ID: 1167087749

View in Genome Browser
Species Human (GRCh38)
Location 19:47321877-47321899
Sequence GTGTGGGGGTGGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1810
Summary {0: 1, 1: 1, 2: 22, 3: 172, 4: 1614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167087749_1167087761 1 Left 1167087749 19:47321877-47321899 CCCACTTCCCTCCACCCCCACAC 0: 1
1: 1
2: 22
3: 172
4: 1614
Right 1167087761 19:47321901-47321923 CCAGCCGTGTCCCTAACCCCTGG 0: 1
1: 0
2: 4
3: 34
4: 407
1167087749_1167087763 9 Left 1167087749 19:47321877-47321899 CCCACTTCCCTCCACCCCCACAC 0: 1
1: 1
2: 22
3: 172
4: 1614
Right 1167087763 19:47321909-47321931 GTCCCTAACCCCTGGCAACCAGG 0: 1
1: 0
2: 4
3: 19
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167087749 Original CRISPR GTGTGGGGGTGGAGGGAAGT GGG (reversed) Exonic
900418644 1:2546240-2546262 GTGTGGGGGGTGAGGGGGGTGGG + Intergenic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900479158 1:2889884-2889906 GTTCTGGGGTGGAGGGAGGTGGG + Intergenic
900504893 1:3024991-3025013 GGTGGGGGGTGGAGGGAGGTGGG + Intergenic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900589394 1:3453064-3453086 GTGTGGGGTTGGGGGTAACTTGG + Intergenic
900602638 1:3509650-3509672 GTGTGGGGGTTGGGGACAGTGGG - Intronic
900622842 1:3595294-3595316 GGGTGGAGGTGGAGGGAGGGCGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900850247 1:5137028-5137050 GAGTGGGGGAGTGGGGAAGTAGG - Intergenic
900850269 1:5137076-5137098 GAGTGGGGGAGCGGGGAAGTGGG - Intergenic
900891840 1:5455059-5455081 GTGTGAGGGTGGATGGGAGCTGG - Intergenic
900993112 1:6106928-6106950 GTGGAGGGGTGGAGGGATGGAGG + Intronic
901306829 1:8238943-8238965 GTATGGAGGTGGAGGCAAGGAGG + Intergenic
901442849 1:9290067-9290089 GTGTGGGGGTGGGGTGGAGTTGG + Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901466445 1:9424554-9424576 GGGTGGGGGTGGGGTGAAGGTGG + Intergenic
901518298 1:9764223-9764245 GTGGTGGGGTGGGGGGTAGTGGG - Intronic
901884103 1:12210740-12210762 AAGTAGGGGTGGGGGGAAGTGGG - Intergenic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902431526 1:16367227-16367249 GGGTGGGGGAGGAGGGAAAGCGG + Exonic
902671748 1:17979561-17979583 GGGGTGGGATGGAGGGAAGTAGG - Intergenic
902676622 1:18013185-18013207 GAGTGGGGGAGGAGGAAAGCTGG - Intergenic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
902789444 1:18756713-18756735 GTGTGGGGGTGAGGGGTAGATGG + Intergenic
902917502 1:19647542-19647564 GTGTGGGGGGAGAGGAAAGGTGG + Intronic
903486113 1:23690175-23690197 GTGTGGTGGTGGGGGGAGGGGGG + Intergenic
903539682 1:24089947-24089969 GTGTGGGGGATGAGGGCAGGTGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903560366 1:24222412-24222434 GGGTGGGGGTGGCAGGGAGTGGG + Intergenic
903609239 1:24597966-24597988 TGGTGGGGGTGGGGGGAACTTGG + Intronic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903778914 1:25809566-25809588 GTGTGGGGGTGGAGGTGGATGGG - Intronic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904031248 1:27534790-27534812 GGGAGGGGGTGGAGGGAGATGGG + Exonic
904043447 1:27597139-27597161 GTATGGGGGTGGGGGGCAGGTGG + Intronic
904171806 1:28596685-28596707 GGGTAGTGGTGGGGGGAAGTGGG - Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904232029 1:29082585-29082607 GGGTAGGGGTGGAGGGATGAAGG - Intronic
904348727 1:29891164-29891186 GTGTGGAGGTGGAGGGCTGTGGG + Intergenic
904373279 1:30064399-30064421 GTGTGTGGGTGGGAGGAAGGAGG + Intergenic
904484610 1:30816427-30816449 GGAGGGGGGCGGAGGGAAGTGGG + Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
904602917 1:31683629-31683651 GTTTGGGAGTGGATGGAAGTAGG + Intronic
904823452 1:33259356-33259378 CTTGGGGGGTGGAGGCAAGTTGG + Intronic
904831229 1:33307729-33307751 GGGTGGGGGTGGGGGGGAGGTGG - Intronic
904842073 1:33379322-33379344 GTGGGGGGGTGGGGGGCAGGGGG - Intronic
905120587 1:35678830-35678852 GTGTGGGCCTGTAGGGGAGTGGG - Intergenic
905739330 1:40355965-40355987 TAGTGGGGGTGGGGGAAAGTGGG - Intronic
905770564 1:40635629-40635651 GTGTGTGCGTGGTGGGAGGTGGG + Intronic
905928723 1:41771277-41771299 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
906083174 1:43107575-43107597 GTGTGGGGGTGGTGGGGGGCGGG + Intergenic
906187333 1:43871715-43871737 GTGAGGGAGAGGAGGGATGTGGG + Intronic
906313951 1:44774232-44774254 GTGGGAGGGTAGGGGGAAGTGGG + Intergenic
906334885 1:44920517-44920539 GTGTGGGGGTGGTGGGAGTGGGG - Intronic
906707749 1:47907058-47907080 GCGTGGGGAGGGAAGGAAGTGGG + Intronic
907038200 1:51235423-51235445 GGTTGGGAGTGGAGGGAAGTGGG + Intergenic
907273758 1:53305734-53305756 GGGTGGAGGTGCAGGGAAGCTGG - Intronic
907415351 1:54310583-54310605 GGGTGGGGGAGGGAGGAAGTGGG - Intronic
907476422 1:54708898-54708920 GTGTGGGGCTGGAGGATAATGGG + Intronic
907564195 1:55419361-55419383 GGGTGGGGGATGAGGAAAGTGGG + Intergenic
907567811 1:55452758-55452780 GTGTGGGGGTGGGTGGGTGTGGG - Intergenic
907679554 1:56550716-56550738 GTGTGGGGGTGGGTGGGAGGAGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907923286 1:58932774-58932796 ATTTGGGCGTGGAGGGAAATGGG + Intergenic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908137337 1:61146715-61146737 ATGTGGGGGTGGAGGGTATGGGG - Intronic
908215695 1:61949352-61949374 TTTGGGGGGTGGTGGGAAGTGGG + Intronic
908464328 1:64376696-64376718 GGCTGGCGGTGGGGGGAAGTGGG - Intergenic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909268110 1:73588408-73588430 GTGCGAGGGTGGAGGGAGGGAGG - Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910159633 1:84259331-84259353 GGGTGGGAGTGGAGGTCAGTTGG + Intergenic
910269421 1:85377705-85377727 GTATGGGGGTGGGGGGATGAGGG - Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
910644421 1:89498068-89498090 GTGTGGGGGTGTAGGGGTGGAGG + Intergenic
910644424 1:89498076-89498098 GTGTAGGGGTGGAGGGTGGATGG + Intergenic
910768411 1:90806443-90806465 GTGTGGGGGTGGGGAGTAGGGGG + Intergenic
910811520 1:91242262-91242284 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
910884795 1:91953096-91953118 ATGTTGGGGTGGAGGGAGGGGGG - Intronic
911276130 1:95861607-95861629 GTGTGGAGGTGGAGGCAGGTGGG + Intergenic
911426219 1:97716612-97716634 GTGTGGTGATGGAGGGATCTAGG - Intronic
911788990 1:101986863-101986885 GTGTAGGGGTTGGGGGATGTAGG + Intronic
912075630 1:105872038-105872060 GTGTGTGTGTGGGGGGAGGTGGG + Intergenic
912227824 1:107755384-107755406 ATGTGGGGGTGAGGGGAAGCTGG + Intronic
912260762 1:108109921-108109943 TGGTGGGGGAGGAGGGGAGTTGG - Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912517853 1:110227165-110227187 GTTTGGGGACAGAGGGAAGTGGG - Intronic
912526016 1:110283255-110283277 ATGTGGCGGTGTTGGGAAGTGGG - Intergenic
912638357 1:111320102-111320124 GTGTGGAGGTGGGGTGCAGTTGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912706787 1:111920664-111920686 GAGTGGATGAGGAGGGAAGTAGG - Intronic
912823537 1:112885908-112885930 GTGTGGGGGTGGGGGCAGGGAGG - Intergenic
913720984 1:121594326-121594348 GAGGGGGGGGGCAGGGAAGTGGG + Intergenic
914213624 1:145604797-145604819 GGGTGGGGTTGGAGAGATGTTGG + Intergenic
914354559 1:146872349-146872371 GTGGTGGGGTGGGGGGAGGTGGG + Intergenic
914459645 1:147871497-147871519 AGGTGGGGGTGGATGGAATTAGG + Intergenic
914514502 1:148362612-148362634 GGGTGGGGGTGGGGGGCGGTGGG - Intergenic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
915024964 1:152818950-152818972 GTGTGAGGGAGGAAGGATGTTGG - Intergenic
915059637 1:153170774-153170796 GTGGGGAGGTGCAGGGAGGTAGG - Intergenic
915213199 1:154324984-154325006 TGGTGGGGGCGGAGGGAAGGAGG + Exonic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915472767 1:156135834-156135856 GTATGGGGAAGGAGGGACGTGGG - Intronic
915479143 1:156173297-156173319 GTGAGTGGGTGGAGGGGAGCTGG + Intronic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916412422 1:164559325-164559347 GAGTGGGGGTGGGGGGCAGCGGG + Intronic
916677039 1:167072852-167072874 GCCTGGGGGTGGAGGAAAGTGGG + Intronic
916812685 1:168319308-168319330 GGGAGGGGGTGGAGGTGAGTAGG - Intergenic
917049320 1:170901034-170901056 GGGTGGGGGTGCAGGGGAGTGGG + Intergenic
917498644 1:175565549-175565571 GAGTGAGGGTGCAGGGAAATCGG + Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917727254 1:177839590-177839612 GTGTCGGGGTGGAGAGGAGAAGG - Intergenic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
918667189 1:187166317-187166339 TTGTGGTGGTGTTGGGAAGTGGG + Intergenic
918782708 1:188723244-188723266 GGATGGGGGTTGAGGGCAGTGGG - Intergenic
918914959 1:190623075-190623097 TTGTGGGGGGTGAGGGAGGTGGG + Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919207670 1:194437786-194437808 GGGTGGAGGTGGGGGGAAGGGGG - Intergenic
919403987 1:197152801-197152823 GTGGAGGGGTGGGGGGAAGGCGG + Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919780170 1:201216345-201216367 GGATGGGGGTGGGGGGGAGTCGG + Intronic
919780177 1:201216361-201216383 GAGTCGGGGTGGCGGGGAGTTGG + Intronic
920400342 1:205672220-205672242 GTGTGGTGGGGGAGGCACGTGGG - Intronic
920504466 1:206506815-206506837 GGTGGGGGGTGGAGGGGAGTTGG - Intergenic
920547331 1:206829363-206829385 GTGGGGAGGAGGAGGGGAGTGGG + Intronic
920639328 1:207736328-207736350 GTGGTGGGGTGGGGGGAAGGGGG + Intronic
920678344 1:208054322-208054344 GCCTGGTGGTGGAGGGGAGTGGG + Intronic
920920606 1:210294547-210294569 GAGTGAGGGTGGGGGGAAGGAGG + Intergenic
921007901 1:211112285-211112307 GTGGAGGGGTGGAGGGGGGTGGG - Intronic
921108510 1:212009176-212009198 GAGTGTGGGTGGAGGAAAATTGG - Intronic
921441833 1:215196695-215196717 GTGTGGGGGCGGTGGGAGATGGG + Intronic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
921628171 1:217401798-217401820 TTGGGGGGGTAGAGGGAAGGGGG - Intergenic
921882580 1:220271920-220271942 GTGTGGGGGTGGGGGGAGGGAGG + Intronic
921939841 1:220828116-220828138 GTATGGGGGTGGGGGGCAGCTGG - Intergenic
922223584 1:223626941-223626963 GGGTGGCGGTGGGGGGAGGTGGG + Intronic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922559932 1:226562005-226562027 GGGTGAGGTTGGGGGGAAGTGGG + Intronic
922672785 1:227525624-227525646 GTGGGGGGCTAGAGGGATGTGGG - Intergenic
922767258 1:228162650-228162672 GTGGGGGGGTTGGGGGAAGGTGG - Intergenic
922794943 1:228335301-228335323 GAGTGGGGGTGGGGGGATGGGGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923015038 1:230120161-230120183 GGGTGGGGGTGGGGGTGAGTGGG + Intronic
923040159 1:230314174-230314196 GTCTGACGGTGGAGGGAAGATGG + Intergenic
923162203 1:231324177-231324199 CTGTGGTGGTGGGGGGAAGCGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
924048322 1:240054908-240054930 GGGAGGGGGTGCAGGGAAGGAGG + Intronic
924078670 1:240369136-240369158 GGCAGGAGGTGGAGGGAAGTGGG - Intronic
924240526 1:242035623-242035645 TTTTGGGGGTGGGGTGAAGTCGG + Intergenic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062811211 10:467377-467399 GTGGTGGGGTGGGGGGAGGTGGG + Intronic
1062844112 10:690958-690980 GTGGGGGGGTGGTGGGGGGTAGG - Intergenic
1062945952 10:1462150-1462172 GCCTGGGGGTGGTGGGAAGTGGG - Intronic
1062974411 10:1672742-1672764 GTGTGTGCGTGGAGGGAGGGAGG - Intronic
1063342821 10:5284149-5284171 GTGTGGGGGTGTATGGAGGAAGG - Intergenic
1063371713 10:5526595-5526617 GTGAGGGGTTGGGGGGCAGTTGG + Exonic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1063524077 10:6768012-6768034 GTGTGGTGGAAGAGGGAGGTGGG + Intergenic
1063970345 10:11377290-11377312 GTGTGGGGGAGGATGGAAACCGG + Intergenic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064250695 10:13704419-13704441 GGGTCTGGCTGGAGGGAAGTGGG - Intronic
1064920295 10:20509373-20509395 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065846453 10:29747534-29747556 GGGTGGTGGTGGTGGGGAGTTGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066093510 10:32050181-32050203 GTGGGGATGTGGAGGGTAGTAGG - Intronic
1066220658 10:33334714-33334736 GGGAGGGGGAGGAGGGAGGTAGG + Exonic
1066525705 10:36276745-36276767 GTTGGGGGGTGGAGGGTAGGGGG + Intergenic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067008654 10:42690383-42690405 GTCTGGGGGTCCTGGGAAGTGGG - Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067555581 10:47267674-47267696 GTGTGGGGGTGGGTGGGGGTGGG - Intergenic
1067671126 10:48322626-48322648 GTGTGAGGGTGGGGGCATGTGGG - Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067893732 10:50157664-50157686 GTTTTGGGGTGGGGGGAAGAGGG + Intergenic
1067901357 10:50244869-50244891 GTTTGGGGGTGGGAGGTAGTAGG - Intronic
1067979977 10:51074113-51074135 GTGTGCGGGTGGAGCGAGGCGGG - Intronic
1068131904 10:52905671-52905693 GTGTGTGGGTCGAGGGGAGGAGG + Intergenic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1068932173 10:62602901-62602923 GTGGTGGGGTGGGGGGAAGGAGG - Intronic
1068955113 10:62814713-62814735 GGCTGGGGGTGGAGGGGAGTTGG - Intronic
1069127908 10:64660493-64660515 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1069633629 10:69912540-69912562 GGGTGGGGGTGGGGGGCGGTCGG - Intronic
1069950429 10:72014788-72014810 GTCTGGGGGTGGGGGAAAGGAGG - Intergenic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070579321 10:77707846-77707868 GTGGGGGAGTGAGGGGAAGTGGG + Intergenic
1070755259 10:78988050-78988072 GTGTGGGGGTTGAAGGGGGTGGG + Intergenic
1070809068 10:79288497-79288519 GTGTGTTGGGGGAGGGAAATTGG - Intronic
1070962537 10:80509243-80509265 GTGTGGGGGTGCAGGCTGGTGGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071334499 10:84589864-84589886 CTGTGCGGGTGTAGGGAAGGTGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071697291 10:87890020-87890042 GTGGGGGGGTGGTGGGAGGTGGG - Intronic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1072018889 10:91379388-91379410 GTGGGGGGTTGGGGGGCAGTGGG - Intergenic
1072370353 10:94760151-94760173 GTGTGTGGGTGCAGGGAAAGAGG + Intronic
1072378952 10:94847222-94847244 GTTTTGGGGTGGAGGGAGGGAGG - Intronic
1072386499 10:94935883-94935905 GTGTGTGGGTGCAGGGAAAGAGG + Intergenic
