 12:41995198-41995220 AAAGAAAGGGAGAGGGAGGGAGG + Intergenic
1095945981 12:47753625-47753647 AATGAGAAGGAGGAGGAGCCAGG + Intronic
1096117241 12:49061781-49061803 GAAGATGTGGAGAAAGAGGCAGG + Intergenic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096462532 12:51829866-51829888 AAAGAGAATGGGAAGGAGGAAGG + Intergenic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096510089 12:52122893-52122915 AAAGACATGTAGAAGGAGGAAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1097158187 12:57027842-57027864 AAAGATAATGACAATGACGCAGG + Intronic
1097548038 12:61029303-61029325 AAGGAGAAGGAGAAGAAGACAGG - Intergenic
1097747311 12:63315460-63315482 AAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1098064600 12:66600541-66600563 AAAGAAAAGCAGAAGTAGGAGGG - Intronic
1098289528 12:68944693-68944715 AAAAACAAGGTGAAGGAGCCAGG - Intronic
1098338563 12:69428237-69428259 AAAGATAAGAAGAAGTAGGGAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098708005 12:73715872-73715894 AAAGAGAAGGAGAAGGAGAGAGG + Intergenic
1098728456 12:74000039-74000061 AAAGATAAGGATGAGGATGGGGG + Intergenic
1099398440 12:82170985-82171007 AAAAAGAAGGAGGAGGAGGGAGG + Intergenic
1099449776 12:82794929-82794951 AAAAATAAATAAAAGGAGGCCGG + Intronic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099771782 12:87068981-87069003 AAAGAGAAGGAGAGGGAGATGGG + Intergenic
1100175616 12:92027465-92027487 AAAGAGAAAGAGAGGGAGGGAGG + Intronic
1100411527 12:94323662-94323684 AAAGAAATGGAGGGGGAGGCTGG - Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100665325 12:96746014-96746036 AGAGAGAGGCAGAAGGAGGCTGG - Intronic
1100708343 12:97226775-97226797 ATAGATCAAGAGAAGAAGGCTGG + Intergenic
1101025141 12:100595937-100595959 AAAGAAGAGAAGAAGGAGGAGGG - Intronic
1101429900 12:104618200-104618222 AAAGAAAAGAAGAAGAAGCCAGG - Intronic
1101725957 12:107388423-107388445 AAAGAGAAAGACAAGGAAGCAGG - Intronic
1102230337 12:111257516-111257538 AAAGAGGAGGAGAAGGAGGGAGG - Intronic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102484173 12:113244965-113244987 TAAGAAAATGAGAATGAGGCTGG + Intronic
1102735701 12:115157442-115157464 TAAGATAGGGAGAACTAGGCTGG + Intergenic
1102800108 12:115724728-115724750 AAAGATGAAGAGGAGGAAGCAGG + Intergenic
1103147171 12:118604888-118604910 ACAGACAAGGAGACTGAGGCTGG - Intergenic
1103314355 12:120040386-120040408 AAAGAAAAGAAAAAGAAGGCTGG - Intronic
1103414238 12:120733213-120733235 AAAGAGAGGGAGAGGGAGACCGG + Intronic
1103533176 12:121616717-121616739 AAAGAAAAAGAGAACTAGGCTGG + Intergenic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1103610753 12:122122841-122122863 AAAGAAAAAGAAAAGAAGGCCGG - Intronic
1103710079 12:122906012-122906034 ATAGATAAGGAAATTGAGGCAGG - Intergenic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103835631 12:123818241-123818263 AAAAATAAAGAGATAGAGGCTGG - Intronic
1104015745 12:124960582-124960604 ACAGGTGAGGAGAATGAGGCAGG - Intronic
1104407707 12:128532340-128532362 AAAGAAAAAAAAAAGGAGGCCGG + Intronic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104904988 12:132208319-132208341 GAAGATCAGGTGAAGGAGGCCGG + Intronic
1105202441 13:18191740-18191762 AAAGATAGAGAGAAGCAGGCAGG - Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1106107249 13:26743248-26743270 AGAGAGATGGAGAAGGGGGCTGG + Intergenic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1106243033 13:27925277-27925299 AAAGAAGAGGAGGAGGAGGAAGG - Exonic
1106497867 13:30297163-30297185 AAAGAAAAGAAGGAGGAGGAAGG + Intronic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107112372 13:36711874-36711896 CAAGAGAAGGAGAAGGTTGCGGG - Intergenic
1107336321 13:39359622-39359644 GAATACAAGGAGAAGGAGGTAGG + Intronic
1107453107 13:40529810-40529832 AAAGAGATAGAGAAGGAGGGAGG + Intergenic
1107642388 13:42456850-42456872 ACAGAAGAGGAGGAGGAGGCAGG + Intergenic
1107647730 13:42512700-42512722 ACAGAAGAGGAGGAGGAGGCAGG - Intergenic
1107650727 13:42542063-42542085 GAAGATAAAGAGAAGGAGAGAGG - Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107879702 13:44822299-44822321 AAAGAGGAGGAGGAGGGGGCGGG - Intergenic
1108008144 13:45973862-45973884 AAATGTAAGGAGAGGGAAGCAGG + Intronic
1108008977 13:45983720-45983742 AAATATAAGTAGAAGGGGCCGGG - Intronic
1108227164 13:48302038-48302060 AAAGATAAGGAGTAGTCTGCTGG - Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108589255 13:51897628-51897650 AAAGATAACTAGAACAAGGCTGG + Intergenic
1108632094 13:52294800-52294822 AAAAATAAAGAGATAGAGGCCGG + Intergenic
1108638612 13:52361101-52361123 AAAGAGAAGGAAAGGGAGGGGGG - Intergenic
1108654606 13:52517794-52517816 AAAAATAAAGAGATAGAGGCCGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109267316 13:60216476-60216498 AAAGAAAAGGAGAAGCAGAGAGG - Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109397693 13:61782208-61782230 AAAGACAAGAAGTAGGAAGCAGG + Intergenic
1109607607 13:64717412-64717434 AAAGAGAAGGAGAAGGTCACTGG + Intergenic
1109741302 13:66559502-66559524 AAAAATACGGATCAGGAGGCCGG + Intronic
1109919928 13:69043481-69043503 ATAGCTAAGGAGAAGAATGCAGG - Intergenic
1110073731 13:71212040-71212062 AGAAATTAGGAGGAGGAGGCAGG - Intergenic
1110382188 13:74865629-74865651 AAAGAAAAGGAAAATGATGCTGG - Intergenic
1110393827 13:75007111-75007133 AAATAAAAGGAGAAGGAGAAAGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110520478 13:76470065-76470087 AAAGAAATGGATAATGAGGCCGG - Intergenic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1111956121 13:94760478-94760500 AAAGAGGAAGAGAAGGAGGAAGG - Intergenic
1112214707 13:97418350-97418372 AAAGATCAGGAGAGGGATGATGG - Intergenic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113174080 13:107541473-107541495 AAAGAGAAAGAGAAGGAGAGAGG + Intronic
1113555585 13:111231543-111231565 AAAGTTAAGGAGCATGAGGTTGG + Intronic
1113852793 13:113427523-113427545 AAAGAAAAGAAAAAAGAGGCCGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114464362 14:22910504-22910526 AAAGGAAGGGAGAAGGAGGGAGG + Intronic
1114492950 14:23114560-23114582 AAAAATTTTGAGAAGGAGGCAGG - Intergenic
1114663087 14:24361591-24361613 AAAGAAAAGGAGAATCAGTCAGG - Intergenic
1114863843 14:26562523-26562545 AAAGACAAGGAGAAGGGTGAGGG + Intronic
1114980894 14:28162648-28162670 AAAGAAAATGAGACGGAGCCAGG + Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115111457 14:29828325-29828347 AGAGAGAAGGAGAAGGTGCCAGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115544437 14:34453006-34453028 AATCATAAGGAGGAGGAGGAGGG - Intronic
1115648400 14:35385700-35385722 AAAGAGAAAGAGAGGGAGGGAGG + Intergenic
1116037538 14:39645508-39645530 AAGGATAAGGAGGAGGAGTGGGG + Intergenic
1116692090 14:48121167-48121189 AAAACTAAGGAAGAGGAGGCAGG - Intergenic
1116751518 14:48891505-48891527 AAAGAGAAGGAGAGGGAGAGAGG - Intergenic
1116991738 14:51284522-51284544 AGAGATAAGTAAAAGGAGGCAGG - Intergenic
1117215323 14:53545601-53545623 GAAGATTAGGAAAAGGAGGTGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1118058889 14:62114360-62114382 ACAGATAAGAAGTAGGAGACAGG + Intergenic
1118139426 14:63064336-63064358 AAAGAGAAGGGGAAGGAGAAAGG + Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118179152 14:63473884-63473906 AAAGGTAAAGAGAAGGAACCTGG + Intronic
1118215886 14:63808222-63808244 AAAGATAAGGAAAAACTGGCTGG - Intergenic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118275312 14:64381301-64381323 AAAGAGAAGAAGAAATAGGCCGG + Intergenic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118704544 14:68468706-68468728 CAAGATAACCAGAAGGAGTCAGG - Intronic
1118755802 14:68843168-68843190 AGAGATAGAGAGAAAGAGGCAGG - Intergenic
1118774719 14:68966630-68966652 ACAGAAAGGGAGCAGGAGGCAGG + Intronic
1119110668 14:71970950-71970972 AGAGAGAAGGTGTAGGAGGCAGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119123022 14:72097573-72097595 GAAGAGGAGGAGAAGGGGGCGGG + Intronic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1120265096 14:82238572-82238594 AAAGATAAGGAGTAGTTGTCTGG - Intergenic
1120846049 14:89126008-89126030 AAGGAAAAGGACAAGGATGCAGG - Intronic
1121135373 14:91493090-91493112 AAAAATAAGAAAAAGTAGGCTGG + Intronic
1121173490 14:91873254-91873276 AAAGATGAGGAGGAGGAGGATGG + Intronic
1121852549 14:97235671-97235693 AAAGAAAAGGAAAAGCAGGGAGG - Intergenic
1121944302 14:98104508-98104530 AGAGATGAGGAGATGGAGGCTGG + Intergenic
1122035336 14:98945095-98945117 AGAGAAGAGGAGGAGGAGGCAGG + Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1123905797 15:24920148-24920170 GAAGGTAAGGAGGAAGAGGCTGG - Intronic
1123950000 15:25262095-25262117 AAAGAAAAAGAAAAAGAGGCCGG + Intergenic
1124013840 15:25860433-25860455 GAATAGAAGGAGGAGGAGGCTGG - Intronic
1124957876 15:34371263-34371285 AAGGAGGAGGAGAAGGAGGTGGG - Intergenic
1125065894 15:35486134-35486156 AAGGCAAAGGAGAAGCAGGCAGG + Intronic
1125213378 15:37240731-37240753 AGAGATACGGAGAAGGGGGTGGG + Intergenic
1125254817 15:37751398-37751420 AAAGAAAAGGAAAAAGAGGAAGG + Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125427821 15:39567336-39567358 AAAGATCTGGAGAAGTCGGCCGG - Intergenic
1125446273 15:39760840-39760862 TAAGATTAGGAGAAGCAGGGGGG + Intronic
1125601134 15:40916326-40916348 AAAGAGAAGGAGCAGAAGGAGGG - Intergenic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1126008137 15:44278295-44278317 AAAAATAAGGCTATGGAGGCTGG + Intergenic
1126079080 15:44940900-44940922 AAAGATAGGGAGGCTGAGGCGGG + Intergenic
1126371004 15:47947070-47947092 AAAAATAAGGAAAAGGAGAAAGG + Intergenic
1126980742 15:54239748-54239770 ACAGATAAGAATAAGGAGGTGGG - Intronic
