ID: 1167087453

View in Genome Browser
Species Human (GRCh38)
Location 19:47320100-47320122
Sequence GAGGGAGGGCAGGATGCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 1, 1: 0, 2: 11, 3: 77, 4: 800}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167087453_1167087460 14 Left 1167087453 19:47320100-47320122 CCTGCAGCATCCTGCCCTCCCTC 0: 1
1: 0
2: 11
3: 77
4: 800
Right 1167087460 19:47320137-47320159 GTACGCCAGCATCCTGCTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167087453 Original CRISPR GAGGGAGGGCAGGATGCTGC AGG (reversed) Exonic
900156273 1:1204506-1204528 GAGGGAGGGAGGGAGGCTGGTGG + Intronic
900236776 1:1596858-1596880 GAGGGAGGGGAGGCTCCTCCAGG + Intergenic
900318184 1:2069762-2069784 GAGGGAGGGGTGGATGCTATAGG + Intronic
900352318 1:2241072-2241094 GAGGGAGCCCAGGATGCTGTGGG + Intronic
900390482 1:2431807-2431829 GAGGGAGGGCAGTCTTGTGCTGG + Intronic
900971304 1:5993613-5993635 GAGGGACACCAGGATGCGGCTGG - Intronic
901027134 1:6284701-6284723 CAGGGAGGCCTCGATGCTGCAGG - Intronic
901027381 1:6285755-6285777 CACGGAGGTCAGGATGCTTCAGG + Intronic
901056382 1:6450380-6450402 GAGGGGGGGCAGGATGAGACTGG - Intronic
901221328 1:7585629-7585651 GGGCAAGGGCAGGAGGCTGCAGG + Intronic
901233070 1:7652012-7652034 GAGGGATGGCAGGGGGCTGAGGG - Intronic
901674455 1:10874843-10874865 AGGGGAGTGCAGGCTGCTGCTGG + Intergenic
902360001 1:15937229-15937251 GAGGGCGGGCAGGGTGGTGCAGG - Exonic
902896238 1:19482057-19482079 GAGGGAGGGCAGGCTTCTAACGG + Intronic
903375141 1:22860929-22860951 GAGGGAGGGCAGGACGACTCAGG + Intronic
903660009 1:24971302-24971324 GTGGGAGGGCAGGAATCTGCTGG - Intergenic
903822196 1:26111443-26111465 GAGGGAGGGGAGGCCGCGGCCGG + Intronic
903970736 1:27117299-27117321 GAGGGGGGTCAGCATGCAGCTGG - Intronic
904208122 1:28868114-28868136 TAGGGAGGGCAGGAGGGTGATGG + Intergenic
904398415 1:30239355-30239377 GAGCAAGTGCAGAATGCTGCAGG - Intergenic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
905294821 1:36947519-36947541 AAGGGAGGGCAGGAAGGTGGGGG - Intronic
905530586 1:38675559-38675581 GAGGGACACCAGGATGGTGCAGG - Intergenic
906247062 1:44283828-44283850 CAGGGAGGGCAGCATGCTTTTGG - Intronic
906291340 1:44621480-44621502 GAGGGAGGGGAGGTTGCTACTGG - Intronic
906710966 1:47929797-47929819 GAGGGAGATGAGGATGTTGCTGG - Intronic
907314692 1:53560862-53560884 GTGGCAGGGCAGGATGGGGCAGG - Intronic
907326963 1:53644595-53644617 GGGGTAGGGCAGGGTGCTGAAGG + Intronic
907333448 1:53685969-53685991 GGGGGAGGGCAGGTTTCTGACGG - Intronic
907528606 1:55070306-55070328 GAGTGAGGGCAGGAGGATACAGG + Intronic
908806255 1:67936352-67936374 GTGGGAAGGCAGGCTGCGGCAGG + Intergenic
909481508 1:76132321-76132343 GAGGGAAGGCAAGCTGCTGCTGG - Intronic
909913763 1:81292615-81292637 GAGCCAGGACAGAATGCTGCTGG + Intergenic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
911122420 1:94309663-94309685 GAGGGAGGGATGGATGATGCAGG + Intergenic
911129966 1:94377558-94377580 GAGGGAGGGAAGGAATCTCCAGG + Intergenic
912008572 1:104932829-104932851 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
912228683 1:107766729-107766751 GAGGAAGGGGAGGAAGCAGCGGG + Intronic
912459649 1:109822222-109822244 GAGGGAGGTCAGGAGACTTCTGG + Intergenic
912651501 1:111443553-111443575 CAGAAAGGGCAGGAGGCTGCTGG - Intronic
912806059 1:112758099-112758121 GAGGGAGGGCAGGGTGGGGTAGG - Intergenic
913131178 1:115839240-115839262 GAGGGAGGAGAGGATGCAGAGGG + Exonic
913247029 1:116879080-116879102 GAGGGAGGGCAGGCAGCTGCTGG - Intergenic
913250652 1:116909993-116910015 GAGGGAGGGAAGGAGGCGGGAGG + Intergenic
913571651 1:120126206-120126228 GAGGCAGGGCTGGGTGCTGTGGG + Intergenic
914292572 1:146287827-146287849 GAGGCAGGGCTGGGTGCTGTGGG + Intergenic
914553616 1:148738610-148738632 GAGGCAGGGCTGGGTGCTGTGGG + Intergenic
914755413 1:150559256-150559278 GGGGGAGGGCAGGGTGATGAGGG - Intronic
915009326 1:152670583-152670605 GAGGGAGTGCAGCATGTGGCTGG + Intergenic
915102022 1:153507612-153507634 GAGGGATGGCAGGGGGCAGCAGG - Intergenic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
915394458 1:155572222-155572244 GAGGGAAGGGAGGATGCTATTGG - Intergenic
915581689 1:156816608-156816630 GAGGGAGGGCAGGGGGATGGGGG + Intronic
915894708 1:159802814-159802836 GCAGGAGGGAAGGAGGCTGCTGG + Intronic
916065641 1:161133272-161133294 GGGGGTGGGGAGGATGGTGCGGG + Intergenic
916196679 1:162230235-162230257 GACGGAGGGGTGTATGCTGCTGG + Intronic
917929878 1:179815776-179815798 GAGGAAGGTCAGGGTGCCGCTGG + Exonic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
918304330 1:183232273-183232295 GCTGGAAGGCAGGATGCAGCAGG + Exonic
919059223 1:192609294-192609316 GAGGAACTGCAGAATGCTGCCGG - Intergenic
920547002 1:206826569-206826591 GAGGGTGGACTGGAGGCTGCTGG - Intronic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
920987744 1:210906337-210906359 AGGGGATGGCAAGATGCTGCTGG + Intronic
921054252 1:211532147-211532169 GAGGGACAGCAGGTTGCTGAAGG + Intergenic
922421585 1:225464147-225464169 GCTGGAGGGCAGGAGGCTGGAGG + Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
923109547 1:230879858-230879880 GAGGGAGGGCAGGGTGATTGTGG - Intergenic
924454086 1:244204226-244204248 CAGGCAGGGCAGGCTGCTGTAGG - Intergenic
924596082 1:245445862-245445884 AAGGGAGGGAAGGATGCTAATGG - Intronic
924862082 1:247935877-247935899 GAAGGAAGGCAGGAGCCTGCGGG - Intergenic
1063212404 10:3892951-3892973 GGTGGAGGGCAGGCTGCTGGAGG - Intergenic
1063434564 10:6019740-6019762 GAGGGAGAGGAGGCTGCTGTGGG + Intronic
1064552771 10:16520424-16520446 GAGGGAGCGCGGGAAGGTGCGGG - Intronic
1064587341 10:16852069-16852091 GAGGGAGGGAAAGATGATGGAGG - Intronic
1065883796 10:30059385-30059407 GGGGGAGTGCGGGAGGCTGCGGG + Intronic
1066247382 10:33596552-33596574 GGGGCAGAGCAGGATGCTCCAGG - Intergenic
1067140853 10:43655391-43655413 TCGGGAGGGCAGGAGGCTGGAGG + Intergenic
1067216611 10:44309434-44309456 GAGGGAGGGAAGGAGGTGGCGGG + Intergenic
1067295486 10:44973136-44973158 GAGGGAGGGGAGCAAGCTGTGGG - Intronic
1068919209 10:62465300-62465322 GAGGGAGGCCAGGGTACTGAGGG + Intronic
1069067238 10:63955375-63955397 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1069142246 10:64840576-64840598 GAGCGAGTGCAGGATTCAGCTGG - Intergenic
1069861278 10:71473174-71473196 CTGGGAAGGCAGGATGCTCCCGG + Intronic
1070256026 10:74813699-74813721 GAGGGCGAGCAGGAGGCGGCGGG + Intergenic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070569008 10:77626973-77626995 GAGGGAGGGCAGGAGGTAGAGGG - Intronic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1070725341 10:78783901-78783923 GAGGCAGGGCAGGCTGGGGCAGG - Intergenic
1070776529 10:79113103-79113125 AAGGCAGGCCAGGCTGCTGCGGG - Intronic
1070797423 10:79224724-79224746 GGGGAAGGCCAGGCTGCTGCAGG + Intronic
1070976494 10:80609690-80609712 GTGGGAGTCCAGGAGGCTGCAGG + Intronic
1071129051 10:82370366-82370388 GAGGGATGTCTGGATGCTGAGGG - Intronic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071786469 10:88905860-88905882 CAGGGAGGGCAGGAGGCTCAGGG + Intronic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072607651 10:96997991-96998013 AAGGGCGGGCCGGGTGCTGCTGG - Intergenic
1073047126 10:100646128-100646150 GAGGGAGGGGAGGAGGCTGGGGG + Intergenic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1073214378 10:101828558-101828580 GAGGGAGGGAGGGATTCTGGAGG - Intronic
1073561178 10:104498406-104498428 GGGGGAAGGCAGGATGATGTTGG - Intergenic
1074185729 10:111098217-111098239 GAGTGTGGGCAGGAGGCTGCAGG - Intergenic
1074728940 10:116347831-116347853 GAGGGAGGGAAGAATGGTGGAGG - Intronic
1075164236 10:120052531-120052553 CATGGAGGCCTGGATGCTGCTGG + Intergenic
1075336200 10:121610415-121610437 GAGGGAGGTCTGGATGCCTCTGG - Intergenic