1072656186 10:97332177-97332199 GTGCTGTGGTGGAGGGAGGTGGG - Intergenic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1072809237 10:98446624-98446646 GTTCGGGGGTGGGGGGAGGTGGG - Intronic
1073094255 10:100970130-100970152 ATCTTGGGGTGGAGGGAACTGGG - Intronic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1073838154 10:107467855-107467877 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1074636809 10:115327931-115327953 GTTGTGGGGTGGGGGGAAGTGGG + Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074758278 10:116644197-116644219 ATGTGCGGGTGGAGGGATGATGG - Intronic
1075167853 10:120085335-120085357 GTGGAGGGGAGGAGGGAAATGGG + Intergenic
1075217969 10:120555091-120555113 GGGTGGGGGTGGAAGAGAGTGGG + Intronic
1075815443 10:125261305-125261327 GTTTGGGATTGGAGGGGAGTTGG + Intergenic
1075919059 10:126195103-126195125 GCTTGGGGGTGGAGAGATGTGGG + Intronic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076586207 10:131549319-131549341 GTGTGAGGATGGAGGGAACGGGG + Intergenic
1076653569 10:132006312-132006334 GTGTGGGGGTGGGAGGGGGTGGG + Intergenic
1076668489 10:132105894-132105916 GTCTGGCGGTGGAGGGGAGTCGG + Intronic
1076709479 10:132324056-132324078 GTGTGGGTGTGTTGGGAGGTGGG - Intronic
1076888254 10:133272318-133272340 GGCTGGGGTGGGAGGGAAGTGGG - Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077306407 11:1870523-1870545 GTGTGGGGGTGTCAGGAAGAGGG + Intronic
1077339917 11:2021679-2021701 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1077340373 11:2023745-2023767 GTGTGTGGGTGCAGGGAGGTGGG + Intergenic
1077363136 11:2149696-2149718 ATGTGGAGGTGGTGGGGAGTGGG + Intronic
1077364988 11:2158061-2158083 GTGTTGGAGTGGAGGGCAGCAGG - Intronic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077609565 11:3636022-3636044 GCCTGGGGGTGGGGGGAAATGGG + Intergenic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1077861223 11:6181798-6181820 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1077980217 11:7292523-7292545 GTGTGGAGTTGGAGGGGAATGGG - Intronic
1078556794 11:12334596-12334618 GTGGGGGGGTGGGGGGAGGGGGG - Intronic
1078768497 11:14323532-14323554 GTGTGCCGGTGGGGGGAAGAGGG - Intronic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1079271820 11:18994155-18994177 GGGTGTGTGTGGGGGGAAGTGGG - Intergenic
1079565763 11:21880040-21880062 TTGTGGGGTTGGGGGGAAGCGGG + Intergenic
1079885308 11:25981071-25981093 GGGTGGAGGTGGGGGGAAGCAGG + Intergenic
1079885987 11:25989540-25989562 GTTTTGGGGTGGGGGGAAGTGGG + Intergenic
1080949752 11:37018009-37018031 GTTTGGGGGTGGGGGGAGGCGGG - Intergenic
1081012690 11:37834994-37835016 GAGTGAGGAAGGAGGGAAGTGGG - Intergenic
1081181415 11:39990028-39990050 GTGGTGGGGTGGGGGGAGGTGGG + Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081362242 11:42194528-42194550 ATTTGGGGGTGGAGGGTATTAGG + Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081633179 11:44703017-44703039 GTGTGGGGGGGTGGGGAGGTGGG + Intergenic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1081732742 11:45383157-45383179 ATTTGGGGGTTGAGGGCAGTTGG - Intergenic
1082059390 11:47847639-47847661 GTGTGGGGGTGGGGGGGGGGAGG + Intronic
1082266277 11:50121903-50121925 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
1082289812 11:50356669-50356691 GTGGTGGGGTGGAGGGAGGGGGG - Intergenic
1082557595 11:54581457-54581479 GGGTGGGGGTGGGGGGAGGGGGG - Intergenic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082835875 11:57649802-57649824 GTGGGTGGGGGGAGGGTAGTTGG + Intronic
1083025056 11:59543678-59543700 GTTTTGGGGTGGGGGGAAGGGGG - Intergenic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083192376 11:61061592-61061614 GGGTGGGGCGGGAGGGAGGTGGG - Intergenic
1083293954 11:61705306-61705328 GTGCGAGGGTGAAGAGAAGTGGG - Intronic
1083338855 11:61945731-61945753 GGGTGGGGGTGGGTGGAAGGTGG + Intergenic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083804921 11:65067789-65067811 GTCTAGGGGATGAGGGAAGTGGG + Intronic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1084174980 11:67418354-67418376 GTGTGGAGGTGGTGGAAGGTGGG + Intronic
1084257417 11:67952604-67952626 GTGGGGGGGTGGAGGGTGGGGGG - Intergenic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084694840 11:70746950-70746972 GTGCTGGGGTGGAGGGAGGGGGG - Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084726006 11:70942515-70942537 ATGTGGGGGTGTTGGGAGGTGGG - Intronic
1084937820 11:72596396-72596418 GTGTGGGGGTGGGAGGAGTTGGG - Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1085024404 11:73228183-73228205 GGGTGGGGGTGGGGGGGAGCGGG + Intronic
1085026431 11:73239276-73239298 GGGTGTGGGAGGAGGGAAGCAGG + Intergenic
1085027554 11:73245428-73245450 GGGTGGGGGTGGAGGAGAGGAGG + Intergenic
1085134683 11:74075367-74075389 GGGGGGGGGTGGGGGGAAGTAGG + Intronic
1085154572 11:74281720-74281742 GTTGTGGGGTGGAGGGAGGTGGG + Intronic
1085414876 11:76313234-76313256 ATGGGGGGTTGGAGGGATGTGGG + Intergenic
1085498916 11:76999604-76999626 AGGTGGGGCAGGAGGGAAGTAGG - Intronic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1085646921 11:78230261-78230283 ATGCCGGGGTAGAGGGAAGTTGG - Intronic
1085655420 11:78310151-78310173 ATGTGGGGGTGGAGGGAGTGAGG + Intronic
1085753505 11:79184543-79184565 GTGTGGGGGTGGAGGTTAGGGGG + Intronic
1085839695 11:79997171-79997193 GTGGGGGGGTGGAGAGAAAGTGG + Intergenic
1086133405 11:83423052-83423074 TTTTGGGGGTGGACAGAAGTTGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086570095 11:88273164-88273186 GTGTGTGGGGGTAGGAAAGTGGG + Intergenic
1086646751 11:89231642-89231664 GGGGTGGGTTGGAGGGAAGTTGG + Intronic
1087034486 11:93742180-93742202 GTGTGGGGCAGGGGGGATGTAGG - Intronic
1087458192 11:98414121-98414143 GTGAGGGGGTGGAGGGTGGGGGG - Intergenic
1087479327 11:98679988-98680010 GGGTGGGGGAGGGGGGTAGTGGG + Intergenic
1087651043 11:100867894-100867916 GTGTCGGGGAAGAGGGAAGCTGG + Intronic
1087801466 11:102509248-102509270 GTGTGGTGGTGTCAGGAAGTGGG + Intergenic
1087857470 11:103109549-103109571 TGGAAGGGGTGGAGGGAAGTTGG - Intronic
1088409270 11:109515309-109515331 ACTTGAGGGTGGAGGGAAGTAGG - Intergenic
1088782099 11:113145760-113145782 CTCAGGGGGTGGAGGAAAGTGGG - Intronic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1089013330 11:115147643-115147665 GTGTGGGGGGGTTGGGGAGTGGG + Intergenic
1089110682 11:116053441-116053463 GGTTGGGGGTGCAGGGCAGTGGG - Intergenic
1089194285 11:116684053-116684075 GGGTGGGGGTGGAGGGGAGCGGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089371219 11:117959750-117959772 GGGTGGGGGTGGAGGTCAGTGGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089580350 11:119477795-119477817 GTCTGGGGGTGAAGAGAGGTGGG + Intergenic
1089916911 11:122165758-122165780 GTATGTGTGTGCAGGGAAGTGGG - Intergenic
1090202010 11:124864021-124864043 GTGTGGGGGAGGGGGTAGGTGGG - Intergenic
1090622989 11:128578129-128578151 GTTTGGGGAGGGTGGGAAGTTGG - Intronic
1090663234 11:128896428-128896450 GGGTGGGGTGGGATGGAAGTGGG - Intronic
1090708214 11:129359452-129359474 TTGGGGGGGTGGTGGGGAGTGGG - Intergenic
1091108524 11:132944110-132944132 GTGTCGGGACGGAGCGAAGTGGG - Intronic
1091131333 11:133149561-133149583 GGGTGGGGGTTGAGAGAATTTGG - Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1202822902 11_KI270721v1_random:76868-76890 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1202823358 11_KI270721v1_random:78934-78956 GTGTGTGGGTGCAGGGAGGTGGG + Intergenic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091446390 12:546216-546238 GGGTGTGGGAGGAGGGGAGTGGG + Intronic
1091568061 12:1662409-1662431 GGGAGGGGGAGGCGGGAAGTGGG - Intergenic
1091568097 12:1662493-1662515 GGGAGGGGGAGGCGGGAAGTGGG - Intergenic
1091568107 12:1662514-1662536 GGGAGGGGGAGGCGGGAAGTGGG - Intergenic
1091568135 12:1662575-1662597 GTGAGGGGGAGGCGGGAAGTGGG - Intergenic
1091658032 12:2360153-2360175 GTGGGGGGGTGGGGGGGGGTGGG - Intronic
1091722089 12:2820898-2820920 GTGTGGGGGTGCATGGAAGCAGG + Intronic
1091754560 12:3043048-3043070 GGCTGGGGGTGCTGGGAAGTAGG - Intergenic
1091763757 12:3104925-3104947 GTGTGGGGGTGATGGGCAGGGGG + Intronic
1091804281 12:3344722-3344744 GAATGGTGGTGGGGGGAAGTGGG + Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092075011 12:5665703-5665725 GGGTGGGGGTGGGGGGTGGTGGG - Intronic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092132889 12:6124826-6124848 GTGTGGGGGTGTAGGGATAGGGG - Intergenic
1092163241 12:6327659-6327681 GGGTTGGGGAGGAGGGAAGCTGG - Exonic
1092247496 12:6871791-6871813 GTGTGGCTGAGGAAGGAAGTAGG + Intronic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1092913718 12:13171164-13171186 GTGGGTGGGTGGGGGGAAGAGGG + Intergenic
1092942594 12:13424168-13424190 GTGTGTGTGTGCAGGTAAGTAGG - Intergenic
1092967400 12:13657662-13657684 GTGTTGGGGGGCAGGGAAGAGGG + Intronic
1093427358 12:19043634-19043656 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1093589706 12:20886858-20886880 GTGGGAGGGTGGAAGGGAGTGGG - Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093809254 12:23472523-23472545 GCCTGGGGCTGGAGTGAAGTGGG - Intergenic
1093887684 12:24481273-24481295 GTGGGGGGTTGGAAGGATGTAGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094074014 12:26452545-26452567 GTGTGGTGGTGTTGGGAGGTAGG + Intronic
1094078305 12:26503174-26503196 GTGTGTTGGTGGGGGGCAGTGGG - Intronic
1094207175 12:27852964-27852986 GTGTGGGGGAGAAGGGGAGTAGG - Intergenic
1094794434 12:33954469-33954491 TTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1094839668 12:34337665-34337687 ATGTGTGGCTGGAGGGACGTGGG - Intergenic
1095106285 12:38237075-38237097 GTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095960081 12:47828893-47828915 GTGGGGGGGTGGTGGGTAGTGGG + Intronic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096188171 12:49597460-49597482 GGGTGGGGGTGGGAGGAAATGGG + Intronic
1096230287 12:49893030-49893052 GTAGTGGGGTGGAGGGAAGAGGG - Intronic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096331646 12:50718418-50718440 GGATTGGGGTGGAGGGAAGGAGG - Intronic
1096385932 12:51195575-51195597 GTGGAGGGGTGGAGGGATGGAGG + Intronic
1096716106 12:53492744-53492766 GTGGGGGCGGGGAGGGAGGTTGG - Intronic
1096744358 12:53715778-53715800 GTGTGGAGGTAGAGGGATGGGGG - Exonic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1096988406 12:55777995-55778017 GTGTGGGTGTGGGGGAAACTGGG + Intronic
1097070132 12:56348670-56348692 GTGTAGGGAAGGAGGGACGTGGG + Intronic
1097226164 12:57477901-57477923 GGGTGGGGGAGGCGGGAAGTTGG - Intronic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1097863915 12:64543482-64543504 GTGTGGGGGAGTGGGGGAGTGGG - Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1097923794 12:65105782-65105804 GTGTGGCGGTGTTGGGAGGTGGG - Intronic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098012674 12:66071353-66071375 GTGTGGGGGTGGTGGGCCGCAGG - Intergenic
1098172930 12:67764944-67764966 TTATGGGGGAGGGGGGAAGTAGG + Intergenic
1098541618 12:71663748-71663770 GTGCTGGGGTGCGGGGAAGTTGG - Exonic
1098718388 12:73861658-73861680 GTGTGGGGATGGCGCGAAATGGG + Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098813190 12:75122207-75122229 GTGTTGGGGAGAAGGGAAATGGG + Intronic
1099165955 12:79307618-79307640 GGGTGGGGGTGGGGGGGCGTGGG + Intronic
1099201077 12:79677975-79677997 GTTTGGGGGTAGAGGGCAGATGG - Intronic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1100264771 12:92965277-92965299 GTGTGGGGGTTAAGGGGAGGGGG - Intergenic
1100297225 12:93274237-93274259 GTGTCGGGGTGGGGGGAGCTTGG + Intergenic
1100351851 12:93791520-93791542 GGGTTGGGGTGGAGGGCAGGTGG + Intronic
1100470478 12:94888400-94888422 GAGAAGGGGTGGAGGTAAGTGGG - Intergenic
1100583654 12:95959606-95959628 GTATGGGGGAGGAGGATAGTAGG - Intronic
1101033039 12:100678530-100678552 GTGTGGGTGTGGGTGGGAGTGGG - Intergenic
1101045537 12:100801749-100801771 GGGGTGGGGTGGAGGGAAGGTGG + Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102317205 12:111898834-111898856 GTCAGGGGGTGGGGGGAAGGGGG - Intergenic
1102722051 12:115024990-115025012 GTGTGTGTGTGTAGGGAATTTGG + Intergenic
1102880723 12:116482622-116482644 GAGTGGGGGTGAAGGGATGGGGG - Intergenic
1102964842 12:117118144-117118166 GGGTGGGGGGTGAGGGAAGAAGG - Intergenic
1102973332 12:117188983-117189005 GAGTGGGGGTGGAGGGAGCAGGG - Intronic
1103154016 12:118667805-118667827 GGGTGGGGGTGGGGTGAGGTGGG + Intergenic
1103424721 12:120823206-120823228 GTGTGGGGGTGGGGGGTGGGGGG + Intronic
1103499227 12:121388045-121388067 AGGTGAGGGTGGTGGGAAGTAGG + Intronic
1103564771 12:121810159-121810181 TTCCGGGGGTGGAGGGAAGTGGG - Exonic
1103740590 12:123088534-123088556 GTGTGGGGGTGGCAGGAGGGTGG + Intronic
1103856803 12:123976328-123976350 GTGTTAGTGTGGAGGAAAGTGGG + Intronic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104460571 12:128952425-128952447 GGGTGGGGGTGGGGGGGGGTGGG + Intronic
1104707618 12:130959154-130959176 GTGTGGCCGTGGTGGAAAGTAGG - Intronic
1104827029 12:131719236-131719258 GTGGGGTGGTGGGGGGAGGTGGG - Intronic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105258264 13:18759609-18759631 GTGAGAGGGTGGTGGGCAGTAGG - Intergenic
1105261862 13:18785605-18785627 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1105264219 13:18802194-18802216 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1105264679 13:18805303-18805325 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1105546616 13:21355452-21355474 GGGAGGGGGAGGAGGGAAGGTGG + Intergenic
1106140383 13:27006515-27006537 GGGTGGGGGTGGGGGGAAAGAGG - Intergenic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106458581 13:29948727-29948749 CTGTGGCGGTGGAAGGAGGTGGG - Intergenic
1106473969 13:30081533-30081555 GGGTGGGGTTGGGGGGAAGGTGG - Intergenic