1127029440 15:54845487-54845509 AAAGAGCAGGAAAAGGAGGCGGG + Intergenic
1127176558 15:56364447-56364469 AAAGAAAAGAAAAAAGAGGCTGG - Intronic
1127272364 15:57413152-57413174 AGAAAGAAGGAGAAGAAGGCCGG - Intronic
1127484466 15:59406338-59406360 ACAGATGAGGAGATTGAGGCTGG + Intronic
1127674907 15:61229342-61229364 AAAAAGAAGGAGAAGGCGACCGG + Intergenic
1127691874 15:61404549-61404571 GAAGACAAGGGGGAGGAGGCAGG - Intergenic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1127954643 15:63842760-63842782 AAAGATAATCATAAGGAGGCTGG + Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128095609 15:64952253-64952275 AAAAAGAAGGAGAAGGAAGAAGG - Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128590081 15:68888088-68888110 AAAGTGAGGGAGAAGGAGGTGGG + Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129180050 15:73868435-73868457 ACAGATAAGGAAAATGAGTCTGG + Intergenic
1129559507 15:76551987-76552009 AAAGAACAGGAGAGGGAAGCTGG + Intronic
1129601845 15:77003664-77003686 AAAAAGAAGAAGAAGGAAGCGGG + Intronic
1130090035 15:80813305-80813327 AATGATAACGAGGAGGAGGATGG - Intronic
1130142159 15:81236657-81236679 AAAGAAGAGGAGAATAAGGCCGG + Intronic
1130760679 15:86816287-86816309 AAAGAGAAAGTGAAGAAGGCAGG + Intronic
1130956281 15:88629515-88629537 GAAGAGAATGACAAGGAGGCTGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131081387 15:89539185-89539207 AAAGAGAAGGAGAGGAAGGAAGG + Intergenic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1131989184 15:98076932-98076954 AAAGAAAAAGAGAAGGAGAGAGG + Intergenic
1132050639 15:98605116-98605138 AAAGTGAAGGAGAGGGAGCCAGG + Intergenic
1132080554 15:98861352-98861374 AAAGAGAAGGACTAGGAGGGCGG - Intronic
1133101718 16:3484076-3484098 AAAGTTAAGGAGGAAGAAGCAGG - Intronic
1133187224 16:4108666-4108688 AAAGATATGGAGAAATGGGCCGG - Intronic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133961260 16:10495550-10495572 AAAAAGAGGGAGAAGGAGGGAGG - Intergenic
1134065334 16:11224746-11224768 AAGGAGCAGGGGAAGGAGGCGGG - Intergenic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134398214 16:13884944-13884966 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG + Intergenic
1134731542 16:16466299-16466321 CAACATAAGGAAAAGAAGGCTGG - Intergenic
1134880785 16:17743798-17743820 AAGGATGAGGAGAAGCAGACAGG + Intergenic
1134935908 16:18245702-18245724 CAACATAAGGAAAAGAAGGCCGG + Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1135518771 16:23157353-23157375 AAAGATGAGGTGGAGGAGACAGG + Intergenic
1135612466 16:23880369-23880391 AAGGAGGGGGAGAAGGAGGCAGG - Intronic
1135633352 16:24053578-24053600 AAAGAGGATGGGAAGGAGGCAGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135703736 16:24656164-24656186 AAAGAAAAGAAAAATGAGGCCGG + Intergenic
1135920391 16:26644091-26644113 AGAGAAAGGGAGAAGGAGGGAGG - Intergenic
1135999230 16:27278317-27278339 AAAGAAAAAGAGAGGGAGGGAGG + Intronic
1136017567 16:27412376-27412398 AAGGAGAAGGAGAAGAAAGCTGG - Intronic
1136185409 16:28585616-28585638 AAACACAGGGATAAGGAGGCAGG - Intronic
1136284307 16:29232272-29232294 ACAGATAAGGAAACTGAGGCTGG + Intergenic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136343175 16:29658351-29658373 AGAGACAAAGAGAAGGAGGGAGG - Intergenic
1136401283 16:30020544-30020566 AAAGAAAAAAAGAAGTAGGCTGG + Intronic
1136464317 16:30431548-30431570 AAAGATAAGGAAACTGAGGCCGG + Intergenic
1136607813 16:31348369-31348391 AGAGACAAGGAGAAGAAAGCAGG - Intergenic
1136777556 16:32879867-32879889 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1136893068 16:33981647-33981669 AAACAGAAGTAGTAGGAGGCTGG - Intergenic
1137038068 16:35583961-35583983 TAAGAAAAGGAGGATGAGGCTGG + Intergenic
1137268208 16:46885435-46885457 AAAGACACGGAGAAAGAGACTGG - Intronic
1137327465 16:47456315-47456337 AAAGATTAGGAGAAAGAAGAGGG + Intronic
1137404084 16:48176430-48176452 AAAGAGGAGGAGACAGAGGCTGG + Intronic
1137507145 16:49064008-49064030 ACAGATAAGAAAAATGAGGCTGG + Intergenic
1137631226 16:49947034-49947056 AAAGATAAGGATGAGGAGCTTGG - Intergenic
1137926223 16:52545605-52545627 AAAGAAAAAGAGAGGGAGGAGGG + Intronic
1138256947 16:55573709-55573731 AAAGATAAAGAGGTGGAGGGAGG - Intronic
1138900695 16:61265515-61265537 AAAGATGAAGGGAAGGAGGGAGG - Intergenic
1138933868 16:61695073-61695095 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139209941 16:65067686-65067708 ACAGAGAAAGAGAAGGAGGGAGG + Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139550851 16:67672271-67672293 AAAGAAAAGGAGAGGGAGAGAGG + Intergenic
1139918815 16:70445909-70445931 AAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1139969974 16:70768257-70768279 AAAGATGAGGAAACTGAGGCGGG + Intronic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140413554 16:74756545-74756567 AAAGAAAAGGAACAGGAGGTGGG - Intronic
1140676083 16:77331538-77331560 GAATATAATGATAAGGAGGCTGG - Intronic
1140953274 16:79839341-79839363 AAAGATAGGGAGGTAGAGGCTGG - Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141480107 16:84300672-84300694 TAAGAAAAGGAGAAGGGGCCAGG + Intronic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1141744351 16:85915551-85915573 ACAGATGAGGAGACTGAGGCTGG + Intronic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141901972 16:86996864-86996886 AAAGATGAGGGCACGGAGGCCGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1142442295 16:90106627-90106649 GGAGCTGAGGAGAAGGAGGCTGG - Intergenic
1142446062 16:90138636-90138658 AAAGAAAAAGAGAAAGAAGCAGG - Intergenic
1203079970 16_KI270728v1_random:1141976-1141998 AAACAGAAGTAGTAGGAGGCTGG + Intergenic
1142461446 17:96827-96849 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
1142817031 17:2434681-2434703 AAACCTAAGGAGAAGGGAGCTGG + Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143606288 17:7988286-7988308 AAACATACAGAGAAGGAGGCCGG - Intergenic
1143634008 17:8154177-8154199 AAAGACAGGGAGATGGAGGCGGG - Intronic
1143711301 17:8737018-8737040 AAAGAAAAGAAGAGGGAGGGAGG + Intronic
1143711495 17:8739110-8739132 AAAGAGAAAGAGAGGGGGGCTGG + Intronic
1143944981 17:10583157-10583179 AAAGTGAAGGAAGAGGAGGCAGG + Intergenic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144456517 17:15423287-15423309 CAAGTTAAGGATAAGGAAGCTGG + Intergenic
1144588033 17:16500494-16500516 TCAGAAAAGGAGGAGGAGGCCGG + Intergenic
1144770031 17:17754530-17754552 AAAGATCAGGTTAGGGAGGCTGG - Intronic
1144964782 17:19070124-19070146 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1144983185 17:19182054-19182076 AAATAGAAGGAAAAGGAGGAGGG + Intergenic
1144985040 17:19196185-19196207 AAATAGAAGGAAAAGGAGGAGGG - Intergenic
1146059794 17:29598515-29598537 AAAGAGAAAGGGAGGGAGGCAGG - Intronic
1146083725 17:29807728-29807750 AAAGATAAGCTGCAGGAGACAGG + Intronic
1146144495 17:30401271-30401293 AAAGAGGAGGAGAAGGAAGAAGG - Intronic
1146291771 17:31612906-31612928 AAAGGAGAGGAGAAGGAGGAGGG - Intergenic
1146332696 17:31941211-31941233 AAAAATAAGGAGGCTGAGGCAGG - Intronic
1146662417 17:34673641-34673663 AAAGAGCAGGAGAAGGAAGTAGG - Intergenic
1146735058 17:35231895-35231917 AAAGGAAAGGAGAAAGAGCCAGG + Intergenic
1146918964 17:36697127-36697149 AGAGAAAAGGGGAAGGAGGGAGG + Intergenic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147122734 17:38345230-38345252 GAAGAAAAGGAGAAGGGGCCAGG - Intergenic
1147271596 17:39276351-39276373 AAAGAAAGGAAGAAGGAGGGAGG + Intronic
1147383384 17:40068728-40068750 AAAGAGGAGGAGGAGGAGGTGGG - Intronic
1147636089 17:41965236-41965258 CAAGATCAGGAGAAACAGGCAGG + Exonic
1147749229 17:42718386-42718408 AAAGAGAAGGAAATGGTGGCTGG + Intronic
1147801154 17:43089329-43089351 AAAAATTAGGAGAAAGAGCCTGG + Intronic
1148467576 17:47874075-47874097 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
1148610069 17:48959148-48959170 AAAAATAAGTAAAATGAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148992504 17:51678712-51678734 AATGTGAAGGAGAAGGATGCAGG + Intronic
1149107088 17:52982606-52982628 AAAGGGGAGGAGAAGGAGGAGGG - Intergenic
1149114175 17:53071794-53071816 AAAGAAAAAGAGAAAGAGGAGGG + Intergenic
1149319354 17:55468667-55468689 AGAGACACGGAGAAGGGGGCGGG - Intergenic
1149362913 17:55912760-55912782 ACAGCTAAAGAGAAGAAGGCAGG - Intergenic
1149444527 17:56703471-56703493 AAATGATAGGAGAAGGAGGCCGG - Intergenic
1149452521 17:56760857-56760879 ACAGAAAAGGAGGAGGAGGGAGG + Intergenic
1150023357 17:61644210-61644232 AAAGAGAAGGAGAAAGAGAGAGG - Intergenic
1150195644 17:63295608-63295630 AGAGATAAGGGGAAAGAAGCTGG + Intronic
1150250746 17:63703204-63703226 AAAGTTAAATAGAATGAGGCTGG + Exonic
1150465208 17:65386814-65386836 AAAGAAAAGAAAAAAGAGGCAGG - Intergenic
1150706564 17:67492372-67492394 AAACATATGAAGCAGGAGGCAGG + Intronic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1150801580 17:68287311-68287333 AAAAAGAAGAAGAAGAAGGCTGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151250680 17:72831978-72832000 GAAGAGGAGGAGAAGGAGGTTGG + Intronic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1151739433 17:75969886-75969908 AAAGAGAGCGAGAAAGAGGCCGG + Intronic
1151765125 17:76129711-76129733 AAAGAAAAAGAGAAAGAGACAGG + Intergenic
1152033765 17:77859268-77859290 GAAGAGAGGGAGAGGGAGGCAGG + Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152297549 17:79476942-79476964 GAAGAAAAGGAGGAGGAGGAAGG + Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152795972 17:82306522-82306544 CAAGAAAATGAGAACGAGGCCGG - Intergenic
1152878139 17:82800049-82800071 GAAGACAAGGAGATGGAGGAAGG - Intronic
1153295406 18:3541238-3541260 AGAGAGAAAGAGAAGGAGGGAGG + Intronic