1075396904 10:122134066-122134088 TAGATAGGGCAGGAAGCTGCAGG + Intronic
1075616447 10:123893481-123893503 GAGGGAGAGGAGGAGGCTGCTGG + Intronic
1076050221 10:127327449-127327471 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1076189073 10:128470215-128470237 GAGCGAGTGAAGGATGCAGCCGG + Intergenic
1076855925 10:133115625-133115647 GAGGGAGGCCAGGACCCCGCCGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1076996707 11:300566-300588 GAGGGAGGGCAGCTTGGTCCTGG - Intergenic
1077012747 11:386095-386117 GAGGGAGGCCAAGATGGAGCTGG + Intergenic
1077118450 11:896006-896028 GTGGGAGGGCAGGAGGCAGTAGG - Intronic
1077191661 11:1258251-1258273 GGGGGAGTGCAGGATGGTGGGGG + Intronic
1077278929 11:1733260-1733282 ATGGGAGGGCAGGAGGCGGCGGG - Exonic
1077340218 11:2023130-2023152 GCGGGAGGGCAGGACTCGGCAGG - Intergenic
1077484838 11:2833910-2833932 CTGGGAGGGCAGGAAGTTGCTGG - Intronic
1077555428 11:3223792-3223814 GAGGGTGCGCAGGACCCTGCTGG - Intergenic
1077651594 11:3978059-3978081 GAGGGAGGGCATGATAAAGCAGG + Intronic
1077897366 11:6463591-6463613 CAGGGAGGCCAGGACGCAGCTGG + Intronic
1077938726 11:6817830-6817852 GAGGCATGGCAGAAGGCTGCAGG + Intergenic
1078152558 11:8771823-8771845 GAGAGAGGGCAGGAGGGGGCCGG + Intronic
1078442539 11:11379296-11379318 GAGGGAGGTCAGGAGGCAGAGGG + Intronic
1079130497 11:17744424-17744446 GAGTGAGGACAGGATGAGGCAGG - Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079353500 11:19712824-19712846 AGGGGAGGACAGGCTGCTGCCGG - Intronic
1079506302 11:21156059-21156081 GACAGGGGGCAGGATGCTGATGG + Intronic
1080036827 11:27719708-27719730 GAGGGAGGGATGGAGGCTGGAGG + Intronic
1080139824 11:28903249-28903271 GATTTAGGCCAGGATGCTGCAGG + Intergenic
1080643172 11:34169825-34169847 GGGGGAGGGCAGGATGGGGACGG - Intronic
1081176680 11:39935704-39935726 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1083613197 11:64014139-64014161 GAGGAAGGGCAGGGTGCTGTGGG + Intronic
1083769595 11:64859082-64859104 GAGCGAGCACAGGCTGCTGCGGG - Intronic
1083990740 11:66244355-66244377 CAGGGAGGGAAGGAGCCTGCTGG - Exonic
1084046155 11:66568670-66568692 TAGGGAGAGCGGGAGGCTGCTGG + Intronic
1084047621 11:66579110-66579132 GAGGGAGGACTGGATTCTGAGGG + Intergenic
1084185115 11:67467431-67467453 GAGGGGGTGCAGGAGGCTGTGGG + Intronic
1084640256 11:70421590-70421612 GGGGGAGGGTAGGAGGCTGGTGG - Intronic
1084674212 11:70624711-70624733 GGGAGAGGCCAGGCTGCTGCTGG + Intronic
1084738925 11:71125534-71125556 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1084739770 11:71132086-71132108 GAGGCAGGTGAGGCTGCTGCCGG + Intronic
1084874939 11:72124262-72124284 GAGCAAGGGCAGGATCCAGCCGG + Intronic
1085011219 11:73142635-73142657 GAGGGAGGGCAGGAGGCGTCTGG - Intergenic
1085021768 11:73214505-73214527 AAGGGAAGGGAGGATGGTGCAGG + Intergenic
1085040801 11:73325226-73325248 GAGACAGGGCAGGAGGCTGGGGG - Intronic
1085228363 11:74943005-74943027 GAGGGAGGGCAGGCTCCTTCAGG + Intronic
1085311651 11:75520475-75520497 GAGGGAGGGGAGGATTCGGTGGG + Intronic
1085328640 11:75628256-75628278 GAGGGACTGCAGGATGCTGGGGG + Intronic
1085337380 11:75706487-75706509 GAGGGAGGAGAGGAGGCAGCGGG - Intergenic
1085513674 11:77100349-77100371 GAGGGAGGGGAGGAGGCAGAGGG - Intronic
1085641688 11:78196865-78196887 GAGGCAGGGCAGGATGGCGGCGG - Exonic
1085644226 11:78212889-78212911 GAGGGGGAGGAGGATGCTTCGGG + Intronic
1086220367 11:84436166-84436188 GAGGGAGGGGAGGATTGGGCTGG - Intronic
1089134295 11:116237013-116237035 GAGGATGGGCAGGATGTTGATGG + Intergenic
1089459103 11:118642329-118642351 GAGTGAGGGGAGGCTGCAGCGGG - Exonic
1089678532 11:120106671-120106693 AAGGCAGGGCAGGATCATGCCGG - Intergenic
1090271543 11:125389504-125389526 GAGGGAGTGAAGGATGAAGCCGG - Intronic
1202823203 11_KI270721v1_random:78319-78341 GCGGGAGGGCAGGACTCGGCAGG - Intergenic
1091458706 12:627993-628015 CAGGGCGGGGAGGATGCGGCAGG - Intronic
1091584361 12:1807620-1807642 GAGTGAGGGCTGGAGGCAGCAGG - Intronic
1091754213 12:3041141-3041163 CGGGGAGGGCAGGAGGCGGCAGG + Intergenic
1091769563 12:3142210-3142232 GAGGGAGGACAGCAGGCAGCGGG - Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092014402 12:5145830-5145852 TGGGGAGGGCAGGCTGCTTCAGG - Intergenic
1092124431 12:6065581-6065603 GAGGGAGGAGGGGAGGCTGCAGG - Intronic
1092145792 12:6213826-6213848 GAGGGAGGGAGGGAAGATGCTGG - Intronic
1092427049 12:8383125-8383147 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1092511233 12:9159006-9159028 GTGGAAGGGCAGGATGATGGAGG - Intronic
1092996915 12:13959354-13959376 GAGGGAGGTCAGGCTGCAGAGGG + Intronic
1093402073 12:18758493-18758515 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1093435396 12:19129924-19129946 GCGGGAGGGCAGGAGGCGGGCGG + Intronic
1093683516 12:22030399-22030421 GAGGGATGTCTGGATGCTGAGGG + Intergenic
1095159938 12:38904963-38904985 GTGGGTGGGGAGGAAGCTGCCGG + Intronic
1096159840 12:49367363-49367385 GCCGGACTGCAGGATGCTGCCGG - Intronic
1096179891 12:49544840-49544862 AGGGGAGAGCAGGATGCAGCGGG - Intronic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1096517582 12:52165630-52165652 GGAGGAGGGGAGGAGGCTGCTGG - Intergenic
1096751508 12:53761721-53761743 AAAGGAGGGAAGGATGCTGGAGG - Intergenic
1096847977 12:54418431-54418453 GGGGGAGGGGAGGATGAGGCTGG + Intronic
1097629510 12:62042891-62042913 GAGGAAAGGCAGGGTGCTGACGG - Intronic
1098216384 12:68224666-68224688 GAGGGAGGGAAGGAGGGTGGAGG + Intronic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1101241289 12:102842255-102842277 GAGGGAGAGGGGGATGATGCTGG + Intronic
1101625284 12:106434778-106434800 GAAGGAGGAAAGGATGCTGGAGG - Intronic
1101760032 12:107650989-107651011 GAGGGAGGGCAGGGTGGGCCCGG - Intronic
1102020619 12:109679843-109679865 GTGGGAGGGCAGGAAGCACCCGG - Intergenic
1102042754 12:109811072-109811094 GAGGGAGGGAAGGGTGTTGTAGG - Intronic
1102064651 12:109963856-109963878 GAGGGAGATAAGGATCCTGCAGG - Intronic
1102451489 12:113045040-113045062 GAGGGAGGGAAGGATGGAGGGGG + Intergenic
1102485377 12:113251907-113251929 GAGTGAGTCCAGGTTGCTGCAGG + Intronic
1102570606 12:113824982-113825004 GAGGGAGATCTGGGTGCTGCCGG - Intronic
1103918762 12:124388898-124388920 GAGGGAGGGAGGGACGCGGCGGG + Intronic
1103928430 12:124436354-124436376 GAGGTGGGGCAGGGGGCTGCAGG + Intronic
1103954525 12:124568701-124568723 GAGGGAGGGAGGGAGGCTCCAGG - Intergenic
1104301008 12:127565102-127565124 GAGTGAAGGGAGGATCCTGCTGG + Intergenic
1104647380 12:130506868-130506890 GAGGGAGGGAAGGATTCTCTAGG - Intronic
1104667887 12:130660437-130660459 GAGGAGGGGCAGGATTCTGGTGG + Intronic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1104866782 12:131960731-131960753 GAGGGAGCGAAGGGAGCTGCGGG - Exonic
1104877263 12:132044236-132044258 GAGGGAGGCCCGGCTGCGGCTGG + Exonic
1104981242 12:132573939-132573961 GAGGGAGGGCAGGCTGTCCCTGG + Intronic
1108373209 13:49791850-49791872 GGGGGAGGGTAGGATGCGCCAGG - Intronic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1110133310 13:72034592-72034614 GAGGTAGGGGATGATACTGCGGG - Intergenic
1110862772 13:80361913-80361935 GAGGGAGTGACGGAGGCTGCAGG - Intergenic
1111347263 13:86974760-86974782 GAGGGAGGCCAGGGGGCTGAAGG + Intergenic
1111620223 13:90715589-90715611 GAGGGAGGGAAAGATAATGCAGG + Intergenic
1111707896 13:91774496-91774518 GGTGCAGGGCAGGATGCTACAGG + Intronic
1112496600 13:99910540-99910562 AAGAGAGGGCTGGATGCTCCTGG + Intergenic
1112518944 13:100079596-100079618 GAGGGAGGGCAGGGATCTCCAGG - Intergenic
1112573168 13:100612081-100612103 GAGGCCGGGCAGGCTGGTGCAGG - Intronic
1112646381 13:101337654-101337676 GAGGGAGGTCACCATGTTGCAGG + Intronic
1112749532 13:102567936-102567958 GAGGGAGGTCAGTGTGCTGGAGG - Intergenic