1106660114 13:31790747-31790769 GAGGTGGGGTGGATGGAAGTTGG + Intronic
1106666370 13:31855188-31855210 GTGTGAGGGGGCAGGGAGGTGGG + Intergenic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1106813237 13:33380468-33380490 GTGTGGGGGGGGTGGGGGGTGGG - Intergenic
1106880562 13:34124858-34124880 GTTTGGGGTTGGTGGGAGGTAGG + Intergenic
1106926259 13:34616137-34616159 GGTTGAGGGTGGAGGAAAGTAGG - Intergenic
1107284821 13:38779223-38779245 GTCGGGGGGTGGAGGGAAAGGGG + Intronic
1107610208 13:42105393-42105415 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
1107805098 13:44146285-44146307 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
1107886963 13:44881572-44881594 GTGTGGGGGGCGAGGGAATGGGG + Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108007232 13:45961556-45961578 ATGTGGGGGTGGGGAGATGTGGG + Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1108703932 13:52968127-52968149 TGGTGGAGGTGGAGGAAAGTCGG - Intergenic
1109593600 13:64520918-64520940 GTGTGGTGGTAAAGAGAAGTTGG - Intergenic
1110125082 13:71932483-71932505 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1110274456 13:73628241-73628263 GTTTTGGGGTGGGGGGAGGTGGG - Intergenic
1110301465 13:73933995-73934017 GTGTTGGGGGAGAGGGAAATAGG - Intronic
1110422524 13:75329102-75329124 GTGTGGGGGTTGGGGGGAGGTGG - Intronic
1110441553 13:75532115-75532137 CTTTTGGGGTGGAGAGAAGTGGG + Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110759919 13:79220236-79220258 GTGTGGTGGTGTTGGGAGGTGGG - Intergenic
1111806514 13:93044989-93045011 GTGTTGGGGTGGAGAGATGAGGG - Intergenic
1111897855 13:94163323-94163345 AGGTGGAGGTGGAAGGAAGTAGG - Intronic
1112024207 13:95397555-95397577 GTGTGGGGGTGGTGGGCGATTGG + Intergenic
1112035707 13:95494903-95494925 GAGTAGGGGTGGAGGGGAGAAGG - Intronic
1112151488 13:96769441-96769463 GTGGGGGGGTGGGGGGAGGGGGG - Intronic
1112201770 13:97283419-97283441 GGGTGGGGGTGGATTGTAGTAGG - Intronic
1112266181 13:97925849-97925871 GGGTGGGGGGTGGGGGAAGTTGG - Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112505795 13:99974957-99974979 GTCTGGGGTTGGAAGGAGGTTGG - Intergenic
1112551789 13:100428327-100428349 GGGTGGGGGTGGGGGGTAGGGGG - Intronic
1112589613 13:100751291-100751313 GGGTGGGGGTACAGGGAGGTTGG - Intergenic
1112630027 13:101150242-101150264 GGGTGGGGGTGGCGGGGAGCGGG + Intronic
1113055168 13:106259847-106259869 GTGTGGGGGTGTGGGGGTGTGGG + Intergenic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113626984 13:111854791-111854813 GACTGGGGGTGGAGGGCATTTGG + Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114529790 14:23388550-23388572 GTGTGGGGGGTGAGGGCAGGGGG - Intronic
1114547313 14:23512520-23512542 GGGTGGGGGTGGGGTGAGGTGGG - Intergenic
1114630276 14:24155127-24155149 GTGAGGGGTTGGAGGGGAGGGGG - Intronic
1114703756 14:24705421-24705443 GGGTGGGGGTGGGGAGCAGTGGG + Intergenic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1114728396 14:24964114-24964136 GTGTCTGGGTGGGGGGAATTGGG - Intronic
1114982293 14:28179793-28179815 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
1115282236 14:31677318-31677340 TGGTGGGGGTGGAGGGAATGGGG - Intronic
1115347900 14:32362834-32362856 GTGTGGGGAGGGCTGGAAGTGGG + Intronic
1115437797 14:33396004-33396026 GGGTGGGGCTGGAGGGAATGGGG - Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115819193 14:37195963-37195985 TGGTGGTGGTGGAGGGGAGTAGG + Intergenic
1115831775 14:37350708-37350730 GTTGAGGGCTGGAGGGAAGTGGG - Intronic
1116330575 14:43592489-43592511 GTGGGGGGAGGGTGGGAAGTGGG - Intergenic
1116403124 14:44533431-44533453 GTGATGGGGTGGAGAGAAATGGG + Intergenic
1116466482 14:45239252-45239274 GGTTGGGGGTGGAGGCAAGCAGG + Intronic
1116919655 14:50560005-50560027 GTCTGGGGGTGGACTGAGGTAGG + Exonic
1117091817 14:52258714-52258736 GAGTGGGGGTGGGGGGCAATTGG + Intergenic
1117160155 14:52981587-52981609 ATGTGGGGGTGGAGGGTATATGG - Intergenic
1117326352 14:54672329-54672351 GTACGAGGGTGGAGGGAAGGTGG + Intronic
1117349820 14:54870361-54870383 GGGTGGGGGTGGAGCCAAGATGG + Intronic
1117807550 14:59509988-59510010 ATGTGGGGGTAGAGGGAGCTTGG - Intronic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1118279586 14:64416422-64416444 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118693684 14:68363759-68363781 GTGTGTGGGTGCAGTGAAGGTGG + Intronic
1118994329 14:70822678-70822700 AAGTGGGGGTGAAGGGAAGGAGG - Intergenic
1119064638 14:71512967-71512989 TTGAGGGGGTTGGGGGAAGTGGG - Intronic
1119182144 14:72612527-72612549 GTGGGGTGGAGGTGGGAAGTGGG - Intergenic
1119273161 14:73327896-73327918 GTGTGGTGGGGGAGGGCAGGCGG - Intronic
1119578849 14:75755980-75756002 GGGTGGGGGTGGGGGGCGGTGGG - Intronic
1119646564 14:76352839-76352861 GCGTGGGGGCGGAGGGAAAGAGG - Intronic
1119750208 14:77071990-77072012 GTGTGGTGGTGGTGGGAGGTGGG - Intergenic
1119974597 14:79011385-79011407 GGGTGGGGTTGGGGGGAGGTGGG - Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120120353 14:80671867-80671889 ATGGGGGGGTGGGGGGTAGTGGG + Intronic
1120191174 14:81441093-81441115 GTGGGGTGTTGGAGGGAAGGAGG - Intergenic
1120274416 14:82353403-82353425 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1120647233 14:87088617-87088639 GGGTGGGGGAAGTGGGAAGTGGG + Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1121102353 14:91258624-91258646 GAGTGGGAGTGCAGGGAACTTGG + Intergenic
1121141110 14:91543363-91543385 GTGTGCAGCTGGAGGGAAATGGG - Intergenic
1121507993 14:94490977-94490999 GTATGGGGATGGAGTGAAGGTGG - Intronic
1121571480 14:94949782-94949804 TTGGGGAGGAGGAGGGAAGTGGG + Intergenic
1121733532 14:96202738-96202760 GTGTGTGGGTGGATGGATGGAGG + Intergenic
1121737043 14:96225895-96225917 GGGTGGGAGTGGAGGGTGGTGGG - Intronic
1121843621 14:97154867-97154889 AGGTGGGGCTGGAAGGAAGTGGG + Intergenic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1122253116 14:100454365-100454387 GTGTGAGGGTGGAGGTGAGGAGG + Intronic
1122281208 14:100623504-100623526 ATGTGGGGGATCAGGGAAGTAGG - Intergenic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122429448 14:101630553-101630575 GTGTGGGGTAGGAGGGCAGAGGG - Intergenic
1122556637 14:102584072-102584094 GGGTGGGGGTGGGGGGTGGTGGG + Intergenic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122606064 14:102948256-102948278 GGGTGGGGGTGGAGGTGAGGGGG + Intronic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1122748647 14:103916799-103916821 GTGAGTGGGTGGAGGGAGGGAGG - Intronic
1122791360 14:104185455-104185477 GGGTGGGGGTGGAGTGGGGTGGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1122954510 14:105064299-105064321 GTGTGGTGGAGCAGGGAGGTTGG - Intronic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1202833774 14_GL000009v2_random:62758-62780 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124185767 15:27527345-27527367 GTGCTGGGGTGGAGGGATGTGGG + Intronic
1124243456 15:28050952-28050974 GTACTGGGGTGGAGGGCAGTAGG - Intronic
1124272464 15:28295303-28295325 GTGTGTGGGGGGGGGGGAGTGGG + Intronic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1125312887 15:38399876-38399898 GGGTGGGGGTGGCGGGAAATGGG - Intergenic
1126357506 15:47812020-47812042 GTGTGGGGGCGGGGGGTATTAGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126506824 15:49414392-49414414 GTGTGTGGGGGGAGGGAGGGGGG + Intronic
1126561968 15:50053714-50053736 GTGGGGGGGTGGGGTGAAGGTGG + Intronic
1126953173 15:53905611-53905633 GACTGGGGGTTGGGGGAAGTGGG + Intergenic
1126965755 15:54051906-54051928 GTGGTGGGGTGGAGGGAGGGGGG - Intronic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127320000 15:57834690-57834712 GAGTGGGGGCGGGGGGAAGCTGG + Intergenic
1127382310 15:58440614-58440636 GTGTGTGGGGGCAGGGAGGTTGG + Intronic
1127559085 15:60118100-60118122 GTGTGGGTGGGGAGGTAGGTGGG + Intergenic
1127568082 15:60213167-60213189 GGGTGGGGGTGGAGGGCAAGGGG + Intergenic
1127656087 15:61057582-61057604 GTGTGGGGGTGCAAGAAAGATGG - Intronic
1127855741 15:62952279-62952301 GTGGGGGGGTGGGGGGAAATTGG + Intergenic
1127982920 15:64047169-64047191 GTGAGGGGGTGAAGGGAGGAAGG + Intronic
1128014836 15:64334392-64334414 GACTGGGGGTGGAGGGCAGGGGG + Intronic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128406932 15:67351235-67351257 GTTGGGGGGTGGGGGGAAGCAGG - Intronic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128746333 15:70116967-70116989 GTATGGGGGAGGGGGGAAGCAGG + Intergenic
1128794552 15:70455770-70455792 GGGGGGTGGGGGAGGGAAGTAGG - Intergenic
1128814907 15:70601334-70601356 GTGTGGGGGTGGAGGTTATCTGG + Intergenic
1129208899 15:74054126-74054148 GGGTGGGGGTGGAGGAGGGTGGG + Intergenic
1129208908 15:74054142-74054164 GGGTGGGGGTAGAGGGGGGTGGG + Intergenic
1129388077 15:75206848-75206870 GTGGTGGGGTGGTGGGTAGTGGG - Exonic
1129691981 15:77718949-77718971 GGGCTGGGGTGGAGGGAACTGGG + Intronic
1129914516 15:79257019-79257041 GAGTGGGGGCATAGGGAAGTGGG + Intergenic
1129933520 15:79431511-79431533 GTGTGGGGGGGGAGAGAAACAGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130288106 15:82572109-82572131 GTTTGGGGGTGGAGAGCAGGGGG - Intronic
1130306195 15:82713587-82713609 GAGTGAGGGTAGAGGGGAGTAGG - Intergenic
1130355478 15:83126082-83126104 GTGTGGGGGTGCATGCAAGGTGG + Intronic
1130362091 15:83198858-83198880 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130519860 15:84654152-84654174 GGGTGTGGGTGGAGGCACGTTGG - Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130575611 15:85090683-85090705 GGGTGGGGGTGGGGGGATGATGG - Intronic
1130806342 15:87327535-87327557 GTGGTGGGGTGGGGGGAGGTGGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130956743 15:88632172-88632194 GTCTGGGGGTCGAAGGAAGATGG + Exonic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1131357292 15:91757101-91757123 GGTTGGGGGAGGAGGGAAGAGGG - Intergenic
1131360686 15:91788194-91788216 TTCGGGGGGTGGAGGGAAGTGGG - Intergenic
1131757029 15:95575929-95575951 GTAAGAGGGTGAAGGGAAGTGGG - Intergenic
1131855784 15:96592341-96592363 GTGTGGGGGTAGAGGGGTATGGG + Intergenic
1132053157 15:98627702-98627724 GTAGGGGGGTGGAGGAAATTAGG - Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132105298 15:99058963-99058985 GGGTGGGGGCGGAGGGAGGGCGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132139166 15:99376689-99376711 GTTGTGGGGTGGGGGGAAGTGGG - Intronic
1132191122 15:99861788-99861810 GTGGCGGTGTGGAGGGAGGTGGG - Intergenic
1132199650 15:99942559-99942581 TTTTGGGGGAGGAGGGGAGTGGG + Intergenic
1132243225 15:100276297-100276319 GTGGGAGGGTGGAAGGGAGTGGG + Intronic
1132279698 15:100602487-100602509 GGGTGGGGGTGGAGGGAGTAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133058413 16:3158813-3158835 GGGTAGGGGTGGAGTGAAGGCGG + Intergenic
1133061814 16:3179858-3179880 GGGTCCGGGTGGAGGGAGGTTGG + Intergenic
1133357628 16:5148246-5148268 GTGTGGGGGTGCAGGGGTGCAGG - Intergenic
1133563577 16:6971794-6971816 GTGTGGAGGGCGAGGGAAATAGG + Intronic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1133978586 16:10617568-10617590 GTGTAGGGGTGAAGGGAGGAGGG - Intergenic
1133998574 16:10765663-10765685 GTGTGAGGGAGGTGGGAAGATGG - Intronic
1134107427 16:11494317-11494339 GAGTGGGGGTGGGGTGAAGGGGG - Intronic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1134912354 16:18039175-18039197 GTTTGGGGGTGGAGGGGGCTAGG - Intergenic
1135040244 16:19112775-19112797 TTGTGGGGGAGGGGGGAAGGGGG + Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1135491997 16:22917400-22917422 GTGAGAGGGTGGATGGATGTTGG + Intergenic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135829141 16:25758127-25758149 GTTTGAGGGTGGAGAGAATTAGG - Intronic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1135870304 16:26143607-26143629 TTGTGGGGGTGGGGGGAAAGGGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136104319 16:28018678-28018700 GCCTGGGGGTGGGGGGAAGGTGG - Intronic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136813602 16:33199227-33199249 GGGTGGGGGGGGAGGGGAGTGGG + Intronic
1136820078 16:33309307-33309329 GGGTGGGGGGGGAGGGGAGTGGG + Intergenic
1136934583 16:34448142-34448164 GTGAGAGGGTGGGGGGAGGTAGG + Intergenic
1136969989 16:34963672-34963694 GTGAGAGGGTGGGGGGAGGTAGG - Intergenic
1137409647 16:48217284-48217306 ATATGTGGGAGGAGGGAAGTAGG - Intronic
1137463993 16:48691435-48691457 GGGTGGTGGTGGGGGGAAGCAGG + Intergenic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1137693135 16:50442865-50442887 GTGGGGGGGTGGGGGGAAGTGGG + Intergenic
1137709419 16:50555942-50555964 GGGTGGGGGGGAAGGGACGTGGG - Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137785268 16:51133247-51133269 GGGTGGGGGGGGAGGGAGGGAGG + Intergenic
1137966139 16:52935699-52935721 GGGTGGGGGCGGAAGGAAGGCGG - Intergenic
1138175974 16:54898587-54898609 TTGTGGGGGTGGAGGGCAAGGGG - Intergenic
1138221401 16:55254759-55254781 CTATGGGGGAGGAGGGAAATGGG - Intergenic
1138608741 16:58106211-58106233 GTGTGTGGGTGGGTGGGAGTGGG - Intergenic
1139456734 16:67085498-67085520 GGGTGGGGGTGGGGGGAGATGGG + Intronic
1139613950 16:68077891-68077913 TGGTGGGGGTGGGGGGGAGTGGG - Intronic
1139667635 16:68468879-68468901 GTGGAGAGGTGGAGGGAGGTAGG + Intergenic
1140442278 16:74997618-74997640 GTGGGGGGGTGGGGGGAGATGGG - Intronic
1140608553 16:76570536-76570558 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
1140857810 16:78993258-78993280 ATTTGGGGGTGGGGGGAGGTTGG + Intronic
1140864972 16:79052184-79052206 GTGGTGGGGTGGGGGGAAGGGGG - Intronic
1140914673 16:79483104-79483126 GGGAGGGGAGGGAGGGAAGTAGG - Intergenic
1141050665 16:80760342-80760364 GTGGGGGGTTGGAGGGGAGATGG + Intronic
1141490675 16:84370485-84370507 GTGTGAGGAGGGAGGGAGGTGGG + Intronic
1141601154 16:85127157-85127179 GTGTGTGGGTGGGTGGAAGGGGG - Intergenic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142240357 16:88941857-88941879 GTGTGGGGGGGGTGGGGAGGTGG + Intronic