1153339155 18:3956642-3956664 AAAGAAAAGGAAAAATAGGCCGG - Intronic
1153342848 18:3993226-3993248 AAAGAAAAGGAAAAGGAGTTTGG + Intronic
1153565560 18:6414605-6414627 AAAGAGAAAGAGAAAGAGCCTGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153831788 18:8930253-8930275 AGAGAGAAAGAGAAGGAGGGAGG + Intergenic
1153833880 18:8947326-8947348 AAAAAAAGGCAGAAGGAGGCTGG + Intergenic
1153939995 18:9969191-9969213 GAAGATGAGGAGAAGCAGGCGGG - Intergenic
1154330826 18:13427841-13427863 AAATATATGGAAAATGAGGCAGG - Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1155442008 18:25871873-25871895 AAAGAAAAAGAGAAGGAAGAAGG + Intergenic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155713534 18:28911687-28911709 ACAGATCAGGAGAAGGAAGGAGG - Intergenic
1156005589 18:32437435-32437457 AAAGAAAAGGAAAAGGAAGAAGG + Intronic
1156354007 18:36325680-36325702 AAAGAGAAGGAGAAAGAGAGAGG - Intronic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156724485 18:40111696-40111718 AAAGATAGGAAAAAGGAGGAGGG - Intergenic
1156851821 18:41737543-41737565 AAAGATGAAGAAAAGGAGGGTGG - Intergenic
1156950472 18:42890578-42890600 AGAGAGAAGGAGAAGCAGGGAGG + Intronic
1157240214 18:46002327-46002349 AAAGGTGAGGAGAAGGAAGGTGG - Intronic
1157358033 18:46953194-46953216 AAAGAAAAAGAAAAGGAGGAAGG - Intronic
1157495117 18:48151528-48151550 AAAGATAAGGAAACGGAGGCTGG + Intronic
1157500540 18:48187515-48187537 AAAGACAAGAAGTAGAAGGCCGG + Intronic
1158154334 18:54408329-54408351 AAAGAAAAGGGAAAGGAGGAAGG - Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158475432 18:57775325-57775347 AAAGAGAAAGAGAAGGAAGGAGG + Intronic
1158576862 18:58645500-58645522 AGAGATACGGAGAAGGGGGATGG + Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158701887 18:59755552-59755574 AAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1158942842 18:62421641-62421663 ATAGATAAGAAGAAGGAGAGGGG - Intergenic
1159149575 18:64504257-64504279 AAAAAGAAGGAAAAGCAGGCAGG - Intergenic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160228854 18:77031458-77031480 AAAGCTAAGAAAAAGGAGGCAGG + Intronic
1160251850 18:77210150-77210172 AAGGATAAGGGGTAGGGGGCAGG - Intergenic
1160651147 19:229194-229216 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
1160664521 19:318758-318780 AAAAATCAGTAAAAGGAGGCTGG + Intronic
1160676717 19:395025-395047 AAAGATAATGGGAAGGATGATGG + Intergenic
1160758313 19:769894-769916 ACAGATAAGGACACTGAGGCTGG - Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160824512 19:1073474-1073496 AGAGATAAGGACAAGGAGGTGGG - Intronic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1160991611 19:1862619-1862641 ACAGATAAGGAAACTGAGGCTGG + Intronic
1161122908 19:2539968-2539990 AAAGAGAGAGAGAAGGAGGGAGG - Intronic
1161126802 19:2562442-2562464 AAAGAAAAGGAAAAGGAGCGGGG - Intronic
1161254466 19:3299678-3299700 GAAGAAAAGGAGAAGGAGAAGGG - Intergenic
1161616797 19:5275364-5275386 AAAGAAAAAGAAAAGAAGGCTGG - Intronic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1161845245 19:6708443-6708465 AAAGAAAAGAAAAAGAAGGCCGG - Intronic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1161902846 19:7132327-7132349 AGAGAGGAGGAGAAGGAGGGTGG + Intronic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161919745 19:7257238-7257260 AAAGATAAGGTGGGGGAGGCCGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162269656 19:9603859-9603881 AAAGAAAAGGAGAGGGAGGGAGG + Intergenic
1162339205 19:10081732-10081754 GAAGAGAAGGAGGAGGAGGGAGG + Intergenic
1162550943 19:11357792-11357814 ACAGATAAGGAGACTGAGGTTGG - Intronic
1162717057 19:12640786-12640808 AGAGAAAAGGAAAAAGAGGCCGG + Intergenic
1162873636 19:13604396-13604418 AAAGAGAAAGACAAAGAGGCCGG + Intronic
1162984093 19:14258280-14258302 AAAGGGAAGGGGAGGGAGGCGGG - Intergenic
1163373374 19:16914906-16914928 ATAGATGAGGAAATGGAGGCCGG - Intronic
1163505548 19:17703935-17703957 CAAGAGGAGGAGACGGAGGCAGG + Intergenic
1163983183 19:20921073-20921095 AAAGAAAAACAGAAGCAGGCCGG - Intergenic
1164452327 19:28377527-28377549 AAAGAAAAGAAAAAAGAGGCTGG - Intergenic
1164501441 19:28823631-28823653 GAAGGTAAGGAGAAGGAAGGAGG - Intergenic
1164522186 19:28988186-28988208 AAAGAAAAGGAGAGAGAGGAGGG + Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1164858637 19:31544966-31544988 AAAGAGAAGGAGGAGGAGGGAGG - Intergenic
1164858645 19:31545018-31545040 AAAGAGAAGAAGGAGGAGGGAGG - Intergenic
1165116402 19:33531553-33531575 AAAGAAAAGGAAAAGAAGGAAGG + Intergenic
1165295593 19:34923003-34923025 AAAGAGAGGGAGAGGGAGACGGG + Intergenic
1165580838 19:36862155-36862177 AAAGATAAAGAGAAGTTGGCCGG - Intronic
1165677907 19:37744248-37744270 AGAGATTAGGAAAAGGAGGCTGG + Intronic
1165790187 19:38486662-38486684 AAAGATAGGGAGATGGTGGGAGG - Intronic
1165936670 19:39393390-39393412 AAAAAAAAAGAAAAGGAGGCTGG - Intronic
1166229732 19:41419428-41419450 AAAAATAAGAAGAAGAAGTCTGG - Intronic
1166502189 19:43350021-43350043 AAAGATAAGGTGAATATGGCCGG + Intergenic
1166507919 19:43383428-43383450 AAAGATAAGGTGAATATGGCCGG - Intergenic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166808021 19:45498554-45498576 GAAGAGGAGGAGGAGGAGGCGGG + Exonic
1167081412 19:47278512-47278534 AGAGATAAAGGGAAGGAGACAGG - Intergenic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1167637591 19:50664099-50664121 AAAGAAAAGAAAAAGGAGGCTGG - Intronic
1167641422 19:50684520-50684542 AAAAATCAAGAGTAGGAGGCTGG - Intronic
1167758895 19:51430983-51431005 AAAGAGAAAGAGTAGGAGGCTGG - Intergenic
1167839010 19:52098532-52098554 AAAGATAACGCCAAGGAAGCAGG + Intergenic
1168075459 19:53978796-53978818 AGAGATAAGGGGAAGAAGGGAGG + Intronic
1168110151 19:54187719-54187741 AAAGAAAAGCAGATGAAGGCCGG + Intronic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
925038650 2:712747-712769 GAAGATATGGAGAAGGAGCTGGG - Intergenic
925809058 2:7680460-7680482 TCAGATAATGAGAAGCAGGCCGG - Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
925857134 2:8140170-8140192 AAAGAGAAAGAGATGGAGGGAGG + Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926082011 2:9994936-9994958 AAAAACCAGGGGAAGGAGGCTGG - Intronic
926326197 2:11786473-11786495 AGAGCAAAGGAGAAGGTGGCAGG - Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926570573 2:14525351-14525373 AAGGAAGAGGAGAAGGAGGGAGG + Intergenic
926656321 2:15411033-15411055 AAAGAACAGGAGGAGGAAGCAGG - Intronic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927598042 2:24414741-24414763 AAAGATAAGGAGAGGATGGCTGG - Intergenic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
928225865 2:29447561-29447583 AAAGATAAGAACATGGAGTCAGG + Intronic
928624309 2:33123742-33123764 ATAGATGAGGAGGAGGAGGGTGG - Intronic
928746422 2:34421160-34421182 AAAGATAAAGAGGAGTAGCCAGG - Intergenic
929045472 2:37784867-37784889 AGAGATGAGGTGAAGGAGTCAGG - Intergenic
929426392 2:41848890-41848912 AATGAAAAGTGGAAGGAGGCTGG + Intergenic
929489208 2:42381558-42381580 AAAGATCATGACAAGCAGGCAGG - Intronic
929766445 2:44847876-44847898 AAAAAGAAGAAGAAGGAGGAGGG - Intergenic
930001787 2:46866593-46866615 AAAGATAAGAAGCTGGAGGTTGG + Intergenic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930208183 2:48609138-48609160 TAAGACAAAAAGAAGGAGGCAGG - Intronic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930639481 2:53840509-53840531 AAAGAAAAGGAGAAGGAGAAAGG + Intergenic
930673710 2:54177874-54177896 AAAGAAAAGAAACAGGAGGCCGG - Intronic
930741976 2:54841083-54841105 AGAGATCAGGACAAGGAGGGGGG + Intronic
931008227 2:57877698-57877720 AAAGAAAAGAAGAAGGGGGGAGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931340777 2:61398605-61398627 AAAGGGAAGGAGAAAGAGGGAGG + Intronic
931428902 2:62194996-62195018 AGAGATAAGGACCAGGGGGCGGG + Intergenic
931473441 2:62563830-62563852 AAAGTGAAGTAGAAGGAGGCAGG + Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931537166 2:63291835-63291857 AAAGAAAAAGAAAAGAAGGCCGG + Intronic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
931890804 2:66670002-66670024 AAATATAAGGAGGCCGAGGCAGG - Intergenic
931891941 2:66682812-66682834 AAGGACAAAGAGAAGAAGGCAGG - Intergenic
931902756 2:66807544-66807566 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
931942609 2:67269088-67269110 AAAGAAAAGGAGAAGGAAAAAGG - Intergenic
932369684 2:71176793-71176815 AAAGAAGGGGAGAAGGAGGAAGG - Intergenic
932429572 2:71666044-71666066 AAACAGAATGAGAAGGAGGAGGG - Intronic
932452787 2:71826082-71826104 AATGATAAGGAGATGGGGCCAGG + Intergenic
932603153 2:73144049-73144071 AAATATAAGCAGAGGGAGTCTGG - Intronic
932686710 2:73876598-73876620 CAAGATGAGGATAGGGAGGCTGG + Intergenic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933654447 2:84876059-84876081 ACAGATATGGAGAAGGACGGGGG + Intronic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
933938485 2:87226078-87226100 GAAGAGAAGGGGAAGGGGGCTGG - Intergenic
933995004 2:87661722-87661744 AAAGAAAAGGAGGAGGAGGAGGG + Intergenic
934122886 2:88857215-88857237 AAAGCCAAGGAGGAGGAGGGGGG + Intergenic
934161329 2:89252439-89252461 AGAGATAAAGACAGGGAGGCTGG + Intergenic
934205950 2:89929976-89929998 AGAGATAAAGACAGGGAGGCTGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934995374 2:98953096-98953118 AAAGAAGAGGAGAAGGAGGGCGG - Intergenic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935241870 2:101185911-101185933 AAATATGAGGACAAGGAGGCTGG - Intronic
935598902 2:104902089-104902111 AGAGATAGGGAGAGGGAGGTTGG - Intergenic
936298854 2:111289191-111289213 AAAGAAAAGGAGGAGGAGGAGGG - Intergenic