1112848408 13:103672727-103672749 GAGTGTGGGCAGGAAGCAGCAGG - Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1113420213 13:110165266-110165288 GAGGGCTGGCATGAGGCTGCAGG - Intronic
1113584533 13:111455798-111455820 GAGAGAGGGAAGGATGATGAAGG + Intergenic
1113766265 13:112882685-112882707 GCGGCAGGGCTGGAAGCTGCCGG - Exonic
1113921557 13:113916003-113916025 ATGAGAGGCCAGGATGCTGCTGG - Intergenic
1113926467 13:113944375-113944397 GTGCCAGGGCAGGTTGCTGCTGG + Intergenic
1115307518 14:31947606-31947628 GAGAGAGGTCAGCATGCTGCTGG - Intronic
1116013927 14:39383848-39383870 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1116016501 14:39414270-39414292 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1117029065 14:51651312-51651334 GCGGGCGGGCAGGGGGCTGCAGG + Intronic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117771024 14:59134773-59134795 TAGGAAGGGCAGGAGGCTGCTGG + Intergenic
1117776531 14:59189405-59189427 GAGGGAGAGCAGGGTGTTGGCGG + Intronic
1117820030 14:59638683-59638705 GAGAGAGGTGAGGAAGCTGCAGG - Intronic
1118321995 14:64758744-64758766 GAGGGATGGCCAGATGCTGCTGG + Intronic
1118329227 14:64802759-64802781 GAGGCAGGGAAGCAGGCTGCTGG - Intronic
1118594787 14:67427120-67427142 GGGGGAGGGAGGGATGCTTCAGG + Intergenic
1118744398 14:68763311-68763333 GAGGGAGGGAAGGATGGAGGAGG - Intergenic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119657327 14:76426270-76426292 GAAGGAGGGCAGGAGTCTGTGGG + Intronic
1119705240 14:76779114-76779136 AAGGCAGGGCAAGAGGCTGCAGG + Exonic
1120590151 14:86364842-86364864 GTGGGAGGACAGGAAGCTCCAGG - Intergenic
1120732221 14:88016675-88016697 GAGGGAGGGGAGGATGGAACAGG - Intergenic
1121344983 14:93129027-93129049 CAGGCAGGGCTGGCTGCTGCTGG - Intergenic
1121410749 14:93746675-93746697 GGGGAAGGGCGGGAGGCTGCGGG + Intronic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1122148352 14:99707579-99707601 GATGGAGACCAGTATGCTGCTGG + Exonic
1122212615 14:100182446-100182468 GAAGGAGGGCAGAACTCTGCTGG + Intergenic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1122475973 14:102009173-102009195 CAGGGAGGGTGGGATGCTGAAGG + Intronic
1122505246 14:102227756-102227778 GAGGGAGGGCAGGCTGGAGGAGG - Intronic
1122604158 14:102937492-102937514 GAGGGAGGGAGGGATGCAGGCGG - Intronic
1122793715 14:104195267-104195289 GAGGCAGGGAAGGGTGGTGCGGG + Intergenic
1122819754 14:104335494-104335516 GAGGGAGGGCAGTTTGGTGCGGG - Intergenic
1122849964 14:104522789-104522811 GAGGGAGGCCAGCACACTGCAGG - Intronic
1123040949 14:105490092-105490114 GCCGGAGGGAAGGAGGCTGCGGG + Intronic
1123041949 14:105493936-105493958 GAGGGCGGGCAAGCTGCTGCGGG + Intronic
1123045602 14:105512149-105512171 GAGGGAGGGAAAGCTGCAGCTGG - Intergenic
1123704793 15:22943368-22943390 GCAGGAGGGCAGAAAGCTGCAGG + Intronic
1123885650 15:24725418-24725440 AAGGGAGGGAAGGAAGCAGCTGG - Intergenic
1123995131 15:25713097-25713119 GGTGGAGGTGAGGATGCTGCAGG - Intronic
1124025201 15:25959471-25959493 CAGGCAGGGCAGGATGCTTGGGG - Intergenic
1124227071 15:27903607-27903629 GATGGAGGGCAGGAAGCAGGGGG - Intronic
1124239038 15:28014896-28014918 CAGGGAGGCCCGGATGCTGATGG + Exonic
1124533078 15:30523066-30523088 CAGGAAGGGCAGGAGGCAGCAGG - Intergenic
1124765578 15:32484578-32484600 CAGGAAGGGCAGGAGGCAGCAGG + Intergenic
1125089628 15:35774939-35774961 GTTGGAGGGCAGGCTGCTCCCGG - Intergenic
1125304861 15:38299812-38299834 AAGGGAAGGCAGGATGTTACCGG - Intronic
1125685080 15:41559185-41559207 GAGGGCGGGGAGGAGGCGGCGGG - Exonic
1125897252 15:43312921-43312943 AAGGGAGGACAGGAGGATGCTGG + Intergenic
1126177066 15:45745707-45745729 CAGGGAAGGTAGGTTGCTGCTGG + Intergenic
1126940428 15:53759830-53759852 GAGGGAGGGAGGGAGGCAGCGGG - Intronic
1126979533 15:54226705-54226727 GAGGCAGGGCAGGCAGCTCCAGG + Intronic
1127483598 15:59399579-59399601 GAGGAAGGGCAGGGTGTTTCTGG + Intronic
1127810190 15:62559145-62559167 GAGGGAAGTCAGGCTGCTGGAGG - Intronic
1127934694 15:63625794-63625816 GAGGTTGGACATGATGCTGCTGG - Intronic
1128137693 15:65276097-65276119 CAAGGAGGGCAGGATGCAGCAGG - Intronic
1128683685 15:69668664-69668686 GAGGGTGGGCAGGAGCCAGCTGG - Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129228765 15:74184873-74184895 GAGGGAGGGAAGGGCTCTGCCGG - Intronic
1129234148 15:74213799-74213821 GGGGGAAGGGAGGCTGCTGCAGG + Intergenic
1129301851 15:74629999-74630021 GAAGGAAGGCAGGAGCCTGCAGG + Exonic
1129332127 15:74833133-74833155 GAGGGAGGGAAGGAAGGAGCAGG - Intergenic
1129517616 15:76166214-76166236 GGGGAGGGGAAGGATGCTGCGGG + Intronic
1129607968 15:77034069-77034091 GAGGGAGGCCTGGCTGCTGGAGG + Intronic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1129823988 15:78622249-78622271 CAGAGAGGGCAGGAGGCTCCAGG - Intergenic
1129932472 15:79423547-79423569 CAGGGAGTGCAGGATGGTGTGGG - Intronic
1130577674 15:85106749-85106771 GATGAAAGGCAGGCTGCTGCAGG + Intronic
1130662078 15:85838692-85838714 TTGGGAGGGCAGGGTGCAGCTGG - Intergenic
1130871258 15:87974042-87974064 AAGGGAGGGTTGGATGCCGCGGG - Intronic
1131155017 15:90069518-90069540 GAGAGAGGCCAGGATGCAACAGG + Intronic
1131394824 15:92077880-92077902 GAGGAAGTGCAGGATCCTGCAGG + Intronic
1132038728 15:98506781-98506803 CAGGGAGGGCCTGTTGCTGCAGG + Intronic
1132575118 16:660582-660604 GAAGGAGACCCGGATGCTGCTGG - Intronic
1132661991 16:1065758-1065780 GGGGGAGGGTCGGAGGCTGCCGG + Intergenic
1132664369 16:1074785-1074807 ATGGGAGGGATGGATGCTGCTGG + Intergenic
1132726114 16:1339053-1339075 GAGCGAGGGCAGGAGGGAGCGGG - Intronic
1132865534 16:2091194-2091216 GAGGGCGGGAGGGACGCTGCCGG + Intronic
1132888040 16:2191034-2191056 GGGGGAGGCCAGGATGCGGGGGG - Intronic
1133089715 16:3394704-3394726 GAGGCCGGGCAGAATGATGCTGG - Intronic
1133287976 16:4699331-4699353 CAGGCAGGGCAGGATGTTGCAGG + Intronic
1133304570 16:4801360-4801382 GAGGGAGGGCTGGGTGGTGGGGG - Intronic
1133371207 16:5247240-5247262 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1133717905 16:8466970-8466992 GAGGGAGGGACGGATGCGGGTGG + Intergenic
1134452787 16:14373669-14373691 GGGGGAAGGCAGGGAGCTGCTGG - Intergenic
1136473336 16:30496366-30496388 GAGGGAGGGAAGGATCGGGCTGG - Intronic
1136666730 16:31819383-31819405 GAGGGAGGGCAGCGCGCTGGGGG + Intergenic
1136862740 16:33712955-33712977 AAGGGAGGGCAGGGTGGAGCAGG - Intergenic
1136923891 16:34353326-34353348 GAGGAAGGGCAGGAAGCACCTGG + Intergenic
1136980683 16:35058480-35058502 GAGGAAGGGCAGGAAGCACCTGG - Intergenic
1137469548 16:48742488-48742510 GAAGGAGGGCAGGGTGGTGACGG - Intergenic
1137701502 16:50501214-50501236 GAGGAAGGAAAGGATTCTGCAGG + Intergenic
1138411184 16:56841620-56841642 GAGGGAGGGTGGGCTGCTCCAGG - Intronic
1138505577 16:57476730-57476752 GAGGGAAGGCACCATGCTGTGGG - Intronic
1138538868 16:57676158-57676180 GGGGGAGGGTAGGATCCTGCAGG - Intronic
1139548872 16:67662553-67662575 CAGGGAGGGCAGAGAGCTGCGGG - Exonic
1139787343 16:69404531-69404553 GAGGGAGAGCTGGAAGCAGCTGG + Intronic
1140676898 16:77341048-77341070 GAGGGAGGGCAGGTTGCATTTGG - Intronic
1141440281 16:84025630-84025652 GAGGGAGGCCTGGTGGCTGCTGG - Intronic
1141897057 16:86964913-86964935 GAGGGAGGGCAGGCAGGGGCCGG - Intergenic
1142146848 16:88496344-88496366 GAGGGAGGGCAGAGTGGGGCTGG + Intronic
1142178867 16:88657615-88657637 CAGGGCGGGCAGGGTGCTGACGG - Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359299 16:89619141-89619163 GCGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359314 16:89619171-89619193 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359340 16:89619232-89619254 GTGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359355 16:89619262-89619284 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359368 16:89619292-89619314 GCGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359383 16:89619322-89619344 GCGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359547 16:89619706-89619728 AAGGGAGTGCAGGGGGCTGCAGG - Intronic