1142365838 16:89649214-89649236 GTGGGGAGGTTGAGGGAAGCTGG - Intronic
1142411846 16:89921001-89921023 GTTTGCGGGTGGAGGGATGGGGG + Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142986318 17:3697136-3697158 GTGCGGGGGTGGGGGGCAGACGG + Intergenic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143193091 17:5054889-5054911 GTGTGTGACTGGAGGGAGGTAGG + Intergenic
1143351745 17:6293163-6293185 GGCTGGGGGAGGAGGGAAATGGG + Intergenic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143406984 17:6684205-6684227 GTTTGGTTGGGGAGGGAAGTAGG - Intergenic
1143439422 17:6957564-6957586 GTGTGGGGTAGGAGGGGATTTGG - Intronic
1143585546 17:7848633-7848655 CTGAGAGGGTGGAGGGAACTTGG - Exonic
1143746941 17:9002117-9002139 GTGTGGGGGCGGGGGGCGGTGGG - Intergenic
1143747813 17:9006170-9006192 GTACGGGGGTGGTGGGTAGTGGG + Intergenic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1144341110 17:14310894-14310916 GTGTGTGGGTGGATGGGTGTGGG + Intronic
1144647821 17:16987438-16987460 GTATGGGGGAGGAGGGAGGGAGG + Intergenic
1144700239 17:17332875-17332897 GTGTGGGAGTGGAGGGTATATGG + Intronic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1145014338 17:19386966-19386988 GGGTGGGGGGGCAGGGAAGAGGG - Intronic
1145795201 17:27651410-27651432 GTGTGGCGGGGGAGGGGGGTTGG - Intergenic
1145990026 17:29073736-29073758 GTGTGTGGGGGCAGGGAGGTTGG + Exonic
1146095907 17:29930093-29930115 GGGTGGGGGTGAAGGGAACGGGG + Exonic
1146110951 17:30089085-30089107 GTCGTGGGGTGGAGGGAAGGGGG - Intronic
1146211441 17:30946641-30946663 GAGTGGGGGTGGATGAAGGTGGG + Intronic
1146240705 17:31221088-31221110 GGTTGGGGGTGGAGGGATGGTGG + Intronic
1146419934 17:32674157-32674179 GTGTGGGGGTGGAGTGGAAACGG + Intronic
1146750351 17:35373370-35373392 GGCTGGGGGTGGAGTGGAGTGGG - Intronic
1147327090 17:39674828-39674850 GGGTGGGGGTAGAGGGACATAGG - Intronic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1147909580 17:43847391-43847413 GGCTGGGGGTGGGGGGAGGTGGG + Intronic
1147980810 17:44272851-44272873 GTCTGGGGGTGGATGGAAGTGGG + Intergenic
1148156333 17:45427104-45427126 GTCTGGGGGCCGAGGGAGGTGGG - Intronic
1148201799 17:45754135-45754157 GTGTGGGGGTGGTAGGAGGCTGG - Intergenic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148750728 17:49944461-49944483 GCCTGGAGGTGGAGGGAGGTGGG - Intergenic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1149126856 17:53245126-53245148 GTGTGCGGGGGGAGGGAGGTGGG - Intergenic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149891126 17:60391721-60391743 GTGTGGTGGAGGAGAGAGGTCGG - Intronic
1150152035 17:62817866-62817888 GGGAGGGGGTGGAAGGAAGGAGG + Intergenic
1150388005 17:64775734-64775756 GTCTGGGGGCCGAGGGAGGTGGG - Intergenic
1150563743 17:66319119-66319141 GGGTGGGGGTGGAGGGGACAGGG - Intronic
1150646106 17:66978464-66978486 GTGTGGGGGAGGGGTGAAGTGGG - Intronic
1151013725 17:70531022-70531044 GTGGGGGGGTGGAGGGGTGGAGG + Intergenic
1151070614 17:71206299-71206321 GTTGTGGGGTGGAGGGAAGGGGG + Intergenic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151109232 17:71655276-71655298 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1151189490 17:72387754-72387776 GGGGAGGGGTGGAGAGAAGTGGG + Intergenic
1151275035 17:73027915-73027937 TTGTTGGGGTGAAAGGAAGTGGG - Intronic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151552422 17:74829823-74829845 GTGTGGGGCTGGAGAGAGTTGGG - Intronic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151686957 17:75653060-75653082 GTGGTGGGGCGGAGGGAGGTGGG + Intronic
1151694735 17:75708561-75708583 GTGTGTGGGTGGGGGACAGTAGG - Intergenic
1151708810 17:75787946-75787968 TTATGGGGGTGGAGGGAAGCAGG - Intronic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1152120721 17:78416681-78416703 GTGGGAGGGTGGAGGGTGGTAGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152315493 17:79578110-79578132 GGGTAGTGGTGGAGGGAAGGGGG + Intergenic
1152423272 17:80205294-80205316 GCGTGGTGGGGGAGGGAAGGAGG - Intronic
1152461514 17:80444627-80444649 GTGGGGGGGTGGGGGGGCGTGGG + Intergenic
1152541811 17:80980343-80980365 GTGCTGGGCTGGAGGGATGTTGG - Intergenic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152624060 17:81380172-81380194 GAGTGGGGGTGGGGAGTAGTGGG - Intergenic
1152655248 17:81516438-81516460 GTGTGGGAGAAGAGGGAGGTGGG - Intronic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1152811329 17:82384143-82384165 GGGTGTGGGTGGAGGGTAGCAGG - Intergenic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1152909991 17:82997882-82997904 GTGGGTGGTGGGAGGGAAGTAGG + Intronic
1152913093 17:83016656-83016678 GGTGGAGGGTGGAGGGAAGTGGG + Intronic
1153009568 18:525760-525782 TTGTGGGGTTTGTGGGAAGTAGG + Intergenic
1153344865 18:4014408-4014430 TTGTGGGGGTGAAGAGATGTTGG + Intronic
1154203595 18:12318264-12318286 GGGAAGGGGTGGAGAGAAGTTGG + Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1154423717 18:14256258-14256280 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1154424182 18:14259367-14259389 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1154425091 18:14265882-14265904 GTGAGAGGGTGGTGGGCAGTAGG + Intergenic
1154425956 18:14272245-14272267 GTGGGCAGGTGGAGGGTAGTAGG + Intergenic
1154426853 18:14278569-14278591 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1154428204 18:14288345-14288367 GTGGGAGGGTGGGGGGTAGTAGG + Intergenic
1154429583 18:14298103-14298125 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1154431851 18:14314449-14314471 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1154433176 18:14324008-14324030 GGGTGGGGTTAGAGGGAAGGGGG + Intergenic
1155019485 18:21882152-21882174 ATGTGGGGGAGGAGGTAAATGGG + Intergenic
1155270965 18:24140671-24140693 GGGTGGGGGAGGGGGAAAGTGGG - Intronic
1155420067 18:25646262-25646284 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155979276 18:32163859-32163881 GGGTGGGGGAGGAGAGAAGGGGG + Intronic
1156064597 18:33124991-33125013 GTGTGCAGGTGGAGGTAAGAGGG - Intronic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156463660 18:37335517-37335539 GTGTGGGGGTGAATGGGTGTAGG + Intronic
1156481072 18:37436751-37436773 GGCTGGGGCTAGAGGGAAGTCGG + Intronic
1156911883 18:42420828-42420850 GTGTGGGGGCTGGGGGAAGTGGG - Intergenic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157759442 18:50249707-50249729 GGGTGGGGCAAGAGGGAAGTAGG + Intronic
1157880641 18:51318094-51318116 GTGGGTAGGTGGAGAGAAGTAGG - Intergenic
1157903795 18:51547361-51547383 GCTGGGGGGTGCAGGGAAGTAGG - Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1157989669 18:52479567-52479589 GGGGGGGGGTGGAGGGAGGTAGG - Intronic
1158319646 18:56248881-56248903 GGGTGGGGGTGGAGGGGGGCAGG + Intergenic
1159039000 18:63305464-63305486 GTGTGTGTGGGGAGGAAAGTAGG + Intronic
1159347195 18:67221465-67221487 GTGGGGCGGTGAAGGGAAGGAGG - Intergenic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1159797614 18:72863804-72863826 GTGTGTGTGTGGGGGGAAGGTGG + Intronic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160176066 18:76595349-76595371 GGATGGGGGTAGGGGGAAGTAGG + Intergenic
1160204383 18:76821682-76821704 GGGAGGGGGAGGAGGGAAGGAGG + Intronic
1160939323 19:1612886-1612908 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1160939354 19:1613084-1613106 GTGTGGGTGTGGACAGCAGTGGG + Intronic
1161088112 19:2344301-2344323 GGGTGGGGGGGCAGGGGAGTGGG - Intronic
1161168691 19:2802314-2802336 AGGTGGGGGTGTCGGGAAGTGGG - Intronic
1161218957 19:3109187-3109209 GTGTGAGGGTGAAGAAAAGTGGG + Intronic
1161255501 19:3306812-3306834 GTGAGGGGGTGGAGAGGAGGCGG - Intergenic
1161345635 19:3767586-3767608 GTGTCGGCCTGGCGGGAAGTGGG + Intronic
1161515018 19:4691605-4691627 GTGTGGGGGAGGAGCCAACTGGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161660973 19:5546049-5546071 AGGTGGGGGTGGCAGGAAGTGGG - Intergenic
1161761037 19:6173004-6173026 GTGTGGGGTGGGAGGGCAGGTGG + Intronic
1161974472 19:7600555-7600577 GTGTGTGGGTGGATGGATGGGGG - Intronic
1162031260 19:7918134-7918156 GTATGGAGGTGGAGGGAGCTGGG + Intronic
1162450809 19:10753396-10753418 GTGGGGGGGGGAAGGGAAGGGGG - Intronic
1162566130 19:11446618-11446640 GTGTGGGGGAGGAGGGGAATAGG - Intronic
1162615919 19:11800063-11800085 GTGAGGGAGAGGATGGAAGTTGG + Intronic
1162742637 19:12782405-12782427 GTGTGTAGGGGGCGGGAAGTGGG + Intronic
1162751740 19:12833809-12833831 GGGCGGGGGCGGAGCGAAGTGGG - Intronic
1162878759 19:13641130-13641152 CCGTAGTGGTGGAGGGAAGTAGG - Intergenic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1162937624 19:13989258-13989280 GTGAGGGGATGGGTGGAAGTGGG + Intronic
1163054237 19:14706360-14706382 GTTGAGGGGTGGAGGGAAGATGG - Intronic
1163099045 19:15082423-15082445 GGGTGGGGGTGGAGGGTTGTGGG + Intergenic
1163107296 19:15132346-15132368 GTGGGGGGTGGGACGGAAGTGGG - Intergenic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163618103 19:18341351-18341373 GTTTGGGGGTGGGGGGGAGTCGG - Intronic
1163758523 19:19120729-19120751 GTGTGGGGGTGGAGGAGGGGCGG - Intronic
1164738264 19:30558395-30558417 TGGTGGGGGTGGAGGGTACTTGG + Intronic
1164995943 19:32720403-32720425 GTGTGGGGGTGGAGCTGGGTGGG - Intronic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165149782 19:33753763-33753785 GTGTGGGGATGGTGGGTGGTTGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165445667 19:35855765-35855787 GTGTGGGGGTGGGGAGAGATTGG + Intronic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1165772609 19:38387855-38387877 GGGTGCGGGTGAAGGCAAGTGGG + Intronic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166118105 19:40667843-40667865 GTGTGGGGGTGGCAGGAACACGG + Exonic
1166224078 19:41384099-41384121 GTGTGTGGGAGGATGGAAGGGGG + Intronic
1166337709 19:42118361-42118383 GAGTAGGGGTGGATGGAGGTGGG + Intronic
1166366495 19:42280900-42280922 GTGGGGGGGTTGAGAGACGTGGG - Intronic
1166412907 19:42568525-42568547 GTCGTGGGGTGGAGGGAAGGGGG + Intergenic
1166583123 19:43920532-43920554 GGGTGGGGGGGGGGGGCAGTGGG + Intronic
1166660929 19:44647071-44647093 GTGTGGGGGGAGGGGGAACTGGG - Intronic
1167087639 19:47321048-47321070 GTGTGGGGGGGGTGGGGGGTGGG - Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167487206 19:49769605-49769627 GGGCGGGTGTGGAGGGGAGTGGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167980760 19:53273015-53273037 GTGTGGGGGCAGTGGGAGGTGGG + Intergenic
1168107780 19:54174691-54174713 ATCTGAGGGAGGAGGGAAGTGGG - Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168370387 19:55828262-55828284 GTGGTGGGGTGGGGGGAAGGGGG + Intronic
1168471313 19:56643113-56643135 GCGGGGGGGTGGGGGGAGGTGGG - Intergenic
1202638898 1_KI270706v1_random:64934-64956 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
924996828 2:368923-368945 GTGTGGTGGTACTGGGAAGTGGG - Intergenic
925173721 2:1767940-1767962 GGGTGGGGGTAGAGGGAGGTGGG + Intergenic
925334036 2:3080129-3080151 GTTTGGGGGTGGAGAGAGGGAGG + Intergenic
925445539 2:3923862-3923884 TGGTGGGGGTGGAGGGATCTGGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926296753 2:11574477-11574499 GCCTGTGGGTGGAGGGCAGTGGG + Intronic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
926732970 2:16051087-16051109 GGGTGGGGGCGGAGGGAGGCAGG - Intergenic
926881369 2:17548201-17548223 GTGTGGGGGTGGGGGAAATGTGG - Intronic
927168692 2:20350717-20350739 GGGTGGGGGGGGAGGGTGGTAGG - Intronic
927245460 2:20953959-20953981 GTGGGGGGGTGTTGGGATGTAGG + Intergenic
927515793 2:23670989-23671011 GTGGGGGGGGGGAGGGAGGGAGG - Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927634886 2:24806453-24806475 GTGAGGGGGTGGAGCCAAGATGG - Intronic
927849745 2:26491360-26491382 GTGGAGGGGTGGAGGGAAAAAGG + Intronic
927921833 2:26978424-26978446 GGGTGGGGGTGGAGGGTGGCTGG - Intronic
927964620 2:27261608-27261630 GTGTGGGGGTGTGGGCATGTGGG + Intronic
928022561 2:27715880-27715902 GGGTCGGGGTGGGGGGAGGTGGG - Intergenic
928100955 2:28437106-28437128 GGGTGGGGGTGGGGGGAGGCGGG + Intergenic
928549730 2:32358063-32358085 GTGGGGGTGGGGAGGGAAGTAGG + Intronic
928599688 2:32892032-32892054 GAGTGGGGGTGGGGAGATGTTGG + Intergenic
928688383 2:33773684-33773706 GTGTGTGGGTGGCGGGGGGTGGG + Intergenic
928758691 2:34556549-34556571 TTGTGGGGTTGGGGGGAAGGGGG - Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929281611 2:40086793-40086815 GGGTGGGGGTGGCGGGGAGTTGG + Intergenic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929875374 2:45792339-45792361 GTGTGGTGGTGTTGGGAGGTGGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929961752 2:46502491-46502513 GTGTATGGTTGGGGGGAAGTGGG - Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
930222745 2:48761724-48761746 TTGTGGGGGTGGAGGGCATGGGG - Intronic
930675924 2:54200415-54200437 GTTTGAGGGTAGAGGGAAATAGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
931793608 2:65688695-65688717 GTATGTGGGTGGCGGGTAGTGGG - Intergenic
931867978 2:66432482-66432504 GTGGGGGGGTGGGGGGATGGGGG + Intergenic
931965077 2:67523954-67523976 GTGCAGGGGAGCAGGGAAGTGGG - Intergenic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932410165 2:71542764-71542786 GTGTCTGTGTGGAGAGAAGTGGG - Intronic
933262675 2:80147764-80147786 GTGGGTGGGTGCAGGGAGGTAGG - Intronic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933690135 2:85173297-85173319 GTGTGGAGGAGCAGGGGAGTGGG + Intronic
934491576 2:94764825-94764847 GTGGGAGGGTAGAGGGTAGTAGG - Intergenic
934492009 2:94767914-94767936 GTGAGAGGGTGGTGGGTAGTAGG - Intergenic
934492474 2:94771057-94771079 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
934494361 2:94784458-94784480 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
934543388 2:95194743-95194765 GTGGGGGGTGGGAGGGAAGTGGG + Intergenic
934653503 2:96105334-96105356 CTGTGCTGGTGGAGGGAATTGGG + Intergenic