936352474 2:111723660-111723682 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
936403860 2:112185442-112185464 AAAGATGAGAGGCAGGAGGCTGG + Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936530613 2:113274499-113274521 AAAGAAAGGGAGAAGGTAGCTGG - Intronic
936655818 2:114485710-114485732 AAAGAAAAGGAGGAGGAGATAGG - Intronic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937246840 2:120499175-120499197 AAAGATGAAGAGCAGGCGGCAGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937513232 2:122622642-122622664 AAAGAGAGGGAGAAGGAGTGGGG - Intergenic
937579119 2:123461827-123461849 AAAGATCAGGAGATTGAGACAGG - Intergenic
937678951 2:124623663-124623685 GAAGATAAGGAGAAGGATCTAGG - Intronic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937729444 2:125209932-125209954 CAAGATAAAGTAAAGGAGGCTGG + Intergenic
937947318 2:127352703-127352725 AAAGAGAGGGAGAGGGAGGGAGG - Intronic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938623166 2:133078622-133078644 CAAGACAAGGAGAATGAGACAGG + Intronic
938873416 2:135506787-135506809 AAAGATATCAATAAGGAGGCAGG + Intronic
938880980 2:135588064-135588086 AAAGAAAAGAGGAAGGAGGGAGG - Intronic
938929845 2:136076992-136077014 AGAGATAATGAGAAGGAGGGTGG + Intergenic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
939307250 2:140427333-140427355 AAAGACACGGAGAAGGGGGGTGG - Intronic
939575835 2:143893549-143893571 AAAGATAAGAAGAAAGAAGTAGG + Intergenic
939669606 2:144993956-144993978 AAAGATCAAGAGGAGGAAGCTGG + Intergenic
939721826 2:145663240-145663262 AAATATAAAGAAAAGGTGGCCGG - Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
940739124 2:157486777-157486799 AAAGAGAAAGAGAGGGAGGGAGG - Intronic
940865513 2:158813849-158813871 AAAGAAAAAGGAAAGGAGGCCGG - Intronic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941021920 2:160416546-160416568 AAAGTCTAGGGGAAGGAGGCAGG + Intronic
941087396 2:161133843-161133865 AAAGAGAAGGAGAAGGTGAAAGG - Intergenic
941099049 2:161277227-161277249 AAAGAGAAAGAGAGGGAGGGAGG - Intergenic
941111351 2:161421739-161421761 TAAGAGAAGTAGAGGGAGGCAGG - Intronic
941192037 2:162396952-162396974 AAATATAAAGAAAAAGAGGCGGG + Intronic
941315450 2:163986400-163986422 AAAGGGAAGGATAAGGAGGAAGG + Intergenic
941417455 2:165239452-165239474 AAAGCTAAGGCAAAGGAGGGAGG + Exonic
941685745 2:168446621-168446643 AGAGATAAGGGGATGGAGGGAGG - Intergenic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
941732425 2:168933345-168933367 TAAGACAAGTAGAAGGAGACAGG - Intronic
942074623 2:172345340-172345362 ACAGAGAAAGAGAACGAGGCTGG + Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942307978 2:174627519-174627541 AAAGAAAGAGAGAAGGAGGGAGG - Intronic
942971940 2:181967656-181967678 AAAGAGAGAGAGAAGGAGGGAGG - Intronic
943269667 2:185782950-185782972 ATAGATAAGGAGAAGGAGAAAGG - Intronic
943334750 2:186600143-186600165 CAAGATAAGGTCAAGGAGCCTGG - Intronic
943357111 2:186870442-186870464 AAAGAGAAGGAGGAGGAGAAAGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943937700 2:193943352-193943374 AAAGAGGAATAGAAGGAGGCAGG + Intergenic
944220667 2:197301081-197301103 AAAGATGAGGAAAATGAAGCCGG - Intronic
944651713 2:201837334-201837356 AAAGAGAAGGAGAGGGAGAGGGG + Intronic
944673064 2:202012205-202012227 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
944844280 2:203653475-203653497 AAAGAAGAGCAGAATGAGGCCGG + Intergenic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945086028 2:206133512-206133534 ACAGATAGGGAGGAGGAGGCAGG + Intronic
945113121 2:206383122-206383144 AAATAAAAAGAAAAGGAGGCCGG - Intergenic
945656667 2:212632512-212632534 AAAGATAAAAATAAGGAGACAGG - Intergenic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946004067 2:216507926-216507948 GCAGATAAGGAGAATGAGGCTGG - Intronic
946192724 2:218016019-218016041 AAAGTGCAGGAGAAGGAGGAAGG + Intergenic
946322486 2:218961875-218961897 AAAGCTAAGGATAAGGAAGCGGG - Exonic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946938433 2:224746013-224746035 AAACAAAAGAAGAAGGATGCTGG - Intergenic
947076986 2:226355444-226355466 AAAGATAAGTAACAGTAGGCAGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947223976 2:227822508-227822530 AAAGGAAAGGAGATGGGGGCTGG - Intergenic
947235008 2:227932055-227932077 AAAGGCAAGGAGAAGAAGGTGGG - Intergenic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947682941 2:232052318-232052340 AAAGAAATTAAGAAGGAGGCTGG - Intronic
947830187 2:233134144-233134166 AAAGTCAAGGAGGAGGAGGAAGG + Intronic
947898268 2:233695418-233695440 AAAAAGAAGAAGAAGAAGGCCGG - Intronic
947955592 2:234187778-234187800 AGAGAGAAGGAGATGGAGGTGGG - Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948558597 2:238835356-238835378 AAAAAGAAGGAGAAGGAGAAGGG - Intergenic
948815855 2:240510097-240510119 GAAGACAAGGGCAAGGAGGCAGG - Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168806012 20:672764-672786 GAAGATGAGGAGAGGGAGGGAGG - Intronic
1168944538 20:1741606-1741628 AAAGAAAAAGAGAAAGAGGGAGG - Intergenic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169369400 20:5016983-5017005 AAAAAAAAAGAGAAGGAGACAGG - Intergenic
1169449715 20:5701356-5701378 AAAGAGAGGGAGAGGGAGACCGG - Intergenic
1169608570 20:7352318-7352340 AAATATAATCAGAAGGAGCCTGG - Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170040838 20:12037477-12037499 AAAGGAAAGGTGGAGGAGGCAGG - Intergenic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170546203 20:17437392-17437414 AGAGCTGAGGAGAAGGAAGCTGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170654389 20:18272654-18272676 GAAGATAAGGACAATGAGACAGG - Intergenic
1170900423 20:20457185-20457207 AAAGAGAAGGAGAGGGAGCGAGG + Intronic
1170900573 20:20458625-20458647 AAAGAGAAGGAGAGGGAGCAAGG + Intronic
1171059906 20:21946078-21946100 AAAGAGAAGGACCAGAAGGCAGG + Intergenic
1171823017 20:29872890-29872912 GAAGATATAGAGAAAGAGGCAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172183400 20:33017013-33017035 TAAGACAGAGAGAAGGAGGCTGG - Intronic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172481966 20:35276706-35276728 AATGAACAGGAGATGGAGGCAGG + Exonic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1172769481 20:37371288-37371310 AAAAATAAGAAGAAATAGGCTGG - Intronic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1173420404 20:42896148-42896170 ATAGATAAGGAAACTGAGGCAGG + Intronic
1173427487 20:42955798-42955820 AAAGTGAGGGAGAAGGAGGGAGG + Intronic
1173559296 20:43991199-43991221 TAAGATAAGGACAAGGAACCAGG + Intronic
1173651813 20:44671175-44671197 AGAGATATGGAGAAGGGGGTGGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173815683 20:45986504-45986526 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1173944127 20:46936695-46936717 GCAGAACAGGAGAAGGAGGCTGG + Intronic
1173958418 20:47052607-47052629 AAAGATAAAAAGAAAGAAGCAGG - Intronic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174563574 20:51448343-51448365 AAAGAAATGGTGGAGGAGGCCGG + Intronic
1174663027 20:52231583-52231605 AAAGAGAAGGAGGAGGAGAAGGG - Intergenic
1175019759 20:55832650-55832672 AAAGAACAGGAGAAGGAGAATGG + Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176715510 21:10346268-10346290 AAAGATAGAGAGAAGTAGGCAGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1178122323 21:29481767-29481789 AAATAAAAGGGGAAGCAGGCTGG - Intronic
1178305688 21:31488435-31488457 AAAGAAAAGGAAGAGGAGGAAGG + Intronic
1178377976 21:32084059-32084081 AAAGAGAAAGAGAGGGAGGGAGG - Intergenic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178726426 21:35056593-35056615 ATAGATAAGGAAATGGAGGAAGG - Intronic
1178900465 21:36593938-36593960 AAAGAAAAGGAAAAGAAGACGGG - Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179353469 21:40635463-40635485 AAAGAAAGAGAGAGGGAGGCAGG + Intronic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180602838 22:17033685-17033707 AAAGATAGAGAGAAGTAGGCAGG - Intergenic
1180681556 22:17630572-17630594 AAAGAAAAGAAAAAGAAGGCCGG - Intronic
1180861013 22:19082788-19082810 AAAGAAAAGAAAAAGGTGGCTGG + Intronic
1181366011 22:22377574-22377596 CCAGATCAGGAGAAGCAGGCTGG - Intergenic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181646115 22:24232539-24232561 AGAGAGAGGAAGAAGGAGGCCGG + Intronic
1181896385 22:26111583-26111605 AAAAAGAAGGAGAAGAAGGAGGG - Intergenic
1182241436 22:28919432-28919454 ATAGATGAGGAAAGGGAGGCTGG + Intronic
1182517533 22:30867505-30867527 AGAGATCAGGAGAATGAGGGAGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183594684 22:38803556-38803578 AGAGAGAAAGAGAAAGAGGCCGG - Intergenic
1183671392 22:39274829-39274851 AAATATTAAGAGAAGGGGGCAGG + Intergenic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1183881477 22:40835065-40835087 AAAAATTAGGAGAAGGCGGGGGG - Intronic
1183941748 22:41299733-41299755 AAAGAAAAGGGCCAGGAGGCTGG - Intergenic
1184939955 22:47756801-47756823 AAAGATAAGGATAACAGGGCTGG + Intergenic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
949103082 3:169403-169425 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
949575186 3:5331887-5331909 AAAGAGGAGAAGAAGGGGGCAGG - Intergenic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
950028567 3:9836974-9836996 AAAGATAAGGAGGCTGAAGCGGG + Intronic
950071779 3:10158444-10158466 AAAAAAAAAGAAAAGGAGGCCGG - Intergenic
950072206 3:10161705-10161727 GAAGAGAAGGAGAAGCAGGTAGG + Intergenic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950401660 3:12773736-12773758 GAAGAAAAGGAGCAGGAGGAAGG + Intergenic
950603383 3:14056548-14056570 AAAGTTAAGATGAAGGAGTCAGG - Intronic