1142359569 16:89619769-89619791 GAGGGGGTGCAGGGGGCTGCAGG - Intronic
1142594496 17:1022942-1022964 TGGGGAAGGCAGGTTGCTGCGGG - Intronic
1142772212 17:2106642-2106664 GAGAGAGGGAAGGAGGATGCTGG + Intronic
1142953076 17:3500129-3500151 GAGAGAGGTGAGGAAGCTGCAGG + Exonic
1142986299 17:3697095-3697117 GAGGGAGGTCTTCATGCTGCCGG - Intergenic
1142994711 17:3753772-3753794 GAGGGAGAGCAGGTACCTGCTGG - Exonic
1143443961 17:6996326-6996348 GCGGGAGGGCGGGAGGCTGGGGG + Intronic
1144038919 17:11391216-11391238 GAGGGTGGGCAGGAAGGTGATGG + Intronic
1144261124 17:13521942-13521964 GAGGGAAGGGAGGTTGCTACTGG - Intronic
1144693906 17:17288268-17288290 GAGGGGGAGGAGGATGCTGAAGG + Intergenic
1144729271 17:17517445-17517467 GAGGGAGGGCATGGAGCTGATGG - Intronic
1144853649 17:18256714-18256736 GAGTGAGGGAGGGAAGCTGCAGG - Intronic
1145046311 17:19619703-19619725 AAGGTAGGGCAGGGTGCTGAGGG - Intergenic
1145124249 17:20287018-20287040 GAGGCAGGGGAGGCTGCTGACGG - Intronic
1145374890 17:22338135-22338157 GATGCAGGGCAGCATGCTGAGGG + Intergenic
1147135541 17:38431924-38431946 AGGGGAGGGCAGGGAGCTGCAGG + Intronic
1147220406 17:38925503-38925525 GTGGGGGGGCAGGAAGCTGCTGG + Intergenic
1147265058 17:39229604-39229626 GAGCGAGGGCCAGGTGCTGCCGG + Intergenic
1147604902 17:41769040-41769062 GAGGTTGTGCAGGATGCTGGTGG + Exonic
1147651997 17:42068062-42068084 CAGGCAGGGCAGGCTGCAGCAGG - Intergenic
1147671868 17:42181045-42181067 GAGGGAGGGGAGGAGGCAGGAGG - Exonic
1147684731 17:42280317-42280339 GAGAGAGGGGAGGAGGCTGTAGG - Intergenic
1147816351 17:43213420-43213442 GAAGGAGGGCAGGTTTTTGCAGG - Intronic
1147948090 17:44091804-44091826 GAGGGAGGGCTCGGTGCTGAGGG + Exonic
1148220424 17:45858008-45858030 GAGGGAAGGCTGGATGCAGATGG - Intergenic
1148228122 17:45913610-45913632 GAGGGAGGGGCAGATGCTACAGG + Intronic
1148862905 17:50613861-50613883 AAGGGAGGACAGGAGGCTACGGG - Intronic
1148909139 17:50931201-50931223 GAGGGAGGGCGGGCTGAGGCGGG - Intergenic
1149659193 17:58325557-58325579 GCGGGAGTGCAGGGAGCTGCAGG - Exonic
1149855364 17:60078402-60078424 GAGGGAGTGAAGGAGGGTGCGGG + Intronic
1149895070 17:60422662-60422684 GAGGGAGGGAAGGAGGGTCCCGG + Intronic
1150227308 17:63531038-63531060 CAGGCAGGGCAGGATGAGGCTGG + Intronic
1150245389 17:63670840-63670862 AGGGGAGGGCAGGATGAAGCTGG + Intronic
1150975681 17:70083978-70084000 GAGGGAGGGTACTGTGCTGCTGG - Intronic
1151536515 17:74741952-74741974 GCTGGAGGGCTGGTTGCTGCTGG - Intronic
1151852366 17:76698418-76698440 CAGGGAGGGCAGGCTGGGGCAGG + Intronic
1151999447 17:77636380-77636402 GAGAGAGTGCAGGATGGGGCAGG + Intergenic
1152054523 17:78013329-78013351 GAGAGAGGGCTGGAGGCAGCAGG + Intronic
1152095311 17:78268845-78268867 GAGGGAGCCCAGGATTCTGGCGG - Intergenic
1152456923 17:80422010-80422032 GGGGGAGGGAAGGCTGCTGCAGG + Intronic
1152528305 17:80902304-80902326 GACGGGGGGCAGGAGGCTGAAGG - Intronic
1152560288 17:81075279-81075301 GAGGGAGGTGAGGATGGTCCCGG - Intronic
1152717582 17:81907360-81907382 GAGGGAGGGCAGGCGGGTGGTGG - Intronic
1152922300 17:83072242-83072264 GAGTCAGGGCAGGAGGCTGGGGG - Intergenic
1153133137 18:1880966-1880988 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
1153715214 18:7840091-7840113 GGGGGAGGGCAGGGTGATGGGGG + Intronic
1153836593 18:8969490-8969512 AAGGAAGGGCAGGAGGCAGCTGG + Intergenic
1154106637 18:11529175-11529197 GAGTGAGGGCATCATGTTGCGGG - Intergenic
1154322668 18:13367612-13367634 GAGGGTGGGCAAGCAGCTGCAGG + Intronic
1154341690 18:13508187-13508209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1155384845 18:25266591-25266613 GACGGAGGGCAAGCTGATGCAGG + Intronic
1155451540 18:25968947-25968969 GAGGAGGGGCAGGATAATGCTGG - Intergenic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157404573 18:47412250-47412272 GAGGGTGGGCATGAGGCTGGGGG - Intergenic
1157749103 18:50162273-50162295 GAGGGAGGGAGGGATGGTTCAGG - Intronic
1158278204 18:55791910-55791932 GTGGGAGGGCAGGATGGGGAGGG - Intergenic
1158409610 18:57193761-57193783 GAGGGAGGGCAGGGCGAGGCTGG - Intergenic
1158457540 18:57621554-57621576 GAGGGAGGGAGGGAGGGTGCTGG - Intronic
1159215000 18:65381151-65381173 AAAGGAGGGCAGAATGCAGCAGG - Intergenic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1159798422 18:72868979-72869001 GAGGGAGGGCGGGACGGAGCCGG - Intergenic
1160156198 18:76435813-76435835 GACCGAGGTCAGGAAGCTGCAGG - Intronic
1160252661 18:77216996-77217018 GAGAGAGGGGAGAATGCTGATGG - Intergenic
1160546108 18:79657093-79657115 GAGGGATGGCAGGATGGAGATGG + Intergenic
1160812208 19:1017725-1017747 GAGAGCGGGCAGGCTGCTCCTGG - Intronic
1160875454 19:1294491-1294513 GAGGGAGACCAGGAGGCCGCCGG + Intronic
1160917319 19:1503453-1503475 GAGGGAGGGCAGTGGGGTGCCGG + Intergenic
1161154867 19:2727354-2727376 GAGGGAGCACAGGCTGCTGCAGG - Intronic
1161322346 19:3647064-3647086 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322368 19:3647136-3647158 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322377 19:3647170-3647192 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322393 19:3647220-3647242 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322404 19:3647258-3647280 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161419975 19:4171402-4171424 GATGGAGGGGAGGATGATGAGGG - Exonic
1161739076 19:6009333-6009355 GAGGGAGGGCAGGGGGGTGGGGG - Intronic
1161849593 19:6731568-6731590 GAGGGAGGGGAGGGGGCTGGGGG + Intronic
1162007301 19:7788748-7788770 GAGGGAGGCGAGGATGGGGCGGG - Intergenic
1162463797 19:10829306-10829328 CAGGGAGGGCAGGAACCTGCAGG - Intronic
1162826957 19:13258696-13258718 GAGGGAGGTGAGGATGCTGAGGG + Intronic
1163012418 19:14433973-14433995 CTGGGAGGGGAGGAGGCTGCTGG + Intronic
1163029495 19:14534975-14534997 AAGGGAGGGCGAGGTGCTGCGGG + Intronic
1163272519 19:16262714-16262736 GTGGGAGGGCAGGACCCAGCTGG + Intergenic
1163323467 19:16587977-16587999 GTGGGAGGGAAGGACGCTGTGGG - Intronic
1163418360 19:17200614-17200636 GAGGGGGGACAGGAAGCAGCCGG - Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163582985 19:18149338-18149360 CGGGGAGGGCGGGATGCTGCTGG - Exonic
1163679541 19:18672695-18672717 GAGGCTGGGCACGTTGCTGCTGG - Intergenic
1164526908 19:29019513-29019535 GTGGGAGGGCTGGACGCTGAGGG + Intergenic
1165100977 19:33438568-33438590 GGGGGCGGGCAGGGTTCTGCTGG + Intronic
1165133628 19:33649475-33649497 GAGGGAGGGCAGGGTGGAACAGG + Intronic
1165213834 19:34255012-34255034 GAGGGAGGGCGGCCTGCTGGCGG + Intronic
1165700530 19:37933723-37933745 GGCAGAGGGCTGGATGCTGCAGG - Intronic
1165707686 19:37988091-37988113 GAGGTAGGGCAGGAGCCAGCAGG - Intronic
1165873497 19:38989597-38989619 GAGGGAGGGCTGCATGCAGTAGG - Intergenic
1165924925 19:39320897-39320919 GAGGGAGGGCGGGAGGCGGGAGG - Intergenic
1166068899 19:40376568-40376590 GAGGTGGGGCAGGATGCAGAGGG - Intronic
1166352677 19:42207485-42207507 GAGGGAGGGGAGGAGGCCCCTGG - Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166751702 19:45166947-45166969 GAGGGAGGGATGGAGGCAGCTGG - Intronic
1166950987 19:46427990-46428012 GAGCGAGGGCAGGACGGTGGAGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167521486 19:49958578-49958600 GAGGGAGGACAGGACTCAGCAGG + Intronic
1167523889 19:49972143-49972165 GAGGGAGGACAGGACTCAGCAGG - Intergenic
1167649937 19:50723651-50723673 GAGGGAGGCCCTGATGCTGAAGG + Exonic
1167751100 19:51380645-51380667 GAGAGAGGGCGGGAGGATGCAGG + Intronic
1167756175 19:51415116-51415138 GAGGGAGGACAGGACTCAGCAGG + Intronic
1168316460 19:55486746-55486768 GGGCGTGGGCAGGAGGCTGCTGG + Exonic
1168691910 19:58382385-58382407 GAGGGCGAGCAGGAGGCTGAAGG + Intergenic