935221381 2:101016921-101016943 GTGTGGGGTTGGGGGGATGGGGG + Intronic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936004460 2:108870803-108870825 GTGTTGGGGAAGAGGGAAATGGG + Intronic
936063584 2:109313829-109313851 GTGGGGGAGAGGAGGGAGGTGGG + Intronic
937210329 2:120264754-120264776 GGGTGGGGGAAGAGGGGAGTGGG - Intronic
937277474 2:120694676-120694698 GTGTGGGCGTGGGGGGATGCTGG - Intergenic
937309547 2:120893687-120893709 GTGGGGGGTTGGGGGGAACTTGG - Intronic
937453879 2:122024934-122024956 GTGGGGGGGTGGGGGGGGGTTGG + Intergenic
937517229 2:122669057-122669079 GTGGTGGGGTGGGGGGAGGTGGG + Intergenic
937563742 2:123257931-123257953 GTTGTGGGGTGGAGGGAGGTGGG + Intergenic
937599026 2:123706348-123706370 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937886113 2:126901016-126901038 GTGTGGGGTTCAAGGGAAATAGG - Intronic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
939058554 2:137393305-137393327 GTGGTGGGGTGGTGGGAAGGGGG - Intronic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
939707402 2:145471962-145471984 GTGAGTGGGAGGAGGGAGGTTGG - Intergenic
939845078 2:147233200-147233222 GTTGTGGGGTGGGGGGAAGTGGG + Intergenic
940160782 2:150711132-150711154 GCGTGGGGGTGGAGGGGTGGAGG + Intergenic
940324428 2:152410652-152410674 GGGTGGGGGTGAAGGGATGGTGG - Intronic
940745674 2:157564953-157564975 GTCAGGGGGTGGAGGGTAATGGG + Intronic
941134350 2:161696058-161696080 GTCGTGGGGTGGGGGGAAGTGGG - Intronic
941166890 2:162092192-162092214 GTGTGTAGGTGGCGGGATGTTGG - Intergenic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941637854 2:167955397-167955419 GTGAGGGGGTGGGAGGAAATGGG + Exonic
941786865 2:169506351-169506373 GAGTGGAGGTGGGGGGAAGGTGG + Exonic
942236561 2:173914306-173914328 GATTGGGGGAGGAGGGGAGTTGG - Intronic
942425977 2:175861284-175861306 TTGTGGGGGTTGAGGGGAGTTGG + Intergenic
942546308 2:177067643-177067665 GGGTGGGGGTGGAGGGATGGGGG + Intergenic
943046659 2:182868135-182868157 GGGCGGGGGTGGGGGGAAGAGGG - Intergenic
943347654 2:186758934-186758956 GTGTGGGGTTGGGGGAGAGTAGG - Intronic
943581340 2:189687102-189687124 TGGTGGGGCAGGAGGGAAGTGGG - Intronic
943709151 2:191070853-191070875 GTGTGGGGGTGGGACGAAGAAGG + Intronic
943720939 2:191202970-191202992 GTTTGGGGGTGGAGAGCAGCTGG + Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944095384 2:195961392-195961414 GGGTGGGGCTGGTGGGTAGTGGG - Intronic
944288404 2:197977267-197977289 GTGAGGGGGCGGGGGGAAATGGG - Intronic
944395097 2:199257879-199257901 GTGTTGGGGTGGGGGGTAGTGGG + Intergenic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944604951 2:201344404-201344426 GGGTGGGGGTGGAGGGATAGGGG + Intronic
944955856 2:204807844-204807866 TTGTGGGGGTTGGGGGTAGTGGG + Intronic
945335922 2:208592499-208592521 GCCTGGGGGTGGAGCAAAGTGGG - Intronic
945998800 2:216463467-216463489 GTGCAGTGGTGGTGGGAAGTGGG - Intronic
946010940 2:216563025-216563047 GTGTGAGGGAGGTGGGAGGTGGG + Intronic
946029236 2:216691940-216691962 GTGGGGGAGAGGAGGGAGGTAGG + Intronic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
946396887 2:219447829-219447851 GGGTGGGGGTGGGGGGCAGGAGG + Intronic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947331674 2:229035455-229035477 GTGTGTGAGTAGAGGGAAGGAGG - Intronic
947447983 2:230179318-230179340 GCATGGGGGTGGAGGGTAGTGGG + Intronic
947544706 2:231002645-231002667 AAGTGGGGGTGGTGGGAAGCTGG - Intronic
947618519 2:231574087-231574109 GTGCGGGGGTGGGGGGACCTGGG - Intergenic
947885839 2:233570305-233570327 GGGTGGGGGTAGGGGGAAGTTGG - Intergenic
948004539 2:234596425-234596447 GTGTGCGTGTGGCAGGAAGTAGG + Intergenic
948266309 2:236637682-236637704 GTGTGGGGGCAGGGGGAAGATGG - Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948733158 2:239979966-239979988 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948733172 2:239980008-239980030 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948856288 2:240732056-240732078 GGATGGGGGAGGAGGGAAGGAGG + Intronic
948964601 2:241367954-241367976 ATGTGGGGGTGGAGGGTATATGG - Intronic
949033731 2:241807368-241807390 GCGTGAGGGGGGAGGGAAGCTGG - Intergenic
1168842198 20:916766-916788 GGATGGGGGTGGAGGGAAAGAGG - Intergenic
1169216258 20:3796412-3796434 GGGTGGGGGGGGGGGGAAGGAGG - Exonic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1170255201 20:14334657-14334679 GTGGGGGGTGGGAGGGAAGGGGG + Intronic
1170373640 20:15677365-15677387 ATGCGGTGGTGGGGGGAAGTGGG + Intronic
1170394906 20:15915674-15915696 GTGTGGGGGTGTAGGGAGGCAGG + Intronic
1170914352 20:20608237-20608259 GTGTGTTGGTAGAGTGAAGTAGG - Intronic
1170976601 20:21170747-21170769 GTTCGGGGGCGGAGAGAAGTGGG - Intronic
1171029418 20:21663894-21663916 GTATGGAGCTGGAGGGAAGGAGG + Intergenic
1171062773 20:21982579-21982601 GTGCTGTGGTGCAGGGAAGTGGG - Intergenic
1171869373 20:30513383-30513405 GTGTGGGGGAGGAGGGGTGGCGG - Intergenic
1171883682 20:30636171-30636193 GTGGGAGGGTGGGGGGAAGTAGG - Intergenic
1171884085 20:30639245-30639267 GTGAGAGGGTGGTGGGCAGTAGG - Intergenic
1171885499 20:30649061-30649083 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1172022460 20:31924229-31924251 ACGTTGGGGTGGAGTGAAGTGGG - Intronic
1172130305 20:32650694-32650716 GGGGAGGGGTGGGGGGAAGTTGG - Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173707928 20:45126652-45126674 GTCTGGGGGTGGGGGGAATAGGG - Intergenic
1173766139 20:45611278-45611300 GAGTGGGGGTGGTGGGAGGCGGG + Intronic
1173902618 20:46601895-46601917 GGGTGGAGGTGGTAGGAAGTGGG + Intronic
1174147911 20:48464951-48464973 GTGAGGAGGTGGAGGGGAGGGGG - Intergenic
1174189875 20:48732860-48732882 GTGGTGGGGTGGAGGGAGGGCGG - Intronic
1174531854 20:51220520-51220542 GGGTGGGGGTTGGGGGAGGTGGG - Intergenic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175172551 20:57090739-57090761 GTGTGGTGGTGGAGGTGTGTGGG - Intergenic
1175172573 20:57090856-57090878 GTGTGTGGGTGGAGGTGTGTGGG - Intergenic
1175175765 20:57110986-57111008 GTGTGGGGGAGCAGGGAAGTGGG - Intergenic
1175194568 20:57234068-57234090 GAGTGGGGGTGGGGGGACATGGG - Intronic
1175344585 20:58263620-58263642 GTATGGGGGTGGGGGTAGGTAGG - Intergenic
1175766168 20:61594255-61594277 GTGGGGGGGAAGAGGGAAGGGGG + Intronic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1175932207 20:62498339-62498361 GTGTGGGGGTGGGTGGGTGTTGG + Intergenic
1175934555 20:62509077-62509099 GTGGAGGGGTGGAGGGATGGAGG - Intergenic
1175934568 20:62509107-62509129 GTGTTGGGGTGGAGGGTTGAGGG - Intergenic
1175934736 20:62509559-62509581 GTGGAGGGGTGGAGGGATGGAGG - Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176028435 20:62998211-62998233 GGCTGGAGGTGGAGGGACGTGGG + Intergenic
1176030830 20:63010416-63010438 GGGTGGGGGAGGAGGGGAGCCGG - Intergenic
1176837846 21:13810292-13810314 GTGTGTGTGTGAAGGGATGTTGG + Intergenic
1176843870 21:13861756-13861778 GTGGGAGGGTGGGGGGTAGTAGG - Intergenic
1176845184 21:13871313-13871335 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1176846555 21:13881077-13881099 GTGGGAGGGTGGGGGGTAGTAGG - Intergenic
1176847915 21:13890870-13890892 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1176849291 21:13900629-13900651 GTGGGTGGGTGGTGGGTAGTAGG - Intergenic
1176896443 21:14383721-14383743 GTGCGGGGCCTGAGGGAAGTCGG + Intergenic
1177011806 21:15739457-15739479 GTGTGGTGGTGGAGGGGTGCTGG + Intronic
1177355982 21:20008365-20008387 GTGTGTGTGTGTAGGGAGGTAGG - Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178939024 21:36889620-36889642 GTGATGGGGTCTAGGGAAGTGGG - Intronic
1179292326 21:40029560-40029582 GTGTGAGGGTGGAGAGTAGGAGG + Intronic
1179411503 21:41167206-41167228 GGGCGGGGGTGGGGGGAAGGTGG + Intergenic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179487964 21:41722846-41722868 GTGTGTGTGCGGGGGGAAGTGGG - Intergenic
1179714525 21:43280399-43280421 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179714546 21:43280449-43280471 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1180047510 21:45316413-45316435 GGGTGGGGGTGGAGAGCATTAGG + Intergenic
1180210954 21:46295377-46295399 GGGTTTGGGTGGAGGGAAGAGGG - Intronic
1180259168 21:46656018-46656040 GTGTGGTGGTGTTGGGAGGTGGG + Intronic
1180363061 22:11916955-11916977 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1180692862 22:17731985-17732007 GTGGGGCTGTGGAGTGAAGTAGG + Intergenic
1180727988 22:17960685-17960707 GTGAGAGGGTGGGGGGAAGGAGG + Intronic
1180728137 22:17961481-17961503 GTGAGAGGGTGGGGGGAAGGAGG - Intronic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1181000925 22:19987377-19987399 GGGGGGAGGTGGTGGGAAGTGGG - Intronic
1181063268 22:20292044-20292066 GGGTGGGGGTTGGGGGCAGTAGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181167135 22:20989777-20989799 GGGTGCAGGTGGAGGGAGGTGGG + Intronic
1181477286 22:23176606-23176628 GTGTGGGGAATGAGGGATGTTGG - Intergenic
1181586789 22:23857070-23857092 GTGTGGGGGGGGGGGGGTGTAGG + Intronic
1181997162 22:26892056-26892078 GGGTGGGGGTGGGGGCAGGTAGG + Intergenic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1182707408 22:32294547-32294569 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1182808216 22:33093749-33093771 GTGTGGGGGCGGTGGGATGGAGG + Intergenic
1183338071 22:37262321-37262343 GAATGGGGTTGGTGGGAAGTGGG - Intergenic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183377055 22:37471492-37471514 GGATGGGGGTGGAGAGGAGTTGG - Intronic
1183440315 22:37819179-37819201 GAGCGGAGGTGGAGGGAAGGAGG - Intergenic
1183642689 22:39101701-39101723 GTGGGGGGGTGGCGGGGAGCGGG + Intronic
1183729962 22:39612845-39612867 GTGGAGGGATGGAGGGAAGGAGG - Intronic
1183781807 22:40003594-40003616 GTGTGGGGGTGGGGGCAGGCAGG - Intronic
1184292885 22:43507545-43507567 GTGTGCGGGTGGAGAAAAGCAGG + Exonic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184395749 22:44238000-44238022 GGGTGGGGCAGGAGGAAAGTGGG - Intergenic
1184492016 22:44815242-44815264 GTGTGGGGGAGGAGGGAGCATGG + Intronic
1184600241 22:45539130-45539152 AGGAGGGGGAGGAGGGAAGTGGG - Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
1184864835 22:47196305-47196327 GTGTCTGGGTGGAAGGAAGGAGG + Intergenic
1185110161 22:48896287-48896309 GTGATGGGGTGAAGGGCAGTGGG + Intergenic
949478904 3:4474562-4474584 GGGTGGGGGTGGAGGGCATGGGG + Intergenic
949482097 3:4503673-4503695 GTGTGGTGGGGCAGGGGAGTGGG - Intronic
949511222 3:4768779-4768801 GTGGGGGCGTGGAGGGAGCTCGG + Intronic
949634771 3:5970618-5970640 GAGTGGGGGAGAAGGGAAGAAGG - Intergenic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950422352 3:12906487-12906509 GTTTGGGGGTGAAGCGAGGTGGG - Intronic
950580516 3:13858865-13858887 GTGTGGGGGTGGAGTGGGATTGG - Intronic
950583643 3:13878808-13878830 GTGTGGGGGCGGGGGGATCTGGG - Intronic
950616819 3:14166501-14166523 GGGTGGGGGTGAAGGGAGGGTGG - Intronic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
952136342 3:30426353-30426375 GAATGGGGGTGGATGGAAGAAGG + Intergenic
952227431 3:31392724-31392746 GTGCTGAGGTGGAGAGAAGTAGG - Intergenic
952406962 3:33013642-33013664 GTGTGGGGCTGGATGCAGGTGGG + Intronic
952845125 3:37681815-37681837 GTGAGGAGATGGAGGGAAATGGG - Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
952959616 3:38581114-38581136 CTCTGGGGGTGGCGGGGAGTAGG + Exonic
953013104 3:39047039-39047061 GGGTGGGGGTGGGGGGATGGGGG - Intergenic
953046876 3:39301361-39301383 GTTGGGGGGTGGAGGAAGGTGGG + Intergenic
953254191 3:41273677-41273699 GAGTGGGGGTGTGGGGAGGTGGG + Intronic
953358624 3:42275741-42275763 GTGTGGGGGTCTAGGGGAATGGG + Intergenic
953371486 3:42392276-42392298 GTGTGGGGGTAGACAGATGTGGG + Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953507247 3:43498344-43498366 TTGCAGGGGTGGAGGGCAGTTGG - Intronic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953699341 3:45183903-45183925 GGGTTGGGGTGGAGGGCAGTGGG + Intergenic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
953772945 3:45792718-45792740 GTGTGGGGTTGGGGAGAGGTGGG - Intronic
953927447 3:46989613-46989635 GTTTGGGGGTGGAGCCAAGTGGG - Intronic
953974382 3:47371376-47371398 GGGTGGGGGTGGGGGGGAGGGGG - Intergenic
954060476 3:48062101-48062123 GTGTCTGTGTGGAGAGAAGTGGG + Intronic
954976918 3:54704828-54704850 GTGTTGGGTAGGAGGGAGGTAGG - Intronic
955131329 3:56171933-56171955 GTGTGGAGGTGGATGGAAGGGGG + Intronic
955618381 3:60833784-60833806 GGGTGGAGTGGGAGGGAAGTGGG - Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
955728116 3:61954161-61954183 GTTTGGTGGAGGCGGGAAGTTGG - Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956057843 3:65319318-65319340 TTGGGGGGTGGGAGGGAAGTAGG + Intergenic
956260153 3:67330282-67330304 CTGTGAGGGTCGAGGGAAGCAGG - Intergenic
956305420 3:67819125-67819147 GTGTGGGGTGGGCGGGAAGCAGG + Intergenic
956456023 3:69421159-69421181 GTGTGAGGGTGGAGGAAAAGGGG - Intronic
956606576 3:71078990-71079012 GAGTGGGCGTGGTAGGAAGTGGG - Intronic
956867105 3:73380714-73380736 GTGGGGGGGTGGGGGGAGGGGGG - Intergenic
956990496 3:74757420-74757442 GGGCTGGGATGGAGGGAAGTGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957037058 3:75303130-75303152 GAGTAGGGGTGGAGGAAAGGGGG + Intergenic
957646765 3:82939971-82939993 TTGGGGGGGTGGGGGGAGGTTGG - Intergenic
957878844 3:86183978-86184000 GTGTGCTGGTGGAGGAAAGGTGG - Intergenic
959011459 3:101081636-101081658 GTGTGGGGGTGGGGGTAGGGGGG + Intergenic
959019164 3:101169408-101169430 GAATGGGGGTGGTAGGAAGTGGG + Intergenic
959539644 3:107524138-107524160 GGGTGGTGGTGGAGGGGAGGAGG + Intronic
959781119 3:110234295-110234317 GGGGGTGGGTGGAGGGAAGGGGG + Intergenic
959900622 3:111657500-111657522 GGGTGGGGGTGGTGGGAACAAGG + Intronic
959991761 3:112638858-112638880 CTCTGGGGGTTGAGGGAGGTTGG + Exonic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960580892 3:119277924-119277946 GTGGGGGGGTGGGTAGAAGTGGG - Intergenic