950689356 3:14643356-14643378 GCAGATGAGGAGATGGAGGCCGG - Intergenic
951549954 3:23867049-23867071 AAAGATGAGGAGAAGGATTCAGG - Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
952001698 3:28793452-28793474 TAAGATAAGAAGAAAGAGGTAGG + Intergenic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952259288 3:31724144-31724166 AGAGAAAAGGGGAAGGAGGAGGG + Intronic
952422996 3:33148151-33148173 AAAGAAGAGTAGAAGGAAGCAGG + Intergenic
953175497 3:40547982-40548004 AAAGATACTGAGAAACAGGCTGG + Intronic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
953833816 3:46326191-46326213 AAAGATAGTGAGAAGGGGGATGG - Intergenic
953997932 3:47535172-47535194 AAAGAAAGTGAGAAGTAGGCTGG - Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954086171 3:48245649-48245671 AAAGATATGGAAGAGAAGGCTGG + Intronic
954238140 3:49272847-49272869 AAAGATTAGGAGAAAAGGGCTGG - Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
954944875 3:54413528-54413550 AAATATAAAGAGAAAGGGGCAGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955413771 3:58673359-58673381 AAAAATAAGGTGAAAGAGGGAGG - Intergenic
955639859 3:61070611-61070633 GAAGAGAAGGAGCAGAAGGCAGG - Intronic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
955878921 3:63523218-63523240 ACAGAAAAGGAGAAGGGTGCTGG + Intronic
955972286 3:64447420-64447442 TAAGATAAGGTGAGTGAGGCAGG - Intergenic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956172321 3:66442733-66442755 AAAGAAAGAGAGAAAGAGGCGGG + Intronic
956284827 3:67597516-67597538 ATAGATAGGGAGGACGAGGCTGG - Intronic
956593323 3:70939693-70939715 AAAGACAAAGAGAAGAAGGAAGG - Intergenic
956819786 3:72943670-72943692 AAAGAACAGGAAAAAGAGGCTGG - Intronic
956828757 3:73024654-73024676 AAAGGAAAGGAGAAGGAGGGAGG - Intronic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957717948 3:83956346-83956368 TGAGATAGAGAGAAGGAGGCAGG - Intergenic
957775393 3:84751999-84752021 ATAGATAAGGAGTAGGGAGCAGG - Intergenic
957832783 3:85544833-85544855 AAAGAAAAGGAGAAAAAGGGAGG + Intronic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958140835 3:89560103-89560125 AAAGATTAGGAGAAAGAAGAGGG - Intergenic
958188577 3:90155080-90155102 AAAGATAAAGTTAAGGAGGGAGG + Intergenic
958732513 3:97974121-97974143 GAAGAAAAGGAGAAGGGGCCAGG + Intergenic
958867658 3:99519684-99519706 AAAGAGGAGGAAAAGGAGGAGGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959454401 3:106541049-106541071 ACAGATAAAGAGAAGGAAGCAGG - Intergenic
959472216 3:106766000-106766022 GCAAATAAGGAGAAAGAGGCAGG + Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959655444 3:108799408-108799430 AAAGAAAAGGAGAAAAAGGAAGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960181990 3:114590764-114590786 AAAGGTAAGGAGAAAGTGCCTGG + Intronic
960183239 3:114607597-114607619 AAAGAGTAAGAGAATGAGGCTGG - Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960331842 3:116369565-116369587 AAAGAAAAGGAGGAAGAGGAGGG + Intronic
960345372 3:116523933-116523955 AAAGGTAGGGAAAATGAGGCAGG - Intronic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960826992 3:121798047-121798069 AAAGAAAGGGAGAAGGATTCAGG + Intronic
960969502 3:123129651-123129673 AAAGTTCAGGACAAGGTGGCTGG - Intronic
961432716 3:126894429-126894451 AAACATAGGGAGAAAGGGGCAGG + Intronic
961559487 3:127718777-127718799 AAAGATATGAAGGAGGATGCAGG - Intronic
961560607 3:127726253-127726275 AAAGAGAGAGAGAAGGAGGGAGG + Intronic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962707756 3:138061831-138061853 AAAGAAAAGGAGGTGGAGGTAGG - Intergenic
962963625 3:140334010-140334032 AAAGAGCAAGAGAAGAAGGCGGG + Intronic
963017244 3:140837579-140837601 AAAGATATGGAGAAATTGGCCGG + Intergenic
963034335 3:141012598-141012620 ATAGGAACGGAGAAGGAGGCTGG - Intergenic
963201479 3:142590781-142590803 AAAAATAAGTAAAAGAAGGCTGG - Intergenic
963356238 3:144211914-144211936 AAATATAAGGTGAAGCAGACAGG - Intergenic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963984716 3:151578655-151578677 AAAGATAGGAAGAAGGATGCAGG - Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964277126 3:155020680-155020702 AAAGAGAGGGAGAAGGAGAGAGG + Intergenic
964351932 3:155811713-155811735 TAAGAAAAGGAAAAGAAGGCCGG + Intergenic
964367812 3:155968439-155968461 GAACAAAAGGAGAAGGAGGTTGG + Intergenic
964472791 3:157072159-157072181 AAAGAAAAGGAGGAGGAGGAAGG + Intergenic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964839744 3:160980769-160980791 AAAGAAAAGGAGAGGGAGGGAGG + Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965079751 3:164021049-164021071 AAGGATGAGGAGAAGGCGGAGGG + Intergenic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965580972 3:170267375-170267397 AAAGAAAAGCAGTAGTAGGCCGG + Intronic
965594875 3:170400712-170400734 AAAGAGAGGGAGAGGGAGGGAGG - Intergenic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
965892851 3:173536360-173536382 AAAGGTAAGGAAATGGAAGCTGG - Intronic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966565018 3:181369669-181369691 AGAGATTAGGAAAAGGAGACTGG + Intergenic
966685585 3:182691129-182691151 ATAGATAAGGAAAAGGAGGGGGG + Intergenic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967621200 3:191636518-191636540 AATGATAAGGAGAACAAGTCTGG + Intergenic
967778008 3:193404651-193404673 AAAGCAAAGGGGAAGCAGGCAGG - Intronic
967802560 3:193679300-193679322 AAAGAGAAAGAGAGGGAGGGAGG + Intronic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076170 3:195817042-195817064 CCCGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968210619 3:196845648-196845670 AAAAAAAAGAAGAAGAAGGCCGG - Intergenic
968362567 3:198157591-198157613 GGAGCTGAGGAGAAGGAGGCTGG - Intergenic
968366683 3:198190793-198190815 AAAGAAAAAGAGAAAGAAGCAGG - Intergenic
968937720 4:3621266-3621288 AAAGATATGTTGCAGGAGGCTGG + Intergenic
969161367 4:5262067-5262089 AAAGATGAGGGGAAGGAGGGAGG - Intronic
969297232 4:6277356-6277378 ACAGAAAAGCAGAGGGAGGCAGG - Intronic
969313191 4:6366303-6366325 AAAGTGCAGGAGAAGGAGCCCGG - Intronic
969313917 4:6370253-6370275 ACAGATGAGGAAACGGAGGCTGG - Intronic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970022683 4:11586909-11586931 AAGGATACAGAGAAGGAAGCAGG + Intergenic
970099147 4:12501342-12501364 AAAGAAAAGGAGAAGGGGAAGGG + Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970502423 4:16691534-16691556 AGAGAGAAGGAGATGGAAGCAGG + Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971280342 4:25238115-25238137 AAAGATGAGAAGATGGAGCCTGG + Intronic
971386481 4:26145011-26145033 AAAAAGAAGAAGAAGAAGGCAGG - Intergenic
971400923 4:26274637-26274659 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
971479047 4:27098317-27098339 AGAGAAAAGGGGAAGGAGGCAGG + Intergenic
971483411 4:27134705-27134727 AAAGACAAAGACAAGGAGGCCGG + Intergenic
972274676 4:37546038-37546060 ATAGATGATGAGAAGGAGGATGG + Intronic
972422591 4:38903458-38903480 AAAAATGAGGTCAAGGAGGCTGG - Intronic
972726288 4:41748658-41748680 ATGGATATGGAGAAGGTGGCTGG + Exonic
972945516 4:44249782-44249804 AAAGAGGAGGGGAAGGGGGCAGG - Intronic
973169657 4:47124820-47124842 AAAGAAAATGAAAAGGAGGAAGG + Intronic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974496159 4:62631195-62631217 AAAGAGAAGGAGAGTGAGACAGG + Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
974916702 4:68186641-68186663 AAAGGCAAGGAGATGGGGGCAGG + Intergenic
975406147 4:73992985-73993007 AAAGAGTAGGAGAAGAACGCAGG - Intergenic
975756685 4:77578396-77578418 AAAGATAAGGATAAGAATGAAGG - Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976408412 4:84685252-84685274 AAAGGTAAGGTGGAGGAGGCTGG + Intronic
976437562 4:85035434-85035456 AAAGCTAAGGAAAGGGAGGAAGG - Intergenic
976851901 4:89557335-89557357 AAAGATAAGGAGGAGCAGGCAGG + Intergenic
977539292 4:98297005-98297027 AAAAAAAAAGAGAACGAGGCAGG - Intronic
978081757 4:104601968-104601990 AAAGAGAAAGAAAAGGAGGGAGG - Intergenic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
978638570 4:110841392-110841414 AAAGATAAGAAGATGAGGGCCGG - Intergenic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
978802413 4:112767996-112768018 AAACAAAGGGAGAAGGAGACAGG + Intergenic
979255096 4:118600403-118600425 AAAGAAAAAGAGAAAGAAGCAGG - Intergenic
979532569 4:121784821-121784843 ACAAATAAGCAGAAGGAGGTGGG + Intergenic
980066892 4:128199517-128199539 AAAGTTCATGAGAAGGATGCTGG - Exonic
980205402 4:129713487-129713509 AAAGTTCAGGAGTAGGAGCCAGG + Intergenic
980494717 4:133575797-133575819 AGAGTTAAGCAGAAAGAGGCAGG - Intergenic
980583830 4:134787958-134787980 AAAGAAAAAAAGAATGAGGCTGG - Intergenic
980604526 4:135072002-135072024 AAAGATAAAGAAAAGAAGGAAGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980784320 4:137532632-137532654 AAAGAGACGGAGAAGGAGGAAGG + Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
981123334 4:141077681-141077703 AAACATAAGGAAAAGAAGGCTGG - Intronic
981384960 4:144119082-144119104 AAAAATAAGGAGAAGAAAGGAGG + Intronic
981766640 4:148258337-148258359 AAGGAAAGAGAGAAGGAGGCAGG + Intronic
982093862 4:151902995-151903017 AAAGATGAGGAGAAAGAGAAAGG - Intergenic
982358600 4:154494536-154494558 AAAGTGAAGGGGAAGTAGGCAGG + Intergenic
983161979 4:164427772-164427794 GAAGACAAGGAGAAGGAAGAGGG + Intergenic
983197445 4:164823049-164823071 TGAGATAAGGAGGAGGTGGCTGG - Intergenic
983421227 4:167520070-167520092 AAAGTTGAGGAGATGGAGGACGG - Intergenic
983720456 4:170845250-170845272 GAAGAGAAGGAGAAGGTGTCAGG + Intergenic
984389673 4:179112713-179112735 AAAGAAAATGAGAAGGAAGAAGG + Intergenic
984589615 4:181602622-181602644 AAAGTTAAGAAGAAATAGGCAGG + Intergenic