1168695490 19:58401633-58401655 GATGGGGGACAGGAGGCTGCGGG + Intronic
925326077 2:3023091-3023113 GAGTGAGGACAGGAAGCTGTTGG + Intergenic
925906921 2:8545168-8545190 GAAGGCGGGGAGGATGCTGTGGG + Intergenic
927075932 2:19577620-19577642 AAAGGATGGCAGGATGATGCAGG + Intergenic
927109795 2:19856404-19856426 GAGTGAGGTCAGGAGGCTGGTGG - Intergenic
927454849 2:23240629-23240651 GAGGGAAGGGAGGATCTTGCAGG - Intergenic
927472282 2:23385425-23385447 GAGGGCGGGGGCGATGCTGCCGG + Exonic
927487363 2:23497653-23497675 GAGGCAGGGAAAGATGCTCCTGG - Intronic
927815138 2:26209134-26209156 TAGGGAGGGAGGGATGCTACTGG - Intronic
927847095 2:26477255-26477277 GCAGCAGGCCAGGATGCTGCGGG - Exonic
928112479 2:28521933-28521955 CAGGGAGTGCAGGCTGCTGCAGG - Intronic
928314800 2:30236818-30236840 GAGGGAGGGCAGACTGGGGCTGG + Intronic
928401115 2:30979405-30979427 GAGGCAGGGCAGGAAGGTGTGGG + Intronic
928623138 2:33111439-33111461 GTGACAGGGCAGGAAGCTGCTGG - Intronic
929841592 2:45470700-45470722 GAGTGAGAGCAGGATGATGCAGG - Intronic
930831377 2:55747251-55747273 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
930874920 2:56204532-56204554 GAGGAAGGGCAAGAAGCTGGAGG - Intronic
931387566 2:61810919-61810941 GAGGTAGGCCAGGAGGATGCAGG + Intergenic
931461997 2:62457386-62457408 GAGGAAGGGCTGGGTGCGGCGGG + Intergenic
931863155 2:66378615-66378637 GAGGGAGAGCAGAATGGTCCAGG - Intergenic
932177778 2:69618675-69618697 GAGGGAAGCCAAGATGCTACAGG - Intronic
932417099 2:71580129-71580151 GTGGGAGGATTGGATGCTGCTGG + Intronic
932496430 2:72147914-72147936 GGGGGAGGGGAGGCTGCGGCCGG + Exonic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933376037 2:81481410-81481432 GTGGCAGGGCAGGAAGCTCCAGG + Intergenic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934171230 2:89542564-89542586 GGGGAAGGGCAGGGTGCTGTGGG + Intergenic
934281536 2:91616882-91616904 GGGGAAGGGCAGGGTGCTGTGGG + Intergenic
935943667 2:108267664-108267686 GAGGTCGGGCAGGATGCAGGGGG - Intergenic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
936499122 2:113051710-113051732 GAGGGAGTCCTGGATGCAGCTGG + Intronic
936559867 2:113528013-113528035 AAGGGAGCCCAGGATGGTGCAGG + Intergenic
936563307 2:113560862-113560884 GAAGGAGGGCAGGAGGGTGATGG + Intergenic
937331995 2:121037522-121037544 GAGGGAGGGGAGGATGAGGGTGG - Intergenic
937904101 2:127043611-127043633 GCGGGAGGGCGGAATGCAGCCGG - Intergenic
937909898 2:127070408-127070430 GAGGGAGGGCAGCTTGCCCCAGG + Intronic
937987298 2:127643840-127643862 AAGGGAGGCCTGGATGCAGCAGG - Intronic
938070507 2:128305843-128305865 CAGGGAGTCCAGGATGGTGCAGG - Intronic
938409758 2:131054384-131054406 GAGGGAGGGCAGCAGGCACCAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938746863 2:134287514-134287536 GAGTGAGGGCTGGCAGCTGCTGG + Intronic
939193548 2:138944681-138944703 GAGAAAGGGCTGGATCCTGCTGG - Intergenic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
940073055 2:149710977-149710999 GCTGGAGGGCAGGATGGTGCTGG + Intergenic
940220352 2:151345143-151345165 GAGGAAGGGCAGTATCCTGGAGG - Intergenic
940883269 2:158968369-158968391 GAGGGATGGTAGGGTGCTTCAGG + Intergenic
941003046 2:160221424-160221446 GAGAGATGGCTGGCTGCTGCTGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941166831 2:162091833-162091855 GAGGGAGAGCATGATGCAGAAGG - Intergenic
941834771 2:170004480-170004502 GGGAGAGGGCAGGATGCTGAAGG + Intronic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
942680981 2:178478505-178478527 GAGGGAGAGCAGTGTTCTGCTGG - Exonic
943060591 2:183038314-183038336 GGCGGAAGGCAGGAGGCTGCCGG - Exonic
943247374 2:185473145-185473167 GAGGGAGGCCAGGGGGCTGAGGG + Intergenic
944216844 2:197264691-197264713 CAGAGATGGCAGGATGCTCCTGG + Intronic
944225328 2:197343780-197343802 GAGAGAGAGCAGGATGAGGCAGG + Intergenic
946041942 2:216790328-216790350 AAGGGAGGGCAGAGTGCAGCTGG + Intergenic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946228535 2:218277711-218277733 GAAGGAAGGCAGGGTGCTGGGGG + Intronic
946335127 2:219030980-219031002 GGGGGAGGGCAGGAGGCCGGTGG + Intronic
946416111 2:219540551-219540573 GAGGCCGGGCGGGATGGTGCTGG + Exonic
947527152 2:230885680-230885702 CAGGGATGGCAGGAAGCTGTAGG + Intergenic
947669177 2:231925897-231925919 AAGGGAGGGCAGGGGGCTTCCGG - Intronic
947739610 2:232479149-232479171 GAGGAAGGGCAGGTGCCTGCTGG + Intergenic
947740992 2:232484923-232484945 GAGGGAGGGCATCATGGAGCAGG - Intronic
947750665 2:232530299-232530321 GAGGGAGGGCTGTATGATTCTGG + Intronic
947777790 2:232728120-232728142 GAGGGAGGTCAGGCTTCTGGGGG + Intronic
948372134 2:237496130-237496152 GAGACAGGGCAGGATGCACCTGG - Intronic
948725381 2:239930813-239930835 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948725413 2:239930899-239930921 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948792828 2:240388163-240388185 GAGGGAGGCCAGGATGGGTCAGG - Intergenic
948843516 2:240672108-240672130 CAGGGAGGGGAGGTGGCTGCAGG + Intergenic
948955088 2:241283224-241283246 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
949017170 2:241720079-241720101 GAGGGACAGGAGGATGGTGCAGG + Intronic
1168842243 20:916913-916935 GAGGGAGGGGAGGAGGCAGAGGG + Intergenic
1169254106 20:4084176-4084198 TAGGGATGGCAGGAGGCAGCAGG + Intergenic
1169404875 20:5314912-5314934 CAGGAGGGCCAGGATGCTGCGGG + Intergenic
1170549296 20:17462532-17462554 GGGGGAGCTCAGGATGCTGAGGG - Intronic
1170682761 20:18541164-18541186 GAGAGAGGTAAGGAAGCTGCAGG - Intronic
1170763944 20:19274497-19274519 GAAGGAGAGGAGGATGCTGGAGG - Intronic
1170780610 20:19422318-19422340 GAGAGAGGGCAGGCTGCTACTGG + Intronic
1170965490 20:21066260-21066282 TAGGGTGGGGAGGATGCTACTGG + Intergenic
1171188580 20:23141843-23141865 GATGGTGGGCAGGAGGCTGGAGG - Intergenic
1171990661 20:31694060-31694082 GTGGGAGGGCAGGCAGCAGCTGG + Intronic
1172484660 20:35291100-35291122 GAAGGAGGAGAGGAGGCTGCTGG - Intronic
1172487135 20:35305084-35305106 CAGGGAGGGCAGAGTGCTGAAGG - Intronic
1172556831 20:35849452-35849474 GAGGCAGGGCAGGATGGTGCAGG + Intronic
1172628707 20:36363953-36363975 GCAGGAGGGAAGGGTGCTGCAGG + Intronic
1172830984 20:37834215-37834237 GAGGGAGGGCTGGGTGCTGGTGG - Intronic
1173009852 20:39172079-39172101 GAGGGAGGATAAGATGCAGCAGG + Intergenic
1173049041 20:39541331-39541353 GAGTCAGGGCTGCATGCTGCAGG - Intergenic
1173658000 20:44714393-44714415 GAGAGAGGGCAGAATGTTCCAGG - Intergenic
1173684982 20:44916888-44916910 GAGGGAGGGGCGGAGGCTGCAGG + Intronic
1173912979 20:46684038-46684060 GAGGCGGGGCCGGATCCTGCAGG - Intronic
1174050791 20:47766026-47766048 GGTGGAGGACAGGATGCTTCAGG + Intronic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175176004 20:57112516-57112538 AAGGGAGGACATGGTGCTGCTGG - Intergenic
1175224834 20:57439130-57439152 GGGGCAGGGCAGGAGGCTGGGGG - Intergenic
1175265658 20:57701977-57701999 GAGGAAGGCCAGGGTGCTCCTGG + Intronic
1175310873 20:58010929-58010951 GAGGGACGGCTGAAGGCTGCAGG - Intergenic
1175901953 20:62363489-62363511 GATGCAGGCCAGGATTCTGCTGG - Intronic
1175978431 20:62725264-62725286 CAGGGAGGCCAGAATGATGCTGG - Intronic
1175984112 20:62755589-62755611 GAGGGAGGGAGGGATGATGGAGG - Intronic
1176112063 20:63415392-63415414 GAGGGAGGGGGGGAGGCTACCGG + Intronic
1176136324 20:63523568-63523590 GAGGCAGGGGACGATGCCGCGGG - Intergenic
1176363990 21:6021581-6021603 CTGGGAGGGCAGGCTGCAGCCGG + Intergenic
1177046150 21:16172742-16172764 GAGAGAGGCGAGGAAGCTGCAGG - Intergenic
1178794028 21:35726991-35727013 GGAGGAGGGTAGGATGGTGCAGG - Intronic
1179189005 21:39107583-39107605 GAGGGAAGGCAGCCTGATGCTGG + Intergenic
1179415998 21:41199297-41199319 GAGGGAGGGTAGGAAGGCGCAGG - Intronic
1179519408 21:41932243-41932265 CAGGCAGGGCATGAAGCTGCTGG + Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179759528 21:43516964-43516986 CTGGGAGGGCAGGCTGCAGCCGG - Intergenic