960615672 3:119593807-119593829 GTTTGGGGGTGTGGGGTAGTCGG + Intergenic
960786027 3:121373515-121373537 GGGTGGATGTGGAGGGATGTTGG - Intronic
961161081 3:124726644-124726666 GTGGGGGGTTGGGGGGACGTGGG - Intergenic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961441862 3:126958144-126958166 GGGTGGGGGAGGAAGGCAGTAGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961649884 3:128412036-128412058 GTGTGGGAGTGGGGTGAAGGAGG + Intergenic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
962170240 3:133094223-133094245 GTGTGGGGGGGGTGGGGGGTGGG - Intronic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962490637 3:135890756-135890778 GGGTGGGTGTGGATGGTAGTGGG - Intergenic
962527213 3:136247629-136247651 GGGTGGGGGTAGGAGGAAGTTGG - Intergenic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962758104 3:138483725-138483747 GGGTGAGGGTGGAGGGGAGGTGG - Intergenic
962924356 3:139977702-139977724 GGGAGGGGGTGGGGGGCAGTGGG + Intronic
963215023 3:142735790-142735812 GTGTTGGGAGGGTGGGAAGTAGG + Intronic
963437113 3:145286040-145286062 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
963576489 3:147066815-147066837 ATTTGGGGGTGGAGGGCAGGGGG + Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
964824257 3:160808329-160808351 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
964824267 3:160808419-160808441 GTGTGGTGGGTGAGGGAAGCTGG + Intronic
965268480 3:166580950-166580972 TTGTGGGCGTGGATGGAAATAGG + Intergenic
965308290 3:167096370-167096392 GGGTGGGGGAAGAGGGAATTTGG + Intergenic
965311643 3:167135358-167135380 GGGTGGGGGGAGAGGGGAGTGGG + Intergenic
965381052 3:167988625-167988647 GTGTGTGTGTGGTGGGATGTGGG - Intergenic
966026294 3:175286973-175286995 TGGTGGGGGTGGAGGGGTGTGGG + Intronic
966206574 3:177412599-177412621 GTGTCTGTGTGGAGAGAAGTGGG - Intergenic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967171979 3:186828767-186828789 GGGTGGGGGTGGGGGGCAGGGGG + Intergenic
967844886 3:194035538-194035560 TTGTGTGGGAGGAGGGCAGTGGG - Intergenic
968051886 3:195660159-195660181 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
968292671 3:197550740-197550762 GGGTGGAGGTGGAGGGAGGGAGG + Intronic
968545048 4:1194172-1194194 GGCTGGGGGTGGAGGGAGGCCGG - Intronic
968642443 4:1721375-1721397 GGGTGGGGGGGGAGGGAGGGCGG + Intergenic
968950042 4:3685942-3685964 GTGTGGGGGGGGTGGGTGGTAGG - Intergenic
969084537 4:4646076-4646098 GTGTAGGGGTGCTGGGGAGTAGG + Intergenic
969122357 4:4919639-4919661 GTGTGTGGGGGTAGGGAGGTGGG + Intergenic
969275003 4:6128908-6128930 GTGTGGGGGTTCTGGGCAGTGGG - Intronic
969370405 4:6727826-6727848 GGGTGGGGGAGGAGGGGAGGGGG - Intergenic
969370417 4:6727846-6727868 GGGTGGGGGAGGAGGGGAGGGGG - Intergenic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969548453 4:7848065-7848087 GTGAGTGGGTGGACGGAAGGAGG + Intronic
969622265 4:8284529-8284551 GTGTGGGCATGGAGGCCAGTGGG + Intronic
969622539 4:8285897-8285919 GGGTGAGGGTAGAGGGAGGTGGG + Intronic
969643554 4:8413175-8413197 GTGCAGGGGTGGAGGGAGATGGG - Intronic
969643677 4:8413621-8413643 GTGGAGGGGTGGAGGGAGATGGG - Intronic
969661578 4:8532673-8532695 GGGTGGGGGTGAGGGGAGGTGGG + Intergenic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
969797197 4:9535502-9535524 GTGGGGGGGTGCAGGGTAGGGGG + Intergenic
969939862 4:10721187-10721209 GTTGGGGGCTGGAGGGAACTGGG + Intergenic
970512877 4:16798602-16798624 GTGTGAGGGAAGAGGGAGGTGGG - Intronic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
970637184 4:18021988-18022010 GGGAGGGGGAGGAGGGTAGTGGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970867827 4:20779570-20779592 GTGTGGGGGGGGGGGGTTGTGGG - Intronic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
970980861 4:22095417-22095439 GTGTGTGGGTGGAGTGGGGTAGG + Intergenic
971195007 4:24464819-24464841 GTGGAGGGGAGGAGGGAAGCGGG - Intergenic
971337021 4:25732736-25732758 GTGTGTGTGTGGTGGGGAGTCGG + Intergenic
971442274 4:26699859-26699881 GTTTTGGGGTGGGGGGAAGGGGG + Intronic
971527462 4:27639041-27639063 GTTGTGGGGTGGAGGGAGGTGGG - Intergenic
972242555 4:37208935-37208957 GTGTGGAGGTGGAGGGAGGGAGG - Intergenic
972351685 4:38242155-38242177 GGCTGGGGGTGGAGTGAAGTAGG - Intergenic
972355043 4:38272610-38272632 GTGTGGGGGTAGAGGGCATATGG - Intergenic
972557218 4:40193522-40193544 GGGTGGGGGAGGAGGGGAGTGGG + Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973068339 4:45825066-45825088 GTGTTGGGGTGGAGGGAGGGGGG + Intergenic
973367338 4:49218442-49218464 GTGGGAGGGTGGGGGGAAGTAGG - Intergenic
973392367 4:49567238-49567260 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
973682465 4:53334597-53334619 GTGGTGGGGTGGGGGGAAGGGGG + Intronic
973862283 4:55077631-55077653 GTGTGGGGGTGGTGTGTGGTGGG + Intergenic
974276095 4:59722821-59722843 GTTGTGGGGTGGAGGGAGGTGGG + Intergenic
974376576 4:61085463-61085485 GTGTGGGGATGGAGGAATTTTGG - Intergenic
974588373 4:63912011-63912033 GTGTGGGGTAGGTGGGAACTGGG - Intergenic
974714010 4:65642315-65642337 GTGTGATGGTGCAGGGAAGAAGG + Intronic
974799582 4:66799727-66799749 GTGGTGGGGTGGGGGGAGGTGGG + Intergenic
974825051 4:67117447-67117469 GTCAGGGGGTGGAGGGAAAAGGG + Intergenic
974898375 4:67967558-67967580 GTGGTGGGGTGGGGGGAGGTGGG - Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975069587 4:70117830-70117852 GTCATGGGGTGGAGGGAAGGGGG - Intergenic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975479190 4:74858771-74858793 GTGTGAAGGTGTAGGGAGGTTGG - Intergenic
975495084 4:75028328-75028350 ATGTGCTGGAGGAGGGAAGTGGG - Intronic
975656133 4:76642800-76642822 GGGTGGGGGAGGAGGGTAGTGGG + Intronic
975688348 4:76940507-76940529 GTGTGGTGGTGTTGGGAGGTAGG + Intergenic
975792645 4:77971176-77971198 GTCTGGGGGTGGGGGGAAAGGGG + Intergenic
975985402 4:80197560-80197582 TTGGGGGGGTGGAGGGAGGGAGG - Intronic
976009607 4:80471574-80471596 GGGTGGGGGTGGGGGGGAGCAGG + Intronic
976226201 4:82797518-82797540 GAGTGGGGGTGCACGGAAGGAGG + Intronic
976310537 4:83607483-83607505 GAGGTGGGGTGGAGGGAAGTGGG + Intergenic
976410313 4:84705921-84705943 GGGCGGGGGTGGAGGGAGGGAGG - Intronic
976628849 4:87217337-87217359 TTTTGGGGGTGGGGGGAAATAGG + Intronic
976727915 4:88233151-88233173 TTGGGGAGGTGGGGGGAAGTGGG - Intergenic
976936867 4:90646947-90646969 GTGTTGGGGTGGGGGGATGAGGG - Intronic
977023392 4:91786170-91786192 GTGGTGGGGTGGAGGGAGGGCGG - Intergenic
977247753 4:94653611-94653633 GGGAGGGGGGAGAGGGAAGTTGG + Intronic
977539082 4:98293676-98293698 GCGGGGGCGTGGAGGGAAGTAGG - Intronic
978156819 4:105499212-105499234 GTGGTGGGGTGGGGGGAAGGGGG - Intergenic
978234701 4:106444858-106444880 GTGTGAAGGTGGTGGGAGGTGGG + Intergenic
978244628 4:106558234-106558256 GTTGTGGGGTGGAGGGAAGCGGG - Intergenic
978459139 4:108930626-108930648 GTGTGGGAGAGAAGGGAAGCAGG + Intronic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
979100904 4:116612996-116613018 GTGGGGGGGAGGGGGGATGTGGG - Intergenic
979120744 4:116897257-116897279 GCTTGGGGGTGGAGGGAGATGGG - Intergenic
979270841 4:118759741-118759763 GTGGGTGGGAGGAGAGAAGTTGG - Intronic
980094848 4:128478972-128478994 TGGAGTGGGTGGAGGGAAGTAGG - Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
980588716 4:134855094-134855116 GTGTGGGGGGCGGGGGTAGTGGG + Intergenic
980669814 4:135990267-135990289 GTGGGGGGTTAGAAGGAAGTGGG - Intergenic
981010278 4:139918321-139918343 GTGTGGTGGTGAAGGGGAGAAGG - Intronic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981474357 4:145173559-145173581 GTGTGGTAGAGAAGGGAAGTGGG - Intronic
981509866 4:145544197-145544219 GTGTGGGGGTGGGGGGCATATGG + Intronic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
981724678 4:147834739-147834761 GTGTGAGGGTGGGGGCAGGTGGG - Intronic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
981865670 4:149415898-149415920 GTCGTGGGGTGGAGGGAGGTGGG + Intergenic
982209078 4:153020485-153020507 GAGTGGGGAAGGAGGGGAGTGGG - Intergenic
982220026 4:153116306-153116328 GAGGTGGGGTGGAGGGAAGTGGG - Intergenic
982852199 4:160332722-160332744 AGGTGGGGGTGAAGAGAAGTTGG - Intergenic
983562842 4:169118173-169118195 ATGTGGAGCTGGAGGCAAGTAGG - Intronic
983711789 4:170726199-170726221 GTGAGGTGGTGGAAGGAAGGTGG + Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
984384415 4:179036225-179036247 GTTTTGGGGTGGGGGGAGGTGGG + Intergenic
984758570 4:183345023-183345045 GTGGAGAGGTGGAGAGAAGTGGG + Intergenic
984888865 4:184473960-184473982 GTGTGGGGGTGCAGGTCAGCTGG - Intronic
985010442 4:185577147-185577169 GTGTGTGTGTGGAAGGATGTCGG + Intergenic
1202766248 4_GL000008v2_random:150793-150815 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
985542134 5:492168-492190 GTGGGGGAGGGGAGGGATGTCGG + Intronic
985649709 5:1101776-1101798 GTCGGGGGGTGGAGGGGGGTCGG - Intronic
985812289 5:2098992-2099014 GTGTGGGGCTGCAGAGGAGTTGG - Intergenic
985968001 5:3352258-3352280 GTGTGTGGGTTGAGGGAGGGGGG + Intergenic
986028222 5:3871025-3871047 GGGTGAGGGTGGTGGGAAGCTGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986311139 5:6551927-6551949 GGGCGGGGGCGGGGGGAAGTAGG - Intergenic
986721723 5:10564875-10564897 GTGGTGGGGAGGAGGGGAGTGGG - Intronic
986898795 5:12406008-12406030 GTGTGAGGGTAGGGGGAAGATGG - Intergenic
987242541 5:16015561-16015583 GTGCTGGGGTGGAGGGAGGCTGG - Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
987301267 5:16599983-16600005 GCGTGGGGGTGGAAGGAACTGGG + Intronic
987596023 5:20000074-20000096 GTGAGGGGGTGGGAGGCAGTAGG + Intronic
987880190 5:23734432-23734454 GTGGTGGGGTGGGGGGAAGGGGG - Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988081986 5:26426462-26426484 TTGTGGGGGTGGGGGGGAGGGGG + Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
988548192 5:32176689-32176711 GGGTGGGGGTGGAGGGCAGCTGG + Intergenic
988609429 5:32711195-32711217 GGGTGGGGGTGGGGAGATGTGGG - Intronic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
989122749 5:38020656-38020678 ATGTGGGGATGGATGGGAGTAGG - Intergenic
989672213 5:43932068-43932090 GTCAGGGGGTGGGGGGAGGTAGG - Intergenic
989813271 5:45704317-45704339 GTCAGGGGGTGGGGGGAAGGGGG - Intergenic
990363328 5:55043733-55043755 GTGTTGGGGTGTGGGGGAGTGGG - Intergenic
991350179 5:65713254-65713276 GTGAGGGGGAGGAAGGAAGAAGG - Intronic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
991555977 5:67895461-67895483 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
991584780 5:68190810-68190832 GTGTGTGGGTGGAGGGTTGGGGG - Intronic
991707102 5:69369213-69369235 GGGGGGGGGTGGAGAGAGGTCGG - Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992215426 5:74520202-74520224 GGGTGGGGGTGGGGGGCAGGAGG + Intergenic
992365046 5:76082814-76082836 GGGTGGGGGCTGGGGGAAGTAGG + Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992753175 5:79879866-79879888 GTTGTGGGGTGGGGGGAAGTGGG - Intergenic
992775064 5:80082173-80082195 GTGTGTGTGTGGAGGGGGGTGGG - Intronic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993500403 5:88660470-88660492 GTGTGGTGGTGGCGGGGAGGGGG + Intergenic
993888849 5:93448045-93448067 GTCGTGGGGTGGAGGGAAGGGGG + Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
994474794 5:100253161-100253183 GTGTGGGGGTGGTGGGTGGGTGG - Intergenic
994737699 5:103576052-103576074 GTGAGTGGGTGGAGTGAGGTAGG - Intergenic
995055097 5:107750429-107750451 ACGTGGGGGTGGAGGCAAATTGG - Intergenic
995314222 5:110749498-110749520 GTGTGGGAGCGGTGGGAAGGGGG + Intronic
995540086 5:113177085-113177107 GTGTGGGGGTGGGAGCAGGTAGG - Intronic
995612896 5:113929390-113929412 GTTGGGGGGTGGAGGGAGGGGGG - Intergenic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996444993 5:123537428-123537450 GTGAGGGGGTGGGAGGGAGTGGG + Intronic
996621298 5:125506935-125506957 GTCTGGGGGTGGAGGGAAAGGGG - Intergenic
996634806 5:125676778-125676800 GTGTTGGGGTGGGGGGGGGTAGG + Intergenic
996800559 5:127398061-127398083 GTCTGGGGGTGGGGGGAAAGGGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996923353 5:128794781-128794803 GGTTGGGGGTGGAGGGAGGGGGG - Intronic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997220930 5:132163283-132163305 GGCTGGGGGTGCTGGGAAGTTGG - Intergenic
997448740 5:133964409-133964431 GGGTGAGGTAGGAGGGAAGTGGG + Intronic
997777472 5:136624115-136624137 GTGTGGTGGTGGTGGGCAGTGGG - Intergenic
997833070 5:137169193-137169215 GTGAGGGGTTGGGGGGAAGTGGG + Intronic
997862594 5:137431531-137431553 GTGTGGTGGTGTTGGGAGGTGGG + Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998163285 5:139825679-139825701 GTGTGGGGGTGGTGGTGAGTGGG + Intronic
998377626 5:141701791-141701813 CTCTGGGGGTGGAACGAAGTGGG - Intergenic
998406046 5:141875495-141875517 GGGTGGGGGAGGAGCTAAGTGGG - Intronic
998707736 5:144782959-144782981 GCGGGGGGGTGGGGGGAAGAGGG + Intergenic
998849278 5:146338585-146338607 GTGTGGTGGAGAGGGGAAGTTGG + Intronic
999064835 5:148674326-148674348 GTCTGGGGGTGGAGCCAAGATGG - Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999268799 5:150284471-150284493 GTGTGCTTGTGGAGGGAGGTGGG + Intronic
999455233 5:151709737-151709759 GAGTGGGGGTGGCGGGGGGTGGG + Intergenic
999590862 5:153143760-153143782 CTGTGGTGGTGGTGGCAAGTTGG - Intergenic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000166876 5:158658459-158658481 GGGTGGTGGTGGTGGTAAGTGGG + Intergenic
1000305665 5:159992139-159992161 GGTTGGGGGTGGAGGGATGATGG + Intergenic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000975446 5:167759542-167759564 GTGGGGAGGTGCAGGTAAGTGGG + Intronic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001230008 5:169978389-169978411 GTGTGGGGGGGGGGGGGTGTAGG + Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001403672 5:171461211-171461233 GTGGGGAGGGGGAGGGCAGTGGG + Intergenic
1001403681 5:171461229-171461251 GTGGGGAGGGGGAGGGCAGTGGG + Intergenic