984624781 4:181994990-181995012 TAAGAAAAGTAGAATGAGGCTGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984791293 4:183617262-183617284 AAAGAAAAAGAGAAGAAGGAAGG - Intergenic
984836726 4:184029171-184029193 AAAGAGAAGGAGCAGGAGGTGGG - Intergenic
984984234 4:185312065-185312087 AAAGCTAATGAGGAGGAGGAAGG - Intronic
985057556 4:186048727-186048749 AGAGACACGGAGAAGGAGGTGGG + Intergenic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985182220 4:187277417-187277439 TAATATGAGGAGAAGGAGGCTGG - Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985988927 5:3539154-3539176 AAGGACAAGGGGAAGAAGGCTGG - Intergenic
986004772 5:3658445-3658467 AAAAACAAAGAGAAGGGGGCTGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986279239 5:6309969-6309991 AATGAACAGGAGAAGGAGGTGGG - Intergenic
986618279 5:9642938-9642960 AAAGAAAGAGAGAAGGAGGGAGG - Intronic
986674899 5:10175476-10175498 AGATAAATGGAGAAGGAGGCTGG - Intergenic
986698410 5:10379202-10379224 AAATAAAAGGATAAAGAGGCAGG - Intronic
986814975 5:11398990-11399012 AAAGCGGAGGAGAAGGAGGTGGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987445737 5:18017101-18017123 AAAGTTAGAAAGAAGGAGGCAGG + Intergenic
988276479 5:29087442-29087464 AAAGATATGGAATTGGAGGCCGG - Intergenic
988693001 5:33591613-33591635 AAAGCTAGGGAAAATGAGGCTGG - Intronic
989223128 5:38992258-38992280 AAAGAAAGGGAGAAGGAAGGAGG + Intronic
989270049 5:39522480-39522502 AAAGAGGAGGAGAAGGAAACAGG - Intergenic
989311910 5:40028979-40029001 GAAGAAAAGGAGAAGGAGAGGGG - Intergenic
989347141 5:40441759-40441781 AAAGCTTATGAGAAAGAGGCGGG + Intergenic
989367013 5:40667479-40667501 AAAGAAAAGGGAAAGGAGGAAGG - Intergenic
989435613 5:41410122-41410144 AAAGATAAATAAAAGGAGGGGGG - Intronic
989706116 5:44332882-44332904 CAAGAGAATGAGAAGGAGACGGG + Intronic
989753715 5:44925622-44925644 TAAGAAGATGAGAAGGAGGCCGG - Intergenic
989955266 5:50351696-50351718 AAAGAAAGAGAGAAGGAGGGAGG + Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990408358 5:55514820-55514842 AAAGATAAGATGAAGAAGGAAGG + Intronic
990536339 5:56726904-56726926 AGAGATGAGGAGACTGAGGCTGG + Intergenic
990569686 5:57065711-57065733 AAAGAAAAGGAGGAGGAGGGAGG - Intergenic
990797905 5:59565173-59565195 AAAGAGAAGGAGAATGGGACAGG + Intronic
990976806 5:61568018-61568040 AAAGAGAAAGAGAAGGGGGGAGG - Intergenic
991396021 5:66206215-66206237 AAAGATAAGGAGAATGTTCCAGG + Intergenic
991902797 5:71477141-71477163 AAAGGAAAGGAAAAAGAGGCTGG - Intronic
992085483 5:73274732-73274754 AAACATAAACATAAGGAGGCAGG - Intergenic
992118358 5:73564861-73564883 GAAGAACAGGAGAGGGAGGCGGG + Intronic
992149756 5:73891386-73891408 AAAGAGACTGAGAAGGAGGGAGG - Intronic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992245806 5:74821245-74821267 ATAGATAGGGAAAGGGAGGCGGG - Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992446323 5:76837498-76837520 AAAAATAATGAGAAACAGGCAGG - Intergenic
992829994 5:80584785-80584807 AGAGACTTGGAGAAGGAGGCAGG - Intergenic
992844713 5:80735043-80735065 AAAGAAGAGAAGAGGGAGGCTGG + Intronic
993045688 5:82863787-82863809 ATATATAAGGAGAAGGAGCCAGG - Intergenic
993295959 5:86141168-86141190 AAAGTTAAGAAGAAAGAAGCAGG - Intergenic
993306998 5:86286322-86286344 AAAGACATAGAGAATGAGGCTGG - Intergenic
993874237 5:93287507-93287529 AGAGAGAAAGAGAAGGAGGGAGG + Intergenic
994275819 5:97836147-97836169 AAAGAAGAGGAGGAGGAGGAAGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994475070 5:100257208-100257230 AAAGATAAAGAGTAGAAGGGTGG - Intergenic
994792553 5:104248631-104248653 AAAGCTAAGGAAATGGAAGCTGG + Intergenic
995074105 5:107961046-107961068 AGTGATACGGAGAAGCAGGCTGG + Intronic
995082267 5:108066070-108066092 AAAGCTAAGAAGAAGAAGGAGGG + Intronic
995147216 5:108800087-108800109 AAAGCTCAGGAGACCGAGGCAGG - Intronic
995864479 5:116676700-116676722 GGAGAAAAAGAGAAGGAGGCTGG - Intergenic
995918751 5:117284469-117284491 GAAGAACAGGAGAAGCAGGCCGG - Intergenic
996511946 5:124326370-124326392 AAAGAGAAGGGAGAGGAGGCTGG + Intergenic
996791937 5:127302791-127302813 AAAGGAAAGGAGGAGGAAGCAGG + Intronic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997212440 5:132085394-132085416 AAAGACAAAGAGAAGTGGGCAGG - Intergenic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
997722493 5:136090526-136090548 AAAGTGAAAGAGAATGAGGCCGG + Intergenic
998269799 5:140696273-140696295 AAAAATAAGGAGATTGTGGCTGG + Intronic
998490163 5:142539591-142539613 GAAGAAGAGGAGAAGGAGGAGGG - Intergenic
998765100 5:145477838-145477860 AAAGAGAAGGAGGAGGAGAAAGG + Intronic
998909560 5:146944050-146944072 AGAGATAAGGATGAGGAGGCTGG - Intronic
999090460 5:148931729-148931751 AAAGAGAATGAGAGGGAGGGAGG - Intronic
999376753 5:151092113-151092135 GAAGAGAAGGAGAAGGAAGTGGG + Intronic
999625211 5:153513316-153513338 GAAGAGAAGTGGAAGGAGGCTGG - Intronic
1000440779 5:161260582-161260604 AAAGATAAGAAGTAAGAGGAAGG + Intergenic
1000691321 5:164325393-164325415 AAATATAAGGAGATGAATGCTGG - Intergenic
1000850429 5:166333294-166333316 AAAGAGAAGCAGCAGGAGCCAGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001079730 5:168658865-168658887 AAAGTTAAGCAGCAGGATGCAGG + Intergenic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1001763802 5:174228928-174228950 AAGGATATGGAGAAAGAGCCAGG + Intronic
1002076917 5:176713762-176713784 ACAGATAAACAGAAGGAGCCTGG - Intergenic
1002189103 5:177469669-177469691 AAAGCTAGGGAGGAGGAGGAAGG - Intronic
1002357536 5:178642783-178642805 TGAGATAAGGAGAAGCTGGCTGG - Intergenic
1002611123 5:180419238-180419260 AGAGACACGGAGAAGGAGGGGGG + Intergenic
1002725908 5:181295993-181296015 AAAGAAAAAGAGAAAGAAGCAGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003365065 6:5466019-5466041 AAAGATCAGAAAAAAGAGGCAGG - Intronic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003560977 6:7180071-7180093 AAAGATGTGGACAAAGAGGCTGG + Intronic
1003745514 6:8997152-8997174 AAGGAAAAGGAGAAGGAGCTAGG + Intergenic
1003745546 6:8997619-8997641 AAAGAAAAAGAGAGGGAGGGAGG - Intergenic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004569932 6:16835237-16835259 AAAAAAAAAGAAAAGGAGGCTGG - Intergenic
1004572211 6:16858203-16858225 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
1004727994 6:18329365-18329387 AAAAATAATGAGCATGAGGCAGG + Intergenic
1004798165 6:19113116-19113138 AAAGAAAAAGAGAAGGAAGAAGG - Intergenic
1004853014 6:19719785-19719807 AAAGACAAGGAGCAGATGGCCGG + Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005081904 6:21965215-21965237 AGAGGAAATGAGAAGGAGGCAGG + Intergenic
1005088499 6:22032073-22032095 AAAAAGAAGAAGAAGGAAGCGGG - Intergenic
1005434840 6:25797842-25797864 AAAAATAGGGAGGACGAGGCGGG - Intronic
1005665112 6:28044486-28044508 AAAGAAAAAGAGAAAGAGGGAGG + Intergenic
1005700121 6:28392470-28392492 AAAGAAAAGGAGTAACAGGCTGG - Intronic
1005847225 6:29791771-29791793 ACAGGTAAGGAGTAGGAGGCAGG + Intergenic
1005864116 6:29926001-29926023 ATAGGTAAGGAGTGGGAGGCAGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006053002 6:31357595-31357617 AGAGGTAAGGAGTGGGAGGCAGG - Intergenic
1006168741 6:32081170-32081192 AGAGATGAGGAGGTGGAGGCTGG + Intronic
1006677579 6:35775579-35775601 AAAAAAAAGCAGAAGCAGGCAGG + Intergenic
1006827207 6:36944356-36944378 AAAGAAAAAGGGAAGGAGGGAGG + Intergenic
1006852369 6:37108122-37108144 AAAGAAAAGTAAAAAGAGGCTGG + Intergenic
1006986225 6:38177399-38177421 ACAGATCAGTAGAAGGAGGCAGG - Intronic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007388312 6:41534409-41534431 AAAGAAAAAGAGAAGGGGTCTGG + Intergenic
1007520128 6:42445610-42445632 AAAGATTGGGAGAGGGAGGCGGG - Intronic
1007594304 6:43042060-43042082 AGAGAGAAAGAGAAGGAGGGAGG + Intronic
1007893734 6:45324624-45324646 AGAGATAGGGAGAGGGAGGGAGG + Intronic
1007906645 6:45467927-45467949 AACTTTAAGGAGAAAGAGGCTGG - Intronic
1008179690 6:48313004-48313026 AAATAGAAGGAGGAAGAGGCAGG + Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008892469 6:56511013-56511035 AAAGATAAGGAGATAAAGGCTGG + Intronic
1009187940 6:60596174-60596196 AAAAATAAGAAGAAGGAAGAAGG - Intergenic
1009932598 6:70194033-70194055 TAAGAAAAAGAGAAGGAGACGGG - Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010412779 6:75579652-75579674 AAAGTTTAGGAGAAGGAAGGGGG - Intergenic
1010595390 6:77756673-77756695 AGAGAGAAGGAGAAGGCGGCGGG - Intronic
1010745820 6:79560379-79560401 AAAGATAACTAGCAGGAGTCAGG + Intergenic
1011292580 6:85792058-85792080 AAAGAAAGAAAGAAGGAGGCTGG - Intergenic
1011361628 6:86531700-86531722 AAAGAGAAGGAGGAGGAGAGAGG - Intergenic
1012529672 6:100220462-100220484 AAAGCTCAGGAGAAGGAGAAAGG + Intergenic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012734301 6:102919649-102919671 AAAGAAAAAGAGAGGGAGGAGGG + Intergenic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325244 6:109039135-109039157 AAAGAAGAGGAGAAGGAAGGAGG + Intronic
1013343663 6:109238950-109238972 ACAGATGAGGAAACGGAGGCTGG + Intergenic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013525262 6:110968283-110968305 AAAAATAAGTAAAATGAGGCCGG + Intergenic
1014078669 6:117265258-117265280 AGAGAGAGAGAGAAGGAGGCGGG - Intergenic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014374197 6:120651916-120651938 GAAGAAAAGGAGAAAGAGGAGGG + Intergenic
1014826725 6:126055367-126055389 ATAGTGAAGGAGAAGCAGGCAGG - Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015237912 6:130992304-130992326 AGTGGTAAGGAGAAGGATGCTGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015366454 6:132401764-132401786 AAAGAAAGGGAGGAGGAGGCAGG + Intergenic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016027750 6:139305700-139305722 AATGTTAAGGAGAAGGAAGTGGG + Intergenic