1179891637 21:44338687-44338709 GAGGGAGGGGAGGAGGCCGGGGG - Intronic
1180075112 21:45458114-45458136 GAGGGAGGGAGGGCTGCAGCGGG + Intronic
1180211512 21:46297662-46297684 GCGGGAGGGGTGGAGGCTGCGGG + Exonic
1180754028 22:18147897-18147919 CAGGGAGGGCAGGGTGCTGGTGG - Intergenic
1181047599 22:20222980-20223002 GAGGGAGAGAGGGAGGCTGCAGG + Intergenic
1182021537 22:27085783-27085805 GAGGAAGGGGAGGATGCAGAGGG - Intergenic
1182278645 22:29205890-29205912 GAGGGCGGGCAGGAGGCGGGCGG - Exonic
1182486342 22:30641302-30641324 GAGGGAGGGAAGGAGGGAGCTGG - Intronic
1182567913 22:31213276-31213298 TGGGGAAGGCAGGAAGCTGCAGG - Intronic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1182586470 22:31346628-31346650 GAGGGGGGGCAGGAAGCGGGGGG - Intergenic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183498877 22:38166242-38166264 GTGGAAGGGCAGGATGCAGAAGG - Intronic
1183585482 22:38750791-38750813 GAGAGAGGGCAGCATGTGGCAGG - Intronic
1183636106 22:39063786-39063808 GAGGGAGGGCTGGGTGCTCTTGG - Intronic
1183650338 22:39150023-39150045 TAGGGAGGGCAGTATGGGGCGGG - Intronic
1183748804 22:39707476-39707498 GCAGGAAGGCAAGATGCTGCAGG - Intergenic
1183751491 22:39723591-39723613 GAGGGAGGGCAGGAGGCAGAAGG - Intergenic
1183930228 22:41231816-41231838 GAGGCAGGGCAGGTTCCTGAAGG - Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184201163 22:42970930-42970952 GGGGCAGGGCAGGGTGGTGCAGG - Intronic
1184217483 22:43077312-43077334 GATCGAGGGCAGCATGCTGCAGG - Intronic
1184441818 22:44521587-44521609 GAGGCAGGGCTTGAAGCTGCCGG - Intergenic
1184510453 22:44930260-44930282 GAGGGAGAGGAGGAAGCTGGAGG + Intronic
1184671466 22:46014102-46014124 GAGGGAGGGAAGGTGGCCGCGGG - Intergenic
1185031893 22:48448441-48448463 ATGGGAGGGCAGGCTGCTGTTGG - Intergenic
1185050884 22:48553425-48553447 GAGGGAGGGAAGCAGGATGCAGG + Intronic
1185157616 22:49203647-49203669 GAGAGAGGGCAGGTTGGAGCAGG - Intergenic
1185335236 22:50268316-50268338 GAGGGAGGCCCGTCTGCTGCAGG - Intronic
949943780 3:9174478-9174500 GAAGGAGAGCAGGAGACTGCGGG + Intronic
949959792 3:9302487-9302509 GAGCTAGGTCAGGATGCCGCAGG + Intronic
950096763 3:10335175-10335197 AAAGGAGGGCAGGATGCTGAAGG + Intronic
950221041 3:11196293-11196315 GAGGGAGGAAAGGGTGCTCCAGG - Intronic
950613187 3:14139142-14139164 GGGGCAGGTCAGGATGCTGAGGG - Intronic
950647441 3:14385686-14385708 GAGGAATGGCAGGAGGCTGAAGG - Intergenic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
952839338 3:37630938-37630960 GAGGCAGGGCAGGAAGCTGATGG + Intronic
952908315 3:38159101-38159123 GAGGGAAGGTAGGATGATTCTGG - Intergenic
954747564 3:52795656-52795678 GGGGCAGGGCAGGATGGAGCTGG + Intronic
954963933 3:54593462-54593484 GAGGGAGGGAAGGAAGGTGAAGG + Intronic
954984401 3:54776803-54776825 GAGGAAGGGCAGCATCCTCCAGG - Intronic
956163105 3:66375187-66375209 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
959597454 3:108143745-108143767 GAGGGAGAGCAGGCTGCCCCAGG + Intergenic
960019425 3:112932554-112932576 GAGTGAGGGCATGGGGCTGCTGG - Intronic
960327217 3:116312450-116312472 GAAGGAGGGGAGCATGCTACTGG - Intronic
960378331 3:116930118-116930140 GATGGCAGGCAGGATGGTGCGGG + Intronic
960622992 3:119654310-119654332 GAGGTAGGGTAGGAAGATGCTGG - Intronic
960639911 3:119814764-119814786 AGGGGAGGAGAGGATGCTGCGGG + Intronic
960702577 3:120451633-120451655 GAAGGAGGGGATGAGGCTGCCGG - Intergenic
960812255 3:121636327-121636349 GAGGGAGGGGACGGTGGTGCTGG - Intronic
960844501 3:121993789-121993811 CAGGGAGGACAGCATGCTGCAGG + Exonic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961314212 3:126023419-126023441 CAGGGAGGGCAGGAGGGAGCTGG + Intronic
962277992 3:134030139-134030161 GAGGGAGGGAAGGAGGTGGCGGG + Intronic
962281064 3:134052260-134052282 GAGGGAGGAGAGGGTGGTGCAGG - Intergenic
962346187 3:134620466-134620488 GACAGAGGGAAGGCTGCTGCTGG + Intronic
963084277 3:141422290-141422312 GAGGTGGGGCAGGATGCAGGAGG - Intronic
963102709 3:141622010-141622032 GAGGGAGGTGGGGAAGCTGCTGG + Intergenic
964678000 3:159305087-159305109 GAGGCAGGACAGGGGGCTGCTGG - Intronic
967073274 3:185980641-185980663 GAGCGGGGGCAGGAAGCTGGAGG + Intergenic
967390201 3:188947800-188947822 GGGGGTGGGGAGGAGGCTGCAGG - Intronic
968138779 3:196238855-196238877 GGGGAAGGGCCGGATGCTGCAGG - Exonic
968478521 4:824062-824084 GTGGGAGAGCAGGATGCAGGTGG - Intronic
968540445 4:1165565-1165587 GAGGGAGGGCAGGTGGATCCAGG + Intergenic
968648490 4:1751297-1751319 GTGGGAGGGTAGGACCCTGCAGG - Intergenic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
968809065 4:2792102-2792124 GAGGAAGGACAGGATCTTGCTGG - Intergenic
969015346 4:4100131-4100153 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
969028539 4:4193324-4193346 GGGGAAGGGCAGGGTGCTGTGGG - Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969154137 4:5195325-5195347 GAGGAAGGGGAGGAGGCAGCAGG - Intronic
969315600 4:6379939-6379961 GAGGGAGGGGAGGAAGCCGGGGG - Intronic
969405607 4:6989518-6989540 GAGGAAGGGCAGGATGCCTGAGG - Intronic
969457545 4:7308698-7308720 GAGAGAGGACAGGGTGCTGGTGG - Intronic
969487243 4:7479153-7479175 GAGAGAGGGCAGCTGGCTGCTGG - Intronic
969487275 4:7479338-7479360 GAGGGAGGGCTGGAGGCTCAGGG - Intronic
969659541 4:8518425-8518447 AAGGGAGGGCGGGAAGCTGCTGG + Intergenic
969720708 4:8891938-8891960 GAGATAGGGCAGGACGCAGCCGG - Intergenic
970418639 4:15883701-15883723 GAGAGAGGGAAGGATGAGGCAGG + Intergenic
972602092 4:40581856-40581878 GAGGGAGGTCTGGTTGCTCCTGG - Intronic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975590280 4:75992859-75992881 CTGGGAGGGCAGGGTGCAGCAGG + Intergenic
976207913 4:82639802-82639824 GAGGAAGGAGAGGAAGCTGCTGG - Intronic
976729262 4:88245411-88245433 GTGGCAGGGCAGGAAGCTCCAGG - Intergenic
977762225 4:100752533-100752555 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
977787254 4:101051035-101051057 GAGAGCAGCCAGGATGCTGCTGG + Intronic
978620999 4:110634115-110634137 GAGGCGGGGCAGGGAGCTGCGGG + Intronic
979946913 4:126843721-126843743 GTGGCAGGGCAGGAAGCTCCAGG - Intergenic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
980980686 4:139652245-139652267 TTGGGAGGGCAGGAGGGTGCAGG + Intergenic
981147635 4:141343614-141343636 GAGGGAAGCCAGGATGCAGGTGG + Intergenic
982036358 4:151349814-151349836 GAGAGAGGTAAGGAAGCTGCAGG + Intergenic
983692092 4:170482649-170482671 GCTGGAGCGCTGGATGCTGCTGG - Intergenic
984757263 4:183336574-183336596 GAGGAAGGGCAGGGTGCTATGGG + Intergenic
985783194 5:1881445-1881467 GAGGGAGGCCAGGAGCCTGAAGG + Intronic
985889669 5:2705710-2705732 GAGTGAGGGGAGGGTGGTGCAGG + Intergenic
985889713 5:2705952-2705974 GAGGGAGGGGATGGTGGTGCAGG + Intergenic
985908910 5:2863939-2863961 GAGGGAGGCCTGGATGATGTCGG - Intergenic
985956707 5:3271107-3271129 AAGGGAGGGAAGGGGGCTGCTGG - Intergenic
985969556 5:3364274-3364296 AAGGGAGGGAAGGATGATGCAGG + Intergenic
986357792 5:6945605-6945627 GAGGGAGGGCAGGAGGCATGGGG - Intergenic
986675739 5:10183609-10183631 GTGGGAGGGCAGGAGGCTAGGGG + Intergenic
986736588 5:10672958-10672980 CAGGGATGGCAGGAAGCTGGAGG - Intergenic
986742439 5:10715727-10715749 GAGAAAGGGCAGGCTGCTGTAGG + Intronic
986859031 5:11904535-11904557 GAGAGAGGGGAGGAGGCCGCGGG + Intergenic
988785808 5:34564608-34564630 GAGGGAGGGGAAGAGTCTGCTGG + Intergenic
990113784 5:52363271-52363293 GAGGGAGGATAGTATGCTCCAGG - Intergenic
990347547 5:54884474-54884496 GAGTGAGGGCAGCAGGCTGGAGG + Intergenic
992362907 5:76060537-76060559 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
992457251 5:76927268-76927290 GAGGTAGGGCCAGATGCTGAGGG - Intergenic
994760951 5:103853345-103853367 GAGAGAGGTGAGGAAGCTGCAGG - Intergenic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