1001633564 5:173194243-173194265 GTGAGGGAGTGGAGGGATCTGGG + Intergenic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001753473 5:174148643-174148665 GTATGAGGGTGGAGAGAGGTGGG - Intronic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1001900177 5:175420589-175420611 GTGTGTGGGTGGATGAAAGGAGG - Intergenic
1001942602 5:175751197-175751219 GTGGGGGGGTGGGGGGGGGTGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001959855 5:175873100-175873122 GGGTGGGGGTGGGTGGGAGTGGG - Intronic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002257498 5:177968933-177968955 ATGTGGTGGTGGTGGGAGGTGGG - Intergenic
1002406989 5:179042453-179042475 GGGAGGGTGAGGAGGGAAGTAGG + Intergenic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002791611 6:441488-441510 GTGTGGGAATGGAGGGCTGTGGG - Intergenic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1002897786 6:1389498-1389520 GGGTGGGGGGGGAGGGAGGGAGG + Intergenic
1003098527 6:3159742-3159764 GGGTGGGGGTGGGGAGAAGGTGG - Intergenic
1003122437 6:3329158-3329180 TTGTGGGGGATGAGGGAGGTGGG - Intronic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003386128 6:5669366-5669388 GCGGGGGGGTGGGGGGAGGTGGG - Intronic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004022047 6:11784822-11784844 GAGTGGGGGTTGGGGAAAGTTGG + Intronic
1004194463 6:13490679-13490701 GTGTTGGGGTGGGGGGAATGGGG - Intergenic
1004331630 6:14727207-14727229 GTATGGGGGTGGAGGGAAATAGG + Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1005111359 6:22285352-22285374 TTGGGGGGGTGGGGGGAGGTTGG + Intergenic
1005379417 6:25218242-25218264 GGGTGGGGGTGGTGGGGAGCAGG - Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1005705770 6:28451241-28451263 GTGTGGGGGTGAAGAGAGGTTGG - Intergenic
1005907559 6:30277748-30277770 GTGGGGGGCTGAAGGGAAGGTGG - Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006065403 6:31457841-31457863 GTGTGGGGGTGGGAGTGAGTAGG + Intergenic
1006175628 6:32119797-32119819 GTGTTGGGGAGGAGAGAAGTAGG - Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006829556 6:36960646-36960668 GGGTGGGGGTAGAGGGAGGGGGG - Intronic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1007022588 6:38536825-38536847 TGCTGGGGGTGGAGGAAAGTGGG + Intronic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1007622266 6:43222439-43222461 GTGGTGGGGTGGAGGGGGGTGGG + Intronic
1007745689 6:44041714-44041736 CGCTGGGGGTGGAGGGAGGTGGG - Intergenic
1007757758 6:44111425-44111447 GGATGGTGGTGGAGGGCAGTGGG - Intergenic
1007823704 6:44581450-44581472 GGGTCGGGGTGGAGAGAATTTGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007907595 6:45477927-45477949 GTGTGTGGGTGGAAGGCAGTTGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1008222180 6:48868256-48868278 ATGTGGGGGTGGGAAGAAGTTGG + Intergenic
1008333769 6:50275082-50275104 GTCATGGGGTGGAGGGAAGGGGG - Intergenic
1008497259 6:52145714-52145736 TTGGGGGGGTGGAAGGAACTTGG + Intergenic
1008957640 6:57233584-57233606 GGGAGGGGGAGGAGGGAAGGAGG - Intergenic
1009035444 6:58112329-58112351 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009211259 6:60865921-60865943 GTATGGGGAGGTAGGGAAGTGGG - Intergenic
1009303132 6:62052603-62052625 GGGTGGGGGTGGAGGAGGGTGGG + Intronic
1009483976 6:64196740-64196762 GTGGTGGGGTGGAGGGAGGGGGG + Intronic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009796994 6:68481774-68481796 GTAGGAGAGTGGAGGGAAGTGGG + Intergenic
1009883348 6:69596600-69596622 GTGTGGTGGTAGTGGGAGGTGGG - Intergenic
1010018382 6:71130950-71130972 GTGGTGGGCAGGAGGGAAGTGGG - Intergenic
1010103600 6:72141357-72141379 TTGAGGGGGAGGAGGGAATTTGG - Intronic
1010486413 6:76419837-76419859 GTGTGGGGGTTGAGGTGAGGAGG + Intergenic
1010582187 6:77613652-77613674 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1011176293 6:84564479-84564501 GTTGGGTGGTGGAGGGGAGTGGG + Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1011723512 6:90184467-90184489 GTGAAGGGGTGGAGGGAGGAAGG - Intronic
1011785783 6:90843112-90843134 GGGTGGGGGTGGAGTGGAGATGG + Intergenic
1011997623 6:93613120-93613142 GTGGGGCGGTGGGGGGAAGAGGG + Intergenic
1012338558 6:98090339-98090361 GTGTGTGGGTGGGGGAAAGTGGG + Intergenic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013115310 6:107099091-107099113 GTGTGTGGGTGGAGGGGGATGGG + Intronic
1013317815 6:108958635-108958657 GTCTGGGGCTGGAGGAAACTAGG + Intronic
1013429589 6:110043742-110043764 GTGTGGGGGAGAAGGGGAGCTGG - Intergenic
1013468504 6:110439104-110439126 GTTTGGGGCTGGTGGGAATTTGG - Intronic
1013590402 6:111615026-111615048 GGGCTGGGGAGGAGGGAAGTGGG + Intergenic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015228127 6:130882211-130882233 GTGTGGGGGAGGAGGGAAGGAGG - Intronic
1015555681 6:134459231-134459253 GTGTGGGGGTTGAGGAAATTGGG - Intergenic
1016174462 6:141062211-141062233 AGGTGGGGGTGGGGGGAAGATGG + Intergenic
1016272433 6:142303370-142303392 GTGTTGGGGAGTGGGGAAGTAGG - Intronic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1016762495 6:147753689-147753711 GTGAGGGGCTGGGGGGAAGGTGG - Intergenic
1016923391 6:149317637-149317659 GGGTGGGGGCAGAGGGAGGTGGG + Intronic
1017113382 6:150953365-150953387 GTGTGGGGGTGGAGGCAGCCGGG - Intronic
1017540177 6:155393603-155393625 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1017597071 6:156039998-156040020 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1018094752 6:160375449-160375471 GCTTGGGGGTGGAGGGTGGTGGG - Intronic
1018266412 6:162029178-162029200 GTGTGGGGGTGGAGGTGGGTGGG - Intronic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018458632 6:163976136-163976158 GTTGTGGGGTGGAGGGAAGGGGG - Intergenic
1018715487 6:166529417-166529439 GTGGTGGGGTGGAGGGATGGGGG + Intronic
1018739654 6:166717601-166717623 GCGTGGGGTTGGAAGGGAGTGGG + Intronic
1018813800 6:167316524-167316546 GTGGGGGGGGGCAGGGAAGGCGG - Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1019044943 6:169138506-169138528 GTGTGCGGGGTGAGGGAGGTAGG + Intergenic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020035277 7:4959942-4959964 GTGGGGGGTTGGTGGGAAGAAGG + Intergenic
1020035336 7:4960093-4960115 GGGTGGGGGGAGTGGGAAGTGGG + Intergenic
1020092941 7:5351477-5351499 GTGCGGGGGTGGGGGGAACTCGG + Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020269608 7:6586299-6586321 GTCTGGGGGAGGAGGGAATGGGG - Intronic
1020283541 7:6663779-6663801 GTGGGGGGGTGAAGGGAAGAGGG + Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020441098 7:8217365-8217387 GTGTAGAGGTGGAGGGAAGGAGG - Intronic
1020510743 7:9054011-9054033 GTCATGGGGTGGCGGGAAGTGGG - Intergenic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1020718209 7:11705585-11705607 AGTTGGAGGTGGAGGGAAGTAGG + Intronic
1020989742 7:15182190-15182212 GTTTGGGGGAAGAGGGAAGTGGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021345158 7:19518217-19518239 TTGTGGGGTTGGGGGGAAGGGGG + Intergenic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021632279 7:22659211-22659233 TTGGGGGGGTGGGGGGAAGTGGG - Intergenic
1021993936 7:26161760-26161782 GGATGGGGGTGGAGGTAGGTTGG + Intronic
1022118900 7:27287714-27287736 GGGTGGGGGTTGGGGGAGGTAGG + Intergenic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022313286 7:29218188-29218210 GTGAGGGGGTGGAAGGGGGTGGG - Intronic
1022363534 7:29685677-29685699 GGCTGGGGGAGGAGGGAAGGTGG - Intergenic
1022378716 7:29840132-29840154 GTGGGTGGGTGGTGGGTAGTGGG - Intronic
1022395155 7:29981659-29981681 GTATGGGGCTGAAGGGAACTGGG - Intronic
1022427753 7:30284848-30284870 GGCTGGGGGAGGAGGGAAGGTGG + Exonic
1022697840 7:32728067-32728089 GGCTGGGGGAGGAGGGAAGGTGG + Intergenic
1022780710 7:33579749-33579771 GTGAGGAGGTGGAGGGAATTGGG - Intronic
1023127011 7:36964713-36964735 ATGTGGAGGAGGAAGGAAGTAGG - Intronic
1023346028 7:39271987-39272009 GTGTGGGGGTGGGGGAGAGGGGG + Intronic
1023773908 7:43584674-43584696 GGGTGGGGGTGTAGGGAGGGTGG + Intronic
1024213730 7:47228814-47228836 GTTTGGAGGTGGAGGGAGGCGGG - Intergenic
1024317457 7:48035252-48035274 GTGTGGGGGCGTGGGGACGTGGG - Intergenic
1024712262 7:52029430-52029452 GTGTGGGTGTGGATGGATGGTGG - Intergenic
1024830797 7:53453607-53453629 TTCTGCGGGTAGAGGGAAGTGGG + Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025154389 7:56590658-56590680 GTGGTGGGGTGGGGGGAAGGGGG + Intergenic
1025819332 7:64947690-64947712 GTGTGGGGGCGGAGGGGACGCGG + Intergenic
1025960894 7:66220666-66220688 GTGTGGGGGTGGTGGGTGGGTGG + Intronic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026411979 7:70132761-70132783 GTATGTGGGGGTAGGGAAGTGGG + Intronic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026656438 7:72260775-72260797 GTGCTGTGGTGGGGGGAAGTGGG - Intronic
1026911632 7:74094717-74094739 GTGGGGCGGAGGACGGAAGTTGG - Intronic
1027047166 7:74998688-74998710 TGGTGGGGGTGAAAGGAAGTTGG + Intronic
1027704298 7:81510137-81510159 GGGTGGGGGTGGGGGGTGGTGGG + Intergenic
1027711044 7:81601742-81601764 GTGTGGTGGTGTTGGGAGGTGGG + Intergenic
1028086864 7:86645997-86646019 GTGGGGGGGTGGGGGGGGGTGGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028520080 7:91720706-91720728 CTGTGGTGGTGGCTGGAAGTAGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029537944 7:101166775-101166797 GTGGGGGGGAGGACGGAAATGGG + Intergenic
1029852266 7:103475328-103475350 GTGCGGGGGTGGGGGGAGTTGGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030330834 7:108268616-108268638 GGGTGGGGGTGGGGGGGGGTTGG + Intronic
1030338176 7:108347917-108347939 GTATGGGGGTGGAGAGGAGGCGG - Intronic
1031135755 7:117882429-117882451 GTGCTGGGGCAGAGGGAAGTGGG + Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031502191 7:122532519-122532541 GGGTGGGGGTGGGGAGAGGTCGG - Intronic
1031751746 7:125583410-125583432 GGCTGGGGGAAGAGGGAAGTAGG - Intergenic
1032020811 7:128406282-128406304 GTGTGGGGGTGTGGGGGGGTGGG - Intronic
1032076483 7:128838482-128838504 GTGTGGGGGTGGGGGGAGGCTGG + Intronic
1032091853 7:128915240-128915262 GGGTGGGGGCGGAGGGGAGGGGG - Intergenic
1032096074 7:128939038-128939060 GGGTGGGGGCGGAGGGGAGGGGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032285461 7:130535730-130535752 GGGTTGGGGTGGGGTGAAGTGGG + Intronic
1032488625 7:132307142-132307164 GTGTGGGGTTGTAGGGATATTGG - Intronic
1032967564 7:137118605-137118627 GTGATGGGGTGGGGGGAAGGGGG - Intergenic
1033291984 7:140093352-140093374 TTGTGGGGGAGAAGGGAAGGAGG - Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1034117480 7:148596807-148596829 GAGTGGGGGAGGAAGGGAGTGGG - Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034445784 7:151113571-151113593 GACTGGGGGTGGAGGAAAGTGGG + Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034749784 7:153557963-153557985 GTCTGGGGTTGGAGGGATATGGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034994837 7:155571037-155571059 GTGGGGGTGGGGAGGGAGGTGGG - Intergenic
1034997398 7:155586910-155586932 GTGTGGGGGTGGAGGCATTGGGG - Intergenic
1035098715 7:156378757-156378779 GTCTGGGGGTGTAGGGGAGGAGG + Intergenic
1035122375 7:156579249-156579271 GTGGGGGGGCGGGGGGGAGTGGG + Intergenic
1035278954 7:157765466-157765488 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035279069 7:157765961-157765983 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035389818 7:158496917-158496939 GGGAGGGGGTGCAGGGAAGGGGG - Intronic
1035404904 7:158590330-158590352 GTGTGGGGGTGTCGGGAGGCTGG + Intergenic
1035436508 7:158863776-158863798 GTGTGGGGGCGGGGGGGAGCGGG + Intronic
1035683808 8:1508377-1508399 GTGGGGGGGTGGGGGGTGGTGGG - Intronic
1035860629 8:3024293-3024315 TTTTGGGGGGGGAGGGCAGTGGG + Intronic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1036243092 8:7095229-7095251 GTGGGGGGGTGGAGGGTGGGGGG + Intergenic
1036544816 8:9757482-9757504 GTCAGGGGAAGGAGGGAAGTGGG - Intronic
1036678424 8:10853176-10853198 GTGTGGGAGGGCAGGGAAGGTGG + Intergenic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037255931 8:16953556-16953578 GTGTGGGGATGAAAGGAGGTGGG + Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037439088 8:18895957-18895979 GTGTGGAGGGGAAGGGGAGTAGG - Intronic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1037654202 8:20868889-20868911 GGGAGGGAGTGGAGGGAGGTGGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1037768967 8:21788025-21788047 GTGGGGGGCTGGCGGGAGGTCGG - Intronic
1037921322 8:22808189-22808211 GTGGGTGGATGGATGGAAGTTGG - Intronic
1038038899 8:23707450-23707472 GAGTGGGGGTGGGGGGGGGTGGG + Intergenic
1038127539 8:24691342-24691364 GTGTGGGGGTGGAGGGTCGGGGG - Intergenic
1038355111 8:26821740-26821762 GGGTGGGGCAGAAGGGAAGTGGG - Intronic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1038482880 8:27913857-27913879 GTGCAGAGGTGGAGGAAAGTTGG - Intronic
1038485370 8:27931394-27931416 GCGAGGGGGTGGTGGGAGGTGGG - Intronic
1038935596 8:32246805-32246827 GGATGGGGGTGGAGGGAATGGGG + Intronic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039610644 8:38916396-38916418 GTGGGGGGCTGGGGGGAAATGGG - Intronic
1039913534 8:41843404-41843426 GTGTGGGGTGGGCGGGGAGTGGG - Intronic
1040017090 8:42708525-42708547 GTGTGTGTTTGGAGGGAGGTGGG + Intronic
1040102283 8:43516396-43516418 GTGGGAGTGTGGAGGGTAGTAGG + Intergenic
1040102707 8:43519485-43519507 GTGGGAGGGTGAAGGGTAGTAGG + Intergenic
1040103064 8:43521993-43522015 GGGTGGGGGTAGTAGGAAGTGGG + Intergenic
1040921419 8:52624016-52624038 TTGAGGGGTTGGAGGGATGTGGG + Intronic
1041256801 8:55985799-55985821 GTGTGTGGTTGGATGGAAGGGGG + Intronic
1042077335 8:65010455-65010477 GTGTGTGGGTGGCAGGGAGTAGG - Intergenic
1042179117 8:66067196-66067218 ATGTGGGGGTGGGGGGCGGTGGG - Intronic
1043719756 8:83533139-83533161 GTGGTGGGGTGGGGGGAGGTGGG - Intergenic
1043827902 8:84951572-84951594 GTCGTGGGGTGGAGGGCAGTGGG - Intergenic
1043930599 8:86086494-86086516 GTGTAGAGGTGGGGGAAAGTAGG + Intronic