1016058367 6:139602673-139602695 TGAGATAAGGAATAGGAGGCAGG - Intergenic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016238242 6:141893954-141893976 AAAGATGAGCAGGTGGAGGCCGG + Intergenic
1016694479 6:146976755-146976777 AAAGAGAAGAAGAAGGATGGGGG - Intergenic
1016906454 6:149155237-149155259 AAAGAAAAGTAGATGGAGGGGGG + Intergenic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017297204 6:152811910-152811932 AAAGAAAAGGAGGAGGAGGAAGG - Intergenic
1017334099 6:153234693-153234715 AAAGAAAAGGAGAAAGAAACTGG + Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017491163 6:154946451-154946473 AAAGAGAAGAAGAAGAAGACAGG - Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017757974 6:157545682-157545704 AAAAAAAAGTAGAAGGAGGGTGG + Intronic
1018152281 6:160951526-160951548 AGAGATAAGGAGGAGCAAGCGGG + Intergenic
1018192217 6:161319593-161319615 AAAGTTAGGGGGAAGGAGACTGG + Intergenic
1018515894 6:164579781-164579803 TAAGATGAGGAAAAGCAGGCCGG - Intergenic
1018520355 6:164642240-164642262 AAAGAGAAAGGGAAGGAGGGAGG - Intergenic
1018814424 6:167320430-167320452 GAAGAAAAGGGGAAGGAGGAAGG - Intergenic
1019253115 7:31116-31138 GGAGCTGAGGAGAAGGAGGCTGG + Intergenic
1019266811 7:121693-121715 GGAGAAAAGGAGAAGGAGGGAGG + Intergenic
1019489250 7:1303737-1303759 AAAGAGAAAGAGAGGGAGGGAGG + Intergenic
1019491416 7:1315217-1315239 AGAGATGAGGAGACCGAGGCTGG - Intergenic
1019737882 7:2659480-2659502 GAAGAAAAAGAAAAGGAGGCAGG - Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020164955 7:5800495-5800517 AAAGGTAAGGAGGCAGAGGCAGG - Intergenic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020237293 7:6366267-6366289 AAAGAAAAGAAGAAAAAGGCCGG + Intergenic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1020684324 7:11274642-11274664 AAAGAAGAGGAAAAGGAGCCAGG - Intergenic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021427810 7:20522628-20522650 AAAGAGGAGGAGAGGGAGGCTGG + Intergenic
1021980345 7:26048134-26048156 AAAGATAATGAGTAGGGGGCCGG - Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022545146 7:31180328-31180350 AAAGGTAAGGTGGAGGGGGCAGG - Intergenic
1022633844 7:32112290-32112312 GAAGAAGAGGAGAAGGAGGAGGG - Intronic
1022765883 7:33410823-33410845 AAAGAAAAGTTGTAGGAGGCAGG - Intronic
1022779346 7:33562627-33562649 ATAGAAAAGGGAAAGGAGGCTGG + Intronic
1023028085 7:36070022-36070044 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1023116849 7:36871233-36871255 TAAGATCAGGTGAAAGAGGCTGG + Intronic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1024070798 7:45783561-45783583 AAAGAAAAAGAGAAAGAAGCAGG - Intergenic
1024183429 7:46921839-46921861 GAAGAAAAGGAAAAGGAGGAAGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024642042 7:51337482-51337504 AAAGAAAAGAAAAAGAAGGCTGG + Intergenic
1024682027 7:51700668-51700690 AAATATAAAGAGAAGGAGAAAGG + Intergenic
1025135475 7:56408245-56408267 AAAGAAAAAGAGAAAGAAGCAGG + Intergenic
1025263638 7:57438874-57438896 AAAGAAAAAAAAAAGGAGGCAGG - Intergenic
1025624764 7:63210971-63210993 AGAGATAAAGTGAGGGAGGCTGG - Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026205741 7:68255663-68255685 AAAGAAAAGGAGAAAGGAGCAGG - Intergenic
1026245429 7:68615341-68615363 GAAGATGAGGAGAAGAAGGAGGG + Intergenic
1026404871 7:70054909-70054931 AGAGATAAGGAGGAGGAGAAGGG - Intronic
1026494169 7:70888276-70888298 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026494181 7:70888332-70888354 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026643537 7:72148606-72148628 AAAGAAAAGAAAAAAGAGGCTGG + Intronic
1026742376 7:72987081-72987103 AAAGAAAAAGGAAAGGAGGCTGG + Intergenic
1026802223 7:73407512-73407534 AAAGAAAAAGGAAAGGAGGCCGG + Intergenic
1026887078 7:73956967-73956989 AAAGATGGGGAGCAGGGGGCGGG - Intergenic
1026967759 7:74451251-74451273 AAAGAAAAAGAGAAAGAGGCAGG + Intergenic
1027028498 7:74871818-74871840 AAAGAAAAAGGAAAGGAGGCTGG + Intergenic
1027101359 7:75377996-75378018 AAAGAAAAAGGAAAGGAGGCTGG - Intergenic
1027131122 7:75592158-75592180 AAAGACAAAGGGAAGGAGGATGG + Intronic
1027171765 7:75877952-75877974 GAAGAAAAGGGGCAGGAGGCTGG - Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028987436 7:97019061-97019083 AGAGAAGAGGAGGAGGAGGCAGG + Intergenic
1029405709 7:100373155-100373177 AGAGAGGAGGAGAAGGAAGCCGG - Intronic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029539752 7:101175629-101175651 AAAAAAAAGAAGAAGAAGGCTGG + Intronic
1029566484 7:101341841-101341863 AAAGAAAAGTATAAAGAGGCTGG - Intergenic
1029787898 7:102810879-102810901 AAAATTAATGAAAAGGAGGCTGG - Intergenic
1029996160 7:105010528-105010550 AAAAACAAGGAAAAGGAGGTTGG + Intergenic
1030068496 7:105678816-105678838 AGAGGTCAGGAGTAGGAGGCTGG - Intronic
1030345010 7:108423301-108423323 AAAGTGAAGGAGAAAGAGTCAGG + Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030849877 7:114470797-114470819 AAAAACATGGAGAAGGAGGATGG - Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032251555 7:130262120-130262142 AAAGATAAAGATAAGGGGCCGGG - Intergenic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032675005 7:134121806-134121828 AGAGATAAAGGGGAGGAGGCTGG - Intergenic
1032746946 7:134795606-134795628 AAAGAAAAGGAGGAGGGGGAAGG - Intronic
1032842333 7:135724168-135724190 CAAGTTAAGGGGAAGGAGGTGGG + Intronic
1033122342 7:138677198-138677220 TAAGAAAAAGAGCAGGAGGCCGG - Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034290046 7:149923435-149923457 AAACACAAGGAGAAGCAAGCAGG + Intergenic
1034435672 7:151061745-151061767 AAAGAGAAGAACAAGGAGACAGG - Intronic
1034507582 7:151506416-151506438 ACAGATAAGGAAAAGGACTCAGG - Intronic
1034568485 7:151934917-151934939 GAAGATCAGAAGAAAGAGGCTGG + Intergenic
1034661022 7:152769411-152769433 AAACACAAGGAGAAGCAAGCAGG - Intronic
1034847804 7:154463501-154463523 TAAGAAAAGGAGAAGTAGGCTGG - Intronic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035117835 7:156539753-156539775 AGAGAGAAGGAGGAGGAGGGAGG - Intergenic
1035196862 7:157229151-157229173 AAAGATAGGGGGAAGGAGAGGGG - Intronic
1035810546 8:2487476-2487498 AAAGAAAAAGAAAAAGAGGCCGG + Intergenic
1035861074 8:3028236-3028258 AGAGATTAGGAGAAGGAGTCAGG - Intronic
1035904966 8:3499757-3499779 ACAGCCAAGGAGAAGGATGCAGG - Intronic
1036400019 8:8399882-8399904 AAAGAGAAAGAGAGGGAGGGAGG - Intergenic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1037147666 8:15592840-15592862 AAAGATGAGGAAAACGAGGCAGG + Intronic
1037218213 8:16484051-16484073 AAAGAGAAGGAGAAGAAGAAAGG + Intronic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037608014 8:20453771-20453793 GAAGAGGAGGAGAAGGAGGCTGG + Intergenic
1037773739 8:21818938-21818960 AAAGATGAGGAGGAGGAGGGTGG - Intergenic
1038148271 8:24918169-24918191 AAAGAGAAGGAGAAAGCGGGAGG + Exonic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038483654 8:27918848-27918870 GAAGAAGAGGAGAAGGAGGAGGG + Intronic
1038579894 8:28738890-28738912 GCAGACAAAGAGAAGGAGGCAGG - Intronic
1039033668 8:33335932-33335954 GAAGAGATGGAGGAGGAGGCAGG + Intergenic
1039182082 8:34878191-34878213 AAAGAAAAGAAAAAGGAGGGAGG + Intergenic
1039184306 8:34899702-34899724 AAGGTTGAGGAGAAGGTGGCTGG - Intergenic
1039218873 8:35305706-35305728 AAAGAGAAAGAGAGGGAGTCAGG - Intronic
1039400332 8:37263654-37263676 AAGGAAAAGGGGAAGCAGGCAGG + Intergenic
1039973019 8:42336167-42336189 AAAGTTAAGGAGAAGCTGGTGGG + Intergenic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040472372 8:47744988-47745010 AAAGAAAAAGAGAGGGAGGGAGG + Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041187130 8:55312859-55312881 CAAGACAAGGAGAAAGAGACTGG + Intronic
1041267603 8:56080326-56080348 AAAAAGAAGAAGAAGGAGGAGGG + Intergenic
1041395142 8:57382856-57382878 ATATATAAAGAGAGGGAGGCAGG + Intergenic
1041440980 8:57896754-57896776 AAAGGTAAAGAGAAGTAGCCAGG - Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042537739 8:69875725-69875747 AAAGAAAAAGAGAGGGAGGAAGG + Intergenic
1042721300 8:71829513-71829535 AAAGATAAGGAAAATGAAACTGG - Intronic
1042839226 8:73107205-73107227 AAAGAAAAAGAAAAGGAGACAGG + Intronic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043156941 8:76794843-76794865 ATAGAGATGGAGAAGGCGGCTGG + Intronic
1044587895 8:93885052-93885074 AGAGAAAAGGAGAAACAGGCAGG + Intronic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045024111 8:98070358-98070380 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1045065930 8:98444313-98444335 AGAGATGAGGAGAGGGAGGTGGG + Intronic
1045196342 8:99934841-99934863 ACGGATAAAGAAAAGGAGGCCGG + Intergenic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045724831 8:105159995-105160017 AAAGAGGAGGAGAAGAGGGCAGG + Intronic
1045828091 8:106425213-106425235 AAAGAAAAGAAAAAAGAGGCAGG - Intronic
1045865468 8:106860517-106860539 AATAAAAAAGAGAAGGAGGCCGG + Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046048300 8:108988772-108988794 AAAGAGAAAGAGAGAGAGGCAGG + Intergenic
1047220122 8:122912017-122912039 TAAGAAAAGGAGAAAGAGACAGG + Intronic
1047371322 8:124258297-124258319 CAAGTTAGGGGGAAGGAGGCTGG - Intergenic
1047416907 8:124672196-124672218 AAAAATATGGAGAAGGGGCCAGG + Intronic
1047661134 8:127038246-127038268 AAAGAGAAGGACAAGCAGCCAGG - Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048189835 8:132277909-132277931 GAAGCTAAGGAGAGGGAGGTAGG - Intronic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048993012 8:139772375-139772397 ACAGATGAGGAGATGGGGGCTGG + Intronic
1049164424 8:141117495-141117517 AAAGAGAGGGAGAGGGAGACAGG - Intronic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1049358579 8:142200952-142200974 AAAGAAAAAGAGAGGGAGGCAGG + Intergenic
1049905427 9:212385-212407 AAAGATACGGAGAAAGAGGAAGG + Intergenic
1050061288 9:1712274-1712296 AAAGATGAGTTTAAGGAGGCAGG - Intergenic
1050533686 9:6612435-6612457 AAAGAAAAGTAGATGGAGGCTGG + Intronic
1050607087 9:7313519-7313541 AAAAATAAAGAAAAGGGGGCTGG - Intergenic
1050702242 9:8353591-8353613 AAATATAAGGAAAATGAGCCGGG - Intronic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1051017611 9:12499596-12499618 AAAGCAGAGGAGAAGGAGGCAGG + Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051466389 9:17382859-17382881 AAAGATAAGGCTAATGAGGTAGG - Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051657120 9:19393810-19393832 AAAGTGAAGGAGAAATAGGCCGG + Intergenic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1051947824 9:22593094-22593116 AAATATAAGGACAACGAGCCTGG - Intergenic
1052311202 9:27071408-27071430 AAAGAAAAGTAAAATGAGGCTGG + Intergenic
1052333649 9:27297561-27297583 AGAGATAGTGAGAAGGAGGATGG + Intergenic
1052411816 9:28131034-28131056 GGAGATAAGGGGAGGGAGGCTGG - Intronic
1052412893 9:28145665-28145687 AGAGAGAGGGAGAAGGAGGGAGG - Intronic
1052519193 9:29522664-29522686 AAAGATAAGGAAACCGAGGCAGG - Intergenic
1052806761 9:33020139-33020161 AAAGAAAAGGAGTCGGAGCCAGG - Intronic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053060129 9:35024160-35024182 AGAGACACGGAGAAGGAGGGTGG + Intergenic
1053164964 9:35837793-35837815 AAAGGCAAGGAGATGGAGGCCGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053218930 9:36295262-36295284 AAAGAAAAGCAGCTGGAGGCTGG + Intronic
1054453439 9:65416433-65416455 AAAGATATGTTGCAGGAGGCTGG - Intergenic
1055418868 9:76114671-76114693 ACAGCTAAGGAAAAAGAGGCAGG - Intronic
1055868548 9:80845622-80845644 AAAGAAAAAGAGAAGAAGGAAGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056107241 9:83359423-83359445 ACAGATGAGGAAATGGAGGCAGG - Intronic
1056240102 9:84636740-84636762 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1056626973 9:88261695-88261717 AAATATAAAGTGATGGAGGCCGG - Intergenic
1056638267 9:88348910-88348932 AAAGAGAAGGAAAAGGTAGCGGG - Intergenic
1056662340 9:88553464-88553486 AGAGACAAGGAGAAGGAGGGTGG - Intronic
1056673117 9:88648394-88648416 ACAGATAAAGAGAAAGAGGGAGG - Intergenic
1057214754 9:93221504-93221526 AATCATATGTAGAAGGAGGCAGG - Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057744776 9:97742076-97742098 GAAGATGAGGAGGAGGAGGAGGG + Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1058112889 9:101050917-101050939 AAAGAGAAGGCTAAGGAGACTGG - Intronic
1058344562 9:103945645-103945667 AAAGAAAAGGAGAAGGTCGTAGG - Intergenic
1058351678 9:104032506-104032528 AAAGGTAAGGAGTAGGAGTGAGG - Intergenic
1058671980 9:107367565-107367587 AAAGAGGAGGAGAGAGAGGCCGG - Intergenic
1058872320 9:109213280-109213302 ATACAGAAGGAGAAGGAGACAGG - Intronic
1059014820 9:110504415-110504437 GAAGAAAAGGAGAAGGAAGCAGG - Intronic
1059048226 9:110894349-110894371 ACAGATAAGGATATTGAGGCTGG - Intronic
1059138406 9:111829512-111829534 GAAGATAAGGAGAAGAAGGGAGG - Intergenic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059383545 9:113946961-113946983 AAAGACAGTGAGGAGGAGGCAGG - Intronic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1059633714 9:116153115-116153137 AAAGAGAGGGAGAGGGAGGGAGG + Intergenic
1059663961 9:116428227-116428249 AAAGAAGAGGAAAAGGTGGCCGG + Intronic
1059669274 9:116477654-116477676 TAAGAAAAGGAGAAAGAGACAGG + Intronic
1059799485 9:117735881-117735903 AAAAAGAAGAAGAAGAAGGCTGG + Intergenic
1059953740 9:119494660-119494682 AAAGAAAGTGAGAATGAGGCAGG + Intergenic
1059965515 9:119609847-119609869 AAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1060028079 9:120190055-120190077 AAAGATGAGGAAACTGAGGCTGG + Intergenic
1060044988 9:120332807-120332829 AAAGAGCAAGAGAAGGAGCCAGG + Intergenic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061153927 9:128845760-128845782 AAAGAAGAGGAGCAGGAGGTGGG + Intronic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1061751871 9:132784148-132784170 AAAGAGAAAGAGAAGGGGGTAGG + Intronic
1061832649 9:133305225-133305247 AAAAAAAACAAGAAGGAGGCCGG + Intergenic
1062008508 9:134254382-134254404 AAAGGGAGGGAGAAGGAGGGAGG + Intergenic
1062028370 9:134350868-134350890 ACAGATGAGGACAAGGCGGCAGG - Intronic
1062037025 9:134386903-134386925 AAAGATGAGGAAACTGAGGCTGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062532228 9:137007018-137007040 AAGGCTAAGGGGAAGGGGGCCGG + Intergenic
1062632630 9:137472288-137472310 AAAGAAAATGAGATGGAGGCTGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062705465 9:137937647-137937669 AAAGTTAAGATGAAGGAGGCTGG + Intronic
1062747255 9:138221250-138221272 GGAGCTGAGGAGAAGGAGGCTGG - Intergenic
1062751043 9:138253637-138253659 AAAGAAAAAGAGAAAGAAGCAGG - Intergenic
1185499042 X:583931-583953 AAACAAGAGGAGGAGGAGGCTGG + Intergenic
1185523727 X:761079-761101 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185575331 X:1167958-1167980 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185963512 X:4573308-4573330 AAAGATAAGGGGGAGAAGGAGGG + Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186329418 X:8516382-8516404 AAAGATAGGGAGTAGAAGGATGG + Intergenic
1186586714 X:10882678-10882700 AAAGATAAGCAGGAGGTGTCAGG - Intergenic
1186684227 X:11907953-11907975 AAAGAAGAGGAGAAGGAAGAAGG - Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187485934 X:19703370-19703392 GAAGATAAGGGGTTGGAGGCGGG + Intronic
1187529753 X:20085668-20085690 AAAGATAAAGAGAAGGAACAGGG + Intronic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1188750281 X:33896577-33896599 AGAGATAAAGAGAGGGAGGGAGG - Intergenic
1189216660 X:39330930-39330952 AAAGAGAAGAAGAAGCAGGGAGG + Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189686668 X:43571537-43571559 AATGAAAAGGAGAGGGATGCTGG - Intergenic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1189782714 X:44531490-44531512 AAAGATAAGGAGTTGGGGGTGGG - Intronic
1190236072 X:48616758-48616780 AAAGGGAAGGAGGAGGAAGCAGG + Intergenic
1190360241 X:49642413-49642435 AAAGATAAGGCGATAGAGTCAGG + Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190883288 X:54508888-54508910 AAAAAAAAATAGAAGGAGGCTGG - Intergenic
1191140287 X:57109221-57109243 AGAGATAACGAGAAGGTGGGGGG - Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192130219 X:68542879-68542901 AAAAAGAAGAAGAAGAAGGCTGG - Intergenic
1192419248 X:71014295-71014317 AAAGTTAAGGAGGAGGAGTTAGG - Intergenic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1193022501 X:76805395-76805417 AGAAATAAGGAGAAAAAGGCAGG - Intergenic
1193097444 X:77566068-77566090 AAAGAAGAGGAGAAGGAAGGAGG + Intronic
1193395901 X:80982904-80982926 AAAGAAAGAGAGAAGGAGGGAGG - Intergenic
1193568343 X:83108392-83108414 AAAGAGAAAGAGAAGGATGGTGG - Intergenic
1193650532 X:84125556-84125578 AAAAATAAAGAGAAAAAGGCTGG + Intronic
1193763818 X:85500633-85500655 AAAGAGAAGGAGAATGAGTTTGG + Intergenic
1194533361 X:95077284-95077306 AAAGATCAGGAGAAGGATAGAGG - Intergenic
1194620790 X:96168655-96168677 AAAGCTAGGGAGAGGTAGGCAGG + Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195211137 X:102652861-102652883 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195217292 X:102713812-102713834 AAAGGCAAGGAGGAGGAGACTGG + Exonic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195745024 X:108108319-108108341 ACAGGTAAATAGAAGGAGGCAGG - Intronic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1196701003 X:118668772-118668794 ATTGATAAGGAGAAGGATCCTGG + Intronic
1196883358 X:120220638-120220660 AAAGAAGAGGAGAAGCAGGGAGG + Intergenic
1196921157 X:120586542-120586564 AAAAATAGGAAGGAGGAGGCGGG + Intergenic
1196987647 X:121292649-121292671 AAAGCTAAGGAGAAGGACTATGG - Intergenic
1197702836 X:129612474-129612496 AGAGATAAGGTTAAAGAGGCAGG - Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1197884301 X:131202040-131202062 AAAGCTCTTGAGAAGGAGGCAGG + Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198162362 X:134020281-134020303 AAACAAAAGGATAAGCAGGCCGG + Intergenic
1198212667 X:134530194-134530216 AGATAAAAGGAGAAGGCGGCCGG - Intergenic
1198383379 X:136105077-136105099 AAAGGCAAGGAAAAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198513472 X:137378483-137378505 AAAGATAAGGTGGAGAAGGTGGG + Intergenic
1199320056 X:146427371-146427393 TCAGAAAAGGAGGAGGAGGCCGG - Intergenic
1199406083 X:147462421-147462443 AAAAAAAAAGATAAGGAGGCTGG + Intergenic
1199443223 X:147892796-147892818 AAGGATAAGGAGACGAAGGTAGG - Intergenic
1199523883 X:148769763-148769785 CAAGTTAAGGAGAAGGGGTCTGG - Intronic
1199572063 X:149276187-149276209 AATGAGAAAGGGAAGGAGGCAGG - Intergenic
1199862173 X:151810968-151810990 AAACATGAGGAGAAAGAGCCTGG + Intergenic
1200101160 X:153689564-153689586 CAAGGTCAGGAGAAGGATGCTGG + Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201266277 Y:12210275-12210297 ACAGATGAGGAGGAGGAGGAGGG + Intergenic
1201428184 Y:13877300-13877322 AAAGATAAGGACAAAAAGTCTGG - Intergenic
1201453010 Y:14136342-14136364 AAAGACAAGGAAAAGGAGAAGGG - Intergenic
1201454648 Y:14156493-14156515 AAAGATAATGACAAGAAGCCAGG - Intergenic
1201671844 Y:16530635-16530657 AAAGAAAAGAAGCAGTAGGCTGG + Intergenic
1201864728 Y:18637687-18637709 AAGGTTAAAGAGAAGAAGGCAGG - Intergenic
1201868594 Y:18682691-18682713 AAGGTTAAAGAGAAGAAGGCAGG + Intergenic