995725749 5:115179357-115179379 TAGGGAGGGGAAGATGCTGGAGG - Intronic
996321587 5:122222796-122222818 CAGGAATGGCAAGATGCTGCCGG - Intergenic
996531648 5:124533571-124533593 GAGTGAGGGGAGGATCCTTCTGG - Intergenic
997284322 5:132667580-132667602 GAGGGAGAGCAGGAAGTCGCAGG - Intergenic
997577202 5:134989584-134989606 GAGAGAGAGAAGGAGGCTGCCGG - Intronic
997622144 5:135305813-135305835 GAGGGTGGGGAGGGTGTTGCTGG + Intronic
997634893 5:135398249-135398271 GTGAGTGTGCAGGATGCTGCTGG - Intronic
997721408 5:136080813-136080835 GAGGGGAGGCAGGAGGGTGCGGG + Intergenic
997756557 5:136405180-136405202 GAGGGAGGGAAGGAGGAGGCAGG - Intergenic
998352021 5:141508120-141508142 GAGGGAGGTCAGGGAGCTGGGGG + Intronic
998676133 5:144410016-144410038 GAGGAGGGGAAGGATGCTCCAGG + Intronic
999176203 5:149633298-149633320 GGGGGAGGGCAGCATGCCGGGGG - Exonic
999184993 5:149700629-149700651 GATGGGGGGCAGGGTGCTTCTGG + Intergenic
1000334884 5:160234831-160234853 GATGGAGGGCGGGAAGCTGGTGG + Exonic
1000386023 5:160675478-160675500 GAGGGAGGAGAGGATGCTGAAGG + Intronic
1000649229 5:163795620-163795642 GAAGAAAGTCAGGATGCTGCAGG - Intergenic
1001106446 5:168858610-168858632 GAGGGAGCTCAGAAAGCTGCTGG - Intronic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001310260 5:170605175-170605197 GAGGGTGGGCAGGTGGCTGGTGG - Intronic
1001398120 5:171431135-171431157 GAGGGAGTGATGGAGGCTGCTGG + Intronic
1001450757 5:171822660-171822682 GAGGGAGGGCAGGCAGATGCAGG - Intergenic
1001908381 5:175492794-175492816 GAGGGAGGAGAAGATGCTACCGG + Intronic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002187107 5:177459529-177459551 GAGTGAGGGCGGGGGGCTGCTGG + Intronic
1002285873 5:178162350-178162372 GAGGGTGGGCAGGATGCCTGGGG + Intergenic
1002468596 5:179421372-179421394 GAGCGAGTGCAGGAGGGTGCTGG - Intergenic
1002782811 6:380031-380053 GTGGAAGGACTGGATGCTGCTGG - Intergenic
1003050167 6:2773288-2773310 GAGGGAGCGCAGTATGATGAAGG + Intronic
1003154379 6:3578761-3578783 GAGGGTGGACATGCTGCTGCCGG + Intergenic
1003414819 6:5898383-5898405 GAGGGAGGGCAGGAGGAGGGAGG - Intergenic
1003807177 6:9738221-9738243 GTGGCAGGTCAGGATGCTGTGGG - Intronic
1004885363 6:20046201-20046223 GAGAGAGGGCAGATTACTGCAGG - Intergenic
1005273103 6:24187209-24187231 GAGGGATGGCTGGATGTGGCAGG + Intronic
1005341482 6:24847575-24847597 GAGGGAGGGCAGGTCACTGAAGG + Exonic
1005529571 6:26689525-26689547 GAGGGAGGGCCGAATGCACCGGG + Intergenic
1005541225 6:26812122-26812144 GAGGGAGGGCCGAATGCACCGGG - Intergenic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1005862285 6:29911008-29911030 CAGGGAGACCAGGTTGCTGCTGG - Intergenic
1005928958 6:30466573-30466595 GAGGTAGGGCCGAGTGCTGCAGG - Intergenic
1006076407 6:31535307-31535329 GAGGAAGGGGAGGAGGCAGCGGG + Intronic
1006197548 6:32255110-32255132 GAGGGAGAGAAGGAAGCTGAGGG + Intergenic
1006271136 6:32968529-32968551 GAAGGAGGGCCAGAGGCTGCGGG - Intronic
1006296176 6:33171061-33171083 GAGGGAGGACCAGAGGCTGCTGG + Intronic
1006321358 6:33321483-33321505 GAGAGTGGGCACGTTGCTGCCGG + Exonic
1006409646 6:33865197-33865219 GAGTGAGTGCAGGATCCAGCCGG - Intergenic
1006430104 6:33990262-33990284 GCGAGAGGGCAGGAGGCTGGTGG + Intergenic
1006650169 6:35544952-35544974 GAAGGAGGGCAGGAGGGTGGAGG + Intergenic
1006903113 6:37515757-37515779 GAAAGAAGGGAGGATGCTGCCGG - Intergenic
1006922263 6:37634744-37634766 GGGGGATGGGGGGATGCTGCTGG - Exonic
1006923215 6:37639637-37639659 GAGGGAGGGAAGAATGTTCCAGG - Intronic
1007168782 6:39847672-39847694 GAGGAAGGGGTGGATGCTGGTGG - Intronic
1007212412 6:40206072-40206094 CAGGAATGGCAAGATGCTGCGGG + Intergenic
1007398434 6:41590173-41590195 GAGGGTGGGCTGGGGGCTGCAGG + Intronic
1007656950 6:43456123-43456145 GAGGGAGGGAAGGGTGGTGGGGG - Exonic
1007763530 6:44148178-44148200 CAGCGTGGGCTGGATGCTGCAGG + Intronic
1007835625 6:44671658-44671680 GAAGGAGGTGAGGATGCTGAAGG - Intergenic
1008516256 6:52322094-52322116 GAGGGAGGTGAGGAAGCTTCAGG - Intergenic
1009012031 6:57854194-57854216 GAGGGAGGGCCGAATGCACCGGG - Intergenic
1011083238 6:83512001-83512023 GAGGCAGCGCAGGATGCTCCCGG + Intergenic
1012351336 6:98254577-98254599 GAGTCAGGGCAGGTTGGTGCTGG - Intergenic
1013108445 6:107046186-107046208 GAAGGAGGGCAGGCTACAGCAGG - Intronic
1013216445 6:108032091-108032113 GAGTGAGTGCAGGATCCAGCCGG + Intergenic
1013282758 6:108654133-108654155 GGGGAGGGGCAGGATGCTGCAGG + Intronic
1013579390 6:111518163-111518185 GAGGGTGGGAGTGATGCTGCAGG - Intergenic
1013749074 6:113381099-113381121 GAGGGAGGGAAGAATGATGTTGG + Intergenic
1014160305 6:118160032-118160054 GAGTAAAGGCAGGATGCTGAGGG + Intronic
1014743454 6:125172021-125172043 GAGGGAGGGAAGGAGGCAGTAGG - Intronic
1015189523 6:130457672-130457694 CAGGAAGGGGAGTATGCTGCAGG + Intergenic
1015651547 6:135467129-135467151 GAGAAAGGGCAGTATGCTTCAGG + Intronic
1016116777 6:140296160-140296182 GAGGCAGGGAAGGATGTAGCAGG + Intergenic
1016390080 6:143565823-143565845 GAGTGAGGGCAGGGTCTTGCGGG + Intronic
1016452138 6:144194444-144194466 GAGTGAGGCCAGGATGCGGTTGG + Intergenic
1018110879 6:160535930-160535952 GAGGTAGGGCAAAAAGCTGCTGG - Intronic
1018240927 6:161773920-161773942 GAGGAAGGGAGTGATGCTGCTGG + Intronic
1018252214 6:161882388-161882410 CAGGGAGGGGAGGCTGCGGCAGG + Intronic
1018719286 6:166560680-166560702 GAGGGAGGGCAGGCACCAGCAGG + Intronic
1019168745 6:170116846-170116868 GAGGAAGAGCAGGAGGCTGGGGG + Intergenic
1019221830 6:170479149-170479171 CAGGCAGGTCAGGATGCTCCTGG - Intergenic
1019419794 7:945716-945738 GAGGGAGGGAAAGAGGCTGGCGG - Intronic
1019465586 7:1186350-1186372 GAGAGAGGGCACGAGGCTGAGGG + Intergenic
1019512337 7:1424022-1424044 GAGGGTGGGCGGGATGGGGCTGG - Intergenic
1019523113 7:1469339-1469361 GAGGGTGGGCAGGCGGGTGCAGG + Intergenic
1019536880 7:1533872-1533894 GGGGGAGAACAGGATGCTGATGG + Intronic
1022016881 7:26357821-26357843 GAAGGGGAGCAGGATGCTGTGGG + Intronic
1022056021 7:26735101-26735123 GAGAGAGGGAAGGATGCTGTGGG - Intronic
1022518137 7:30988602-30988624 GAGGGAGGGAGGGATGGTGTGGG - Intronic
1023126370 7:36958448-36958470 GAGGGAGGGAAGGACTCTGGAGG - Intronic
1023253679 7:38291484-38291506 CAGGGAGGGCAGGCTCCGGCTGG + Intergenic
1023381180 7:39609885-39609907 CAGGCGGGGCAGGCTGCTGCAGG - Intronic
1023654822 7:42408865-42408887 GAAGGGGTGCAGGATGCTGTAGG + Intergenic
1025078735 7:55964677-55964699 GAGCCTGGGCAGGAGGCTGCAGG - Exonic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1026281877 7:68929352-68929374 GAAAGAGGGCAAGATGGTGCTGG - Intergenic
1026630429 7:72033190-72033212 GAACTAGGGCAGGAAGCTGCAGG + Intronic
1026662821 7:72317169-72317191 GAGGGAGGGAAGGAGGCAGGAGG + Intronic
1026955846 7:74376072-74376094 GAGGGAGAGTGGGGTGCTGCGGG + Exonic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1027682030 7:81233366-81233388 GAGGGAGGCCAGGGGGCTGAGGG - Intergenic
1028471199 7:91208391-91208413 GAGGGAGGGCTGCCTGATGCAGG + Exonic
1029074011 7:97921791-97921813 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1029473997 7:100772060-100772082 AAGGGAGGGCAGAATTCTGGAGG - Intronic
1030061068 7:105621752-105621774 GAGAGAGGCCAGGGAGCTGCTGG - Intronic
1032284969 7:130532923-130532945 GAGAGAATGCAGGATGGTGCAGG + Intronic
1032513621 7:132491360-132491382 GAGGGAGTGGAGGAGCCTGCTGG - Intronic
1032833044 7:135648039-135648061 GAGGGAGGGAAGGAGAATGCAGG - Intronic
1033589063 7:142795712-142795734 GCGGGAGGGCACGATGATTCAGG + Intergenic
1034104810 7:148481381-148481403 GATGGTTGGCAGGATGCTGGAGG - Intergenic
1034162278 7:149002401-149002423 GAGGGAGGGCACGATGGTTGGGG + Intergenic
1034491447 7:151395181-151395203 GACGGAGCCCAGGAGGCTGCCGG + Intronic
1034697457 7:153066483-153066505 GAAGGAGGGCAGGATGCAGTCGG + Intergenic
1034720287 7:153285777-153285799 GGGGGAGGGGAGAATGCGGCAGG - Intergenic
1035021673 7:155804253-155804275 GAGGCGCGGCAGGGTGCTGCGGG - Intronic
1035202402 7:157276079-157276101 GAGGGGGGCGAGGGTGCTGCAGG - Intergenic
1035219620 7:157398205-157398227 GAGTGAGGGCAGGGTCTTGCTGG + Intronic
1035283345 7:157791540-157791562 GAGGGGGGGCAGGTGGGTGCAGG - Intronic
1035628190 8:1089378-1089400 GAGTGAGGGCAGCATGCCTCAGG - Intergenic
1035915068 8:3610054-3610076 GAGGGAAGGCTGGGTGCTGTAGG - Intronic
1036243692 8:7099504-7099526 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036257109 8:7214553-7214575 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036288013 8:7461907-7461929 GAGGTTGGGTAGGATGCTGCAGG + Intronic
1036309159 8:7673152-7673174 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036333463 8:7849621-7849643 GAGGTTGGGTAGGATGCTGCAGG - Intronic
1036360376 8:8072967-8072989 AAGGAAGTGCAGGATGCTCCTGG + Intergenic
1036521271 8:9493912-9493934 GAGGGTGGGGAGGAGGGTGCTGG - Intergenic
1036691640 8:10948291-10948313 GAGGGACAGCAGGACGCTGAGGG - Intronic
1036824375 8:11964929-11964951 GAGGCTGGACAGGAAGCTGCCGG + Intergenic
1036890593 8:12594000-12594022 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1036898147 8:12651920-12651942 AAGGAAGTGCAGGATGCTCCTGG - Intergenic
1037706010 8:21315856-21315878 AAGGGCGGGCAGGAGGCAGCAGG - Intergenic
1037738086 8:21582733-21582755 GAGGGAGGGCAGGATGTGGCTGG - Intergenic
1038125171 8:24665347-24665369 GTGGAAGGGCAGCATGCTGGAGG - Intergenic
1038575524 8:28701211-28701233 GATGGCGGGGAGGATGCTCCCGG - Intronic
1038642091 8:29337059-29337081 CAGGTAGGGCAGGCTGCTGGGGG + Exonic
1038765474 8:30423757-30423779 GAAGAAAGGCAGGATGGTGCGGG + Intronic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1039452719 8:37688531-37688553 AGGGAAGGGCAGGATGCTGGGGG + Intergenic
1039579367 8:38651228-38651250 GAGGGAGGCCAGGAGGAGGCCGG - Intergenic
1039882326 8:41632697-41632719 GGCGGAGGGAAGGAGGCTGCAGG + Intergenic
1041489216 8:58412781-58412803 GAGGAAGGTCAGGGTGCTGGTGG + Intronic
1042537083 8:69870000-69870022 GAGGGAGGGCAGGAGGAAGATGG - Intergenic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1043284897 8:78516338-78516360 GCGGGAGCGGAGGCTGCTGCTGG + Exonic
1044627383 8:94247330-94247352 GAAGCAGGGCAGGATAATGCCGG - Intergenic
1046651100 8:116837418-116837440 GAGGGAGGGGAGTATGCTAATGG + Intronic
1048295493 8:133210720-133210742 GGGTGAGGGCAGGATGGGGCAGG - Intronic
1048747233 8:137627588-137627610 GAGGGAGGCCAGGGGACTGCAGG - Intergenic
1049404327 8:142444963-142444985 GAGGGGGGCCAGGATGCACCAGG + Intergenic
1049595460 8:143481331-143481353 CGGGGAGGGAAGGATGCTGAGGG - Intronic
1049892998 9:88358-88380 AAGGGAGCCCAGGATGGTGCAGG - Intergenic
1050319095 9:4432885-4432907 GAGGGATGGGAGGATGAGGCGGG - Intergenic
1050675928 9:8053208-8053230 GCATGAGGGCAGGATGCTGGTGG + Intergenic
1051707440 9:19895659-19895681 GAAGGAAGGCAGGAGCCTGCAGG - Intergenic
1052437104 9:28443710-28443732 GAGGGAGGCCAGGGAGCTGAGGG + Intronic
1052596029 9:30559364-30559386 GAGGGAGTTCTGGATGCTTCGGG + Intergenic
1052904106 9:33818144-33818166 GCGGGAGGGCAGGCTGCACCGGG + Intronic
1053003939 9:34592157-34592179 GAGGCAGGGCCAGATCCTGCAGG - Intergenic
1053135350 9:35647213-35647235 GAGGGAGGGAGGGAGGCTTCGGG - Intergenic
1053139395 9:35673476-35673498 GAGGTAGGGCAGGCTGCTAGGGG - Intronic
1053295315 9:36908714-36908736 CAGGGTGGGCTGGATGCTGGAGG + Intronic
1053354249 9:37432965-37432987 AAGGGAGGGCAGGAGGGAGCAGG - Intronic
1053464503 9:38295821-38295843 GAGGGTGGGCAAGATGGTGCAGG - Intergenic
1053734219 9:41088416-41088438 AAGGGAGCCCAGGATGGTGCAGG - Intergenic
1054694175 9:68343153-68343175 AAGGGAGCCCAGGATGGTGCAGG + Intronic
1056113521 9:83420259-83420281 GAGGGAGTTCAGGATGATGTGGG - Intronic
1056378295 9:86035373-86035395 GAGGAGGAGCAGGAAGCTGCCGG - Exonic
1056791692 9:89629643-89629665 GCAGGAAGGCAGGGTGCTGCCGG + Intergenic
1056868159 9:90249866-90249888 GAGGGAGGGCAGGTAATTGCCGG + Intergenic
1056998560 9:91486932-91486954 GAGGCAGGGCACGTGGCTGCTGG - Intergenic
1057304147 9:93902786-93902808 GAGGGGTGGCAGGTTGGTGCAGG + Intergenic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1059324159 9:113493520-113493542 GTGGGGAGGCAGGATGCTGGGGG - Intronic
1059338578 9:113584238-113584260 CAGCGAGGGCAGCCTGCTGCAGG + Exonic
1060041947 9:120307744-120307766 CAGGGAGGACAGGATGCTTTTGG - Intergenic
1060133245 9:121125819-121125841 GAATGAGTGCAGGAAGCTGCGGG + Exonic
1060460471 9:123848929-123848951 GAGAGAGGTGAGGAAGCTGCAGG + Intronic
1060552709 9:124493044-124493066 CAAGGAGGGCAGCATCCTGCTGG - Exonic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061049000 9:128183129-128183151 GAGGGAGGGAGGGAGGCTGCAGG - Intronic
1061133351 9:128720419-128720441 GAAGGGGGGCTGGATGGTGCGGG - Exonic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061236090 9:129343440-129343462 GAGGGAGCGCAGGATGGGGTGGG + Intergenic
1061486038 9:130920961-130920983 GTGGGAGGCCTGGAGGCTGCTGG + Intronic
1061627277 9:131848494-131848516 GAGGGAAGGCAGGCTGCCGCTGG + Intergenic
1061711875 9:132493554-132493576 GGGGGAGGGCAGCAGGCTGCAGG + Intronic
1061791512 9:133061592-133061614 CAGAAAGGGCAGCATGCTGCAGG - Intergenic
1061805843 9:133137494-133137516 GAGGGAGGGCAGGGGGCCGGAGG + Intronic
1061871788 9:133524788-133524810 GAGGAAGGCCAGGCTGCTGAGGG + Exonic
1062230646 9:135479923-135479945 GGGGGCGGGCCGGAGGCTGCAGG - Exonic
1062378707 9:136276491-136276513 GAGGGAGGGGAGCATGCAGGTGG - Intergenic
1062425842 9:136505822-136505844 GAGGCAGCGCAGGCTGCCGCAGG + Exonic
1062439763 9:136564457-136564479 GGGGCAAGGCAGGAGGCTGCGGG - Intergenic
1062480592 9:136749111-136749133 GAGGGGAGGCAGGAGGCAGCAGG - Intergenic
1062546269 9:137064982-137065004 GCGGGAGGGCAGGATTAGGCAGG + Intronic
1062710116 9:137970963-137970985 GAGGGAGGGCCAGATGCTGCAGG + Intronic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1186380667 X:9055246-9055268 GAGGCAGCGCAGCATTCTGCAGG + Intronic
1186389422 X:9143993-9144015 GAAGGAAGGCAGGAGGCTCCCGG - Intronic
1186639026 X:11435085-11435107 GAGGGAGGGGGAGATGCTACTGG + Intronic
1187226864 X:17381420-17381442 AAGGGAGGGGAGGATGTTTCAGG - Intronic
1187536772 X:20148078-20148100 AAGGAAGTGCAGGATGCTGTAGG - Intergenic
1188743780 X:33817186-33817208 GAGGTAGGGCTGGATGCTGGTGG + Intergenic
1189094195 X:38120748-38120770 GGGGGAAGGCAGGCTGCTGGAGG + Intronic
1190266212 X:48828643-48828665 GAGGGAGGGCAGGATTTTGCCGG - Intergenic
1190773792 X:53536626-53536648 GAAGAAGGGCAGGATGCTGGTGG - Exonic
1191668268 X:63725244-63725266 GAGTGAGAGGAGGAGGCTGCAGG - Intronic
1191846375 X:65550672-65550694 AAGGGAGGGCAGGCTGCAGAGGG + Intergenic
1192237596 X:69305916-69305938 GAGGGAGGGGAGGGGGCTCCAGG + Intergenic
1192246582 X:69378141-69378163 GCTGGAGGCCAGGCTGCTGCTGG - Intergenic
1195599137 X:106726608-106726630 GAGGGAGGAAAGGACACTGCGGG - Intronic
1196910770 X:120482285-120482307 AAGGGAGGGGAGGATGCAGAAGG - Intergenic
1196965057 X:121046903-121046925 GAGAGGGGGCAGGATCCTCCTGG + Intergenic
1197796037 X:130299558-130299580 GAGGGAGGCCAAGATGGGGCTGG - Intergenic
1198297361 X:135300872-135300894 GAGGGAGGGAAGGATGAGGCAGG + Intronic
1199665956 X:150096636-150096658 GAGGGAGAACAGGATGGTGAAGG - Intergenic
1199929984 X:152508189-152508211 GGCGGAGGGGAGCATGCTGCTGG - Intergenic
1200117810 X:153776812-153776834 GAGGCAGGGCAGGATGTGGGCGG + Intronic
1200373651 X:155756151-155756173 AAGGGAGGCCAGCATGCTGCAGG - Intergenic
1201143774 Y:11050425-11050447 GAGAGAGGTGAGGAAGCTGCAGG + Intergenic
1201179464 Y:11332046-11332068 GAGGGAGGGCGTGGTGATGCTGG - Intergenic
1201989723 Y:20010243-20010265 GAGGGAGGGAAGGAATCTCCAGG + Intergenic