1043991000 8:86754526-86754548 TTGTGGGGGTGGGGGGAAAGGGG - Intergenic
1044352865 8:91186797-91186819 GTGTGGGGGTGGTGAGGAGGTGG + Intronic
1044712601 8:95072218-95072240 GTCTGGGGGTGCTGCGAAGTAGG - Intronic
1044973397 8:97641794-97641816 GGATGGGGGTGGAGGGTGGTGGG - Intergenic
1045519822 8:102894108-102894130 GTGTGGGGGTTGGGGAAGGTAGG - Intronic
1045591449 8:103603142-103603164 GTGTTGGGGTGGGGGGAGGGGGG - Intronic
1046227812 8:111307968-111307990 GTGTGGCAGTGTTGGGAAGTGGG - Intergenic
1046254804 8:111681945-111681967 TTGTGGGGGGGTAGGGTAGTGGG - Intergenic
1046437581 8:114212228-114212250 GAATGGGGGTGGAGGGAAAGAGG + Intergenic
1046468730 8:114640262-114640284 GTTTTGGGGTGGGGGGAAGGGGG - Intergenic
1046781318 8:118218509-118218531 GGGTGGGGGTGGGGAGATGTTGG - Intronic
1047291576 8:123535754-123535776 TTGTGGGGGTTGAGGGAGTTAGG - Intronic
1047300748 8:123611886-123611908 GTGTGCATGTGTAGGGAAGTAGG + Intergenic
1047646902 8:126879062-126879084 GGATGGGGTTGGAGGGGAGTGGG - Intergenic
1047827044 8:128588117-128588139 GTGAGGGGGTGGAAGGAGGGTGG - Intergenic
1047845500 8:128801229-128801251 GGGTGGGGGTGGAGCCAAGATGG + Intergenic
1048070691 8:131017595-131017617 GTGTGGGGGTGGGGAGTAGATGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048404268 8:134103882-134103904 GTGTGGGGGTGTTTAGAAGTGGG - Intergenic
1048520565 8:135150458-135150480 GGGTTGGGGTGGGGGGAAGGGGG - Intergenic
1048890218 8:138940483-138940505 GTGGGGGGGTGGGGGGAAGGTGG - Intergenic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049298060 8:141854493-141854515 GTGTGGGGGGGGGGGGCTGTGGG - Intergenic
1049332014 8:142059639-142059661 GTGGTGGGGTAGAGGGAATTGGG - Intergenic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049471009 8:142775000-142775022 GTGTGGTGGTTGGGGGAGGTCGG + Intronic
1049524948 8:143119702-143119724 GTGTTGGGGTGGGGGGATGGGGG + Intergenic
1049643315 8:143725162-143725184 GGGGGGGGGGGGAGGGAAGGAGG + Exonic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050091214 9:2017237-2017259 GGGGTGGGGTGGAGGGAAGTTGG + Intronic
1050249481 9:3729545-3729567 GTGTGGCAGAGTAGGGAAGTGGG - Intergenic
1050678148 9:8079607-8079629 GTTGTGGGGTGGAGGGATGTGGG - Intergenic
1050744185 9:8857912-8857934 GGGTAGGGGTGGAGGGAGGGCGG - Intronic
1050866029 9:10500677-10500699 GGGAGGGGTTGGGGGGAAGTTGG - Intronic
1051288160 9:15517360-15517382 GTGTGGGGGTAGAGGGCATATGG - Intergenic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1051349306 9:16184122-16184144 GTGTGGAGGTGGAGGTGAGGAGG + Intergenic
1051895152 9:21978774-21978796 GGGTGGGGGCAGAGGGGAGTAGG + Intronic
1052132723 9:24869490-24869512 GTGTTGGGGTGGGGGGAGGGGGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052816691 9:33107421-33107443 GTGTGGGGGTGGGGGGAGAGGGG - Intronic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1052878451 9:33584889-33584911 GTGTGAGGGTGGTGGGTAGTAGG + Intergenic
1052878879 9:33587975-33587997 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1052879311 9:33591068-33591090 GTGAGAGGGTGGTGGGTAGTAGG + Intergenic
1052880207 9:33597204-33597226 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053495765 9:38547014-38547036 GTGGGAGGGTGGTGGGTAGTAGG - Intronic
1053497094 9:38556245-38556267 GTGGGAGGGTGGTGGGTAGTAGG - Intronic
1053497530 9:38559320-38559342 GTGTGAGGGTGGTGGGTAGTAGG - Intronic
1053522190 9:38791491-38791513 GTGTGGAGGGGGTGGGAAGAAGG - Intergenic
1053663150 9:40298611-40298633 GTGTGGGGGTGGAAGAAAAAAGG + Intronic
1053664603 9:40308698-40308720 GTGTGGGGGTGGAAGAAAAAAGG + Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1053913655 9:42929141-42929163 GTGTGGGGGTGGAAGAAAAAAGG + Intergenic
1054194416 9:62015955-62015977 GTGTGGAGGGGGTGGGAAGGAGG - Intergenic
1054375274 9:64444835-64444857 GTGTGGGGGTGGAAGAAAAAAGG + Intergenic
1054520011 9:66067586-66067608 GTGTGGGGGTGGAAGAAAAAAGG - Intergenic
1054521444 9:66077612-66077634 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1054521466 9:66077674-66077696 GTGTGGGGGTGGAAGAAAAAAGG - Intergenic
1054643991 9:67572735-67572757 GTGTGGAGGGGGTGGGAAGGAGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1054865868 9:70000290-70000312 GTGGGAGGCTGGAGGGAGGTGGG + Intergenic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1055090207 9:72356763-72356785 GTATTGGGGTGGAAAGAAGTTGG - Intronic
1055403598 9:75950141-75950163 GTGTGGGGGGGGCGGGGAGGGGG + Intronic
1055694146 9:78864700-78864722 GTGGTGGGGTGGGGGGAGGTGGG + Intergenic
1055695441 9:78878489-78878511 GTGGTGGGGTGGGGGGAGGTGGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056244258 9:84678621-84678643 GTGTAGGGGTGGAGGGTGCTGGG + Intronic
1056585880 9:87926826-87926848 GTGGGAGGGTGGGGGGTAGTAGG - Intergenic
1056586333 9:87929855-87929877 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1056610549 9:88123088-88123110 GTGGGAGGGTGGTGGGTAGTAGG + Intergenic
1056611004 9:88126117-88126139 GTGGGAGGGTGGGGGGTAGTAGG + Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056910481 9:90695964-90695986 GTGACGGGGAGGAGGGAAGTGGG - Intergenic
1057141670 9:92730091-92730113 ATGTGGGGGTAGTGGGCAGTGGG - Intronic
1057281211 9:93712957-93712979 GTTTGTGGCTGCAGGGAAGTGGG + Intergenic
1057313873 9:93956996-93957018 GAGTGGGGGTGGGGGGCAGGTGG + Intergenic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057537476 9:95926902-95926924 GTGTGGAGGAGGTTGGAAGTAGG + Intronic
1057596183 9:96417882-96417904 GTGCGGCGGTGGAGGGGAGCCGG - Exonic
1057675697 9:97134529-97134551 GTGGGAGGGTGGGGGGTAGTAGG - Intergenic
1057676149 9:97137601-97137623 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1057677005 9:97143802-97143824 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
1057768543 9:97945490-97945512 GTCTGGGGGTGGGGGGCAGGGGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1057890173 9:98863968-98863990 ATCTGGGGGTGGAGAGAGGTGGG + Intergenic
1057987234 9:99729735-99729757 GGGTGGGGGTGGGGGGGGGTGGG - Intergenic
1058177605 9:101755585-101755607 CTGTTGGGGTTGAGGGAAGCAGG + Intergenic
1058557875 9:106189564-106189586 GTGGGGTGGTAGGGGGAAGTGGG - Intergenic
1058634128 9:107019891-107019913 GTATGTGTGTGGAGGGATGTTGG - Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1058944199 9:109841616-109841638 GTGGGGGGGTGGAGGGAAAGAGG + Intronic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059199582 9:112401712-112401734 GTGGGGTGGGGGAGGGAAGGAGG + Intronic
1059241494 9:112810147-112810169 GGGTGGGGGTGGTTTGAAGTGGG + Intronic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1059459071 9:114418285-114418307 GTGTGGGGGTGGGGAGAAGAGGG + Intronic
1059621542 9:116011185-116011207 GTGTGGGGGTGGGGGTGGGTGGG + Intergenic
1059974585 9:119701973-119701995 GGGTGGTGGTGGAGGGAATTGGG + Intergenic
1060009946 9:120034869-120034891 GTCTGGAGGTGGAGGAAAATGGG - Intergenic
1060304934 9:122402843-122402865 GTGTGGAGGAGGAGGAAATTAGG - Intergenic
1060319891 9:122548739-122548761 GGGTGGGGGTAGAGGGGAGGGGG - Intergenic
1060816342 9:126637470-126637492 GTGTGGGGGTGGGGGGTTGTGGG + Intronic
1060991659 9:127853256-127853278 GTGGGGAGGTGGGGAGAAGTTGG + Intronic
1061223266 9:129264811-129264833 TGGTGGGGGTGGTGGGGAGTTGG + Intergenic
1061371539 9:130200509-130200531 GTGGGGGGGTGGGGGGAGCTAGG - Intronic
1061450655 9:130665307-130665329 GGGAGGGGGTGGAGGGAGGGCGG + Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1062035828 9:134382124-134382146 GTGGGGGGGCGCAGGGCAGTGGG + Intronic
1062204069 9:135326102-135326124 CTTGGGGGGTGGCGGGAAGTGGG + Intergenic
1062262281 9:135668904-135668926 GTTGGGGGGTGGAGGGTAGGGGG - Intergenic
1062303109 9:135886945-135886967 GTGTGGAGGAGGAGGGCAGTCGG + Intronic
1203546997 Un_KI270743v1:135682-135704 GTGGGAGGGTGGTGGGTAGTAGG - Intergenic
1185622987 X:1464788-1464810 GTGTGTGTGTGGGGGGAAGTGGG + Exonic
1185867885 X:3639343-3639365 GGGTGGGGGTGGATGGATGAAGG + Intronic
1185867918 X:3639429-3639451 GGGTGGGGGTGGATGGATGAAGG + Intronic
1185867929 X:3639453-3639475 GTGGGGGGGTGGATGGATGAAGG + Intronic
1185894374 X:3844375-3844397 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185899492 X:3882799-3882821 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185904608 X:3921228-3921250 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1186130464 X:6460116-6460138 GTGGGGGGGTAGAGGGTAGATGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186376413 X:9006799-9006821 GAGGTGGGATGGAGGGAAGTGGG - Intergenic
1186497486 X:10023301-10023323 ATGTGGGGGTGGGGAGAGGTAGG + Intronic
1186642899 X:11474718-11474740 GTGTGGTGGTGTTGGGAGGTGGG + Intronic
1186782653 X:12928747-12928769 GTTGTGGGGTGGGGGGAAGTGGG + Intergenic
1187754065 X:22500590-22500612 GTGTGGGGGGGGAGGGCATGTGG + Intergenic
1187940504 X:24376178-24376200 GTGTGTGTGTGGTGGGGAGTGGG + Intergenic
1188038056 X:25340601-25340623 GTGTGGCGGTATGGGGAAGTGGG + Intergenic
1188170465 X:26918187-26918209 GTGTGTGTGTGGAGGGGGGTGGG + Intergenic
1188253413 X:27928212-27928234 GTGGTGGGGTGGAGGGAGGGGGG + Intergenic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1188304096 X:28541265-28541287 GAGTGGTGGTGGAGGGGAGGTGG + Intergenic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188942910 X:36262350-36262372 GTGGGGGGTTGGTGGGAGGTAGG - Intronic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1189084351 X:38004784-38004806 GTGAGGTGCTGGGGGGAAGTAGG + Intronic
1189184198 X:39038113-39038135 GTTTGGAGGTGGATGGAAGCAGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189279619 X:39812025-39812047 GTGTGTGGGTAGGGGGAGGTGGG - Intergenic
1189308799 X:40006115-40006137 GCCTGGGGGCAGAGGGAAGTGGG + Intergenic
1189313452 X:40036230-40036252 GGGAGAGGGTGGAGGGAAGGAGG - Intergenic
1189428309 X:40922991-40923013 GACTGGGGGTAGTGGGAAGTGGG + Intergenic
1189579298 X:42388911-42388933 TTGTGAGGGAGGAGGGAAGTGGG + Intergenic
1189608113 X:42701814-42701836 GTGAGGGGATGTAGGGAATTTGG - Intergenic
1189726061 X:43969325-43969347 GTTTGGGGAGGGAGGGATGTGGG + Intronic
1189858085 X:45243744-45243766 GTGGGGGGCTGGGAGGAAGTGGG - Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190076375 X:47320271-47320293 GCATGGGGCTTGAGGGAAGTTGG - Intergenic
1190109126 X:47578682-47578704 GGGTGGGGGTGGAGGGAGCGGGG - Intronic
1190417915 X:50199486-50199508 GGGTGATGGTGGAAGGAAGTTGG - Intronic
1190985088 X:55492547-55492569 GGGTGGGGGTGGGGGGGAGTTGG - Intergenic
1191207691 X:57851733-57851755 GTGGGGGGGTGGGGGGAGGGGGG + Intergenic
1191911925 X:66160680-66160702 GTGGAGGGGTGCAGGGAAGAGGG - Intergenic
1192491380 X:71579399-71579421 ATGGGGGCGTTGAGGGAAGTGGG + Intronic
1192549918 X:72045483-72045505 GTGGAGGGGTGGTGGGAGGTGGG + Intergenic
1192628021 X:72750299-72750321 GTCAGGGGGTGGAGGGATGGGGG - Intergenic
1192653688 X:72970509-72970531 GTCAGGGGGTGGAGGGATGGGGG + Intergenic
1192842590 X:74872436-74872458 GTGTGTGGGTGGGGGGTGGTGGG + Intronic
1192906294 X:75555303-75555325 GTGGTGGGGTGGGGGGAAGGGGG - Intergenic
1192909919 X:75592349-75592371 GTTTTGGGGTGGGGGGAAGGGGG + Intergenic
1193453686 X:81702242-81702264 GGGTGGGGGGGGAGGGATTTAGG + Intergenic
1193783163 X:85728667-85728689 GGGTGGCGGTGGGGGGAAGGGGG - Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1193969410 X:88033341-88033363 GTGGTGGGGTGGAGGGAGGGGGG - Intergenic
1194600418 X:95913806-95913828 GTGGGGGGGCGGGGGGAGGTGGG - Intergenic
1195025470 X:100872758-100872780 GTGTGTAGGTGGGGGGAATTGGG - Intronic
1195071114 X:101280965-101280987 GTGTGAGGTGGAAGGGAAGTGGG + Intronic
1195078513 X:101349524-101349546 GTGTGGGGGTGGACCGAATTTGG - Exonic
1195108677 X:101624039-101624061 GTCTGTGGTTGGGGGGAAGTGGG + Intronic
1195329216 X:103783005-103783027 GTTTGGGGGTGGGGAGGAGTTGG + Intronic
1195431176 X:104791215-104791237 GGGTGGGGGTGGAGAGAGGAGGG - Intronic
1195516572 X:105783404-105783426 GCCTGGGGAAGGAGGGAAGTAGG - Intergenic
1195691303 X:107628253-107628275 GACTGGGGGTGGAGGGATGCTGG - Intergenic
1195967876 X:110445484-110445506 CTGTGGGGGAGGAAGGAAGTGGG + Intronic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1196223380 X:113138068-113138090 GTGTGGAGGTGTTGGAAAGTGGG - Intergenic
1196339103 X:114575576-114575598 GTGTGTGTGTGGGGGGGAGTGGG - Intergenic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196574011 X:117297489-117297511 GTGGGGGTGTTGTGGGAAGTTGG - Intergenic
1196650077 X:118159352-118159374 GAGGGGGGGGGGAGGGAAGGAGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197195931 X:123700535-123700557 GTGAGGGGGTGGGGGGGGGTGGG + Intronic
1197382513 X:125762506-125762528 GTTGGGGGGTGGGGGGCAGTGGG + Intergenic
1197415426 X:126166692-126166714 GTGCGGGGGTGGGGGGGTGTGGG + Intergenic
1197806041 X:130399454-130399476 GTGGTGTGGTGGTGGGAAGTTGG + Intergenic
1197862046 X:130981142-130981164 GTGAGAGGGTGGAGGGAGGTGGG + Intergenic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198924451 X:141772066-141772088 GTGTGGAGGGGGAAGGAAGAAGG + Intergenic
1199387018 X:147234809-147234831 GTGGGTGGGTGGATGGATGTGGG - Intergenic
1199565853 X:149215198-149215220 GTGGTGGGGTGGAGGGAGGGGGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1199807402 X:151314058-151314080 GTGTGGTGGTGGTGGGGAGGAGG - Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1200296081 X:154921875-154921897 GTTGGGGGGTGGGGGGAAGAGGG + Intronic
1200613350 Y:5350372-5350394 GTAGGGGGGTGGAGGGAGGGGGG - Intronic
1201172827 Y:11285756-11285778 GTGGGGGGGGGGAGGGGAGAGGG + Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201438541 Y:13985329-13985351 GTGTGGGGTGGGAGGGAGGGAGG - Intergenic
1201446032 Y:14057379-14057401 GTGTGGGGTGGGAGGGAGGGAGG + Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201570830 Y:15412107-15412129 TTGTGGGGGTTGGGGGAAGGGGG + Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic