ID: 1167089312

View in Genome Browser
Species Human (GRCh38)
Location 19:47332463-47332485
Sequence CAGTCTTATTACAGCCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167089312 Original CRISPR CAGTCTTATTACAGCCACAC TGG Intronic
908783577 1:67713629-67713651 CTCTTTTATTACAGCCACATGGG - Intronic
909677218 1:78252092-78252114 CAGTGTAATTTCAGCCACAGAGG + Intergenic
911970261 1:104425924-104425946 CTGTTTTATTCTAGCCACACTGG - Intergenic
917479358 1:175397897-175397919 AGGTCTAATTACAGACACACTGG - Intronic
917849990 1:179053633-179053655 CAGTCTTAGAAAAGCCACAAAGG - Intronic
919243238 1:194941756-194941778 CTGTCTAAATACAGCCACATGGG + Intergenic
922883947 1:229003710-229003732 TTGTCTTATTACAGACACACAGG - Intergenic
923128653 1:231055903-231055925 TAGTCTTAATACTGTCACACTGG + Intergenic
1067533014 10:47088183-47088205 CAGGCTGGTTCCAGCCACACAGG - Intergenic
1069635150 10:69920468-69920490 CTATCTAAATACAGCCACACTGG - Intronic
1070037984 10:72746201-72746223 CTGTCTCATACCAGCCACACTGG + Intronic
1070054134 10:72918307-72918329 CAGTCCAATTAAAGTCACACTGG - Intronic
1070894532 10:79972077-79972099 CAGTCTTATTACACCAATTCAGG + Intronic
1071079500 10:81794133-81794155 CAGTTTTATTATAGCAACAAAGG + Intergenic
1075995566 10:126873734-126873756 CATTCTTATCAAGGCCACACTGG + Intergenic
1076708772 10:132319244-132319266 CAGTCATGATACAGCTACACTGG + Intronic
1077710042 11:4527051-4527073 CTGTTTTATTCTAGCCACACTGG - Intergenic
1077929551 11:6716770-6716792 AATTCTTATGACTGCCACACAGG - Intergenic
1079310008 11:19356748-19356770 CAATCCTAATACAGCCACAGTGG - Intronic
1083964430 11:66034751-66034773 CCATCATATTCCAGCCACACTGG - Intergenic
1084571019 11:69959866-69959888 CCCTCTTACTGCAGCCACACTGG + Intergenic
1085523476 11:77151388-77151410 AAGTCTTCCTACAGCCACAAAGG - Intronic
1086326410 11:85705739-85705761 CAGACTTACTACAACCACAGTGG - Intronic
1089371041 11:117957839-117957861 CTGCTTTATTCCAGCCACACTGG + Intergenic
1089430972 11:118424201-118424223 CACTCTTCCTCCAGCCACACTGG + Intronic
1091806166 12:3357658-3357680 CATTCTTATAACTGCCCCACAGG + Intergenic
1094642269 12:32287884-32287906 CAGTCATCTGACAGCCCCACTGG + Intronic
1095511722 12:42958302-42958324 TACTCTAAATACAGCCACACTGG - Intergenic
1100120246 12:91361236-91361258 CAGTGTGATTAGAGCCAAACAGG - Intergenic
1106361873 13:29038764-29038786 CAGTCTGGTTACAGCCACTTTGG + Intronic
1106671421 13:31909847-31909869 TACGCTTATTAAAGCCACACAGG - Intergenic
1107239339 13:38213130-38213152 CTGTTTTATTGTAGCCACACTGG - Intergenic
1109368337 13:61388056-61388078 CAGTCTTTTTAAATCCAGACTGG + Intergenic
1111004973 13:82235441-82235463 CTGTTTTATTAAAACCACACAGG - Intergenic
1111938467 13:94583022-94583044 CAGTTTTATTAAACCTACACTGG - Intronic
1114492124 14:23109419-23109441 CTGTCTCAGTACAGCCACAGGGG - Intergenic
1119119590 14:72062281-72062303 CACCCTTCTTCCAGCCACACTGG - Intronic
1120438791 14:84510393-84510415 AAGTCTAATTACATCCACAAAGG + Intergenic
1131516211 15:93078889-93078911 CAGTCTGTTTATAGCCACAAAGG - Intronic
1131678701 15:94699243-94699265 CAGTATTAATACAGCCACAGTGG - Intergenic
1134365019 16:13569093-13569115 CAGTCATCTTACTGCCACACAGG + Intergenic
1137048156 16:35687216-35687238 CAGTCTAATTATAGAGACACTGG - Intergenic
1138547089 16:57726339-57726361 CTGTCTTATTCCAGCCACTTGGG + Intronic
1139910710 16:70395670-70395692 CAGTTTTATTCCAGCCATTCTGG - Intronic
1141206479 16:81936874-81936896 CATTCTTTTTATAGCCACATCGG + Intronic
1141213529 16:82003010-82003032 CAGTCTTAATACACTCACACAGG - Intronic
1155457922 18:26040842-26040864 CAGTCTTAGTAGAGACAAACTGG + Intronic
1157623559 18:49029944-49029966 CCCTCTTCTTCCAGCCACACTGG - Intergenic
1158949924 18:62484720-62484742 CAGTGTCAATACAGCTACACAGG - Intergenic
1160571517 18:79820470-79820492 CTTTCTTATTACAGCCATCCTGG + Intergenic
1160655779 19:268340-268362 CAGTCTTATTTCATCCATTCTGG - Intergenic
1162394445 19:10408649-10408671 CATTCATATTACAGTCACACAGG + Intronic
1164379557 19:27720242-27720264 CAGCCTAATTACAGAAACACCGG - Intergenic
1167089312 19:47332463-47332485 CAGTCTTATTACAGCCACACTGG + Intronic
928026276 2:27741890-27741912 CTGTCTTATGACAGCCTCCCAGG - Intergenic
930367980 2:50466429-50466451 CAGTCTTGTTATATACACACAGG + Intronic
930477833 2:51906488-51906510 CAGTCTTATTTCATGCACAAAGG + Intergenic
932561492 2:72875179-72875201 CTGCTTTATTCCAGCCACACTGG + Intergenic
933193479 2:79363355-79363377 TATTCTAAATACAGCCACACTGG + Intronic
935856045 2:107275214-107275236 CATACTTACTGCAGCCACACAGG + Intergenic
937732635 2:125252892-125252914 CTGCTTTATTGCAGCCACACTGG + Intergenic
939300020 2:140324047-140324069 CAGGTTTATTACATCCACATAGG - Exonic
940786401 2:157985961-157985983 CAGTCTTCTTACCTCCACACTGG - Intronic
943647217 2:190419060-190419082 TAGTTTTATAACAGTCACACAGG - Intronic
944856518 2:203773275-203773297 CAGTCCAATTAAAGTCACACTGG - Intergenic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
946656262 2:221951399-221951421 CTGTTTTATTCTAGCCACACTGG + Intergenic
948700497 2:239756753-239756775 CAGTCTTATTTCAGAGACACTGG + Intergenic
1174034347 20:47658698-47658720 ATGTCCTATTAAAGCCACACAGG + Intronic
1175190017 20:57205223-57205245 AAGTCTTTTTAGAGCCACACAGG + Intronic
1176969902 21:15253264-15253286 CACTTTTATTTCAGCCACTCTGG + Intergenic
1181719123 22:24760402-24760424 CCCTCTTCTTCCAGCCACACTGG - Intronic
949869878 3:8579482-8579504 GAGTCTTCTTTCAGCCACCCAGG + Intergenic
950133841 3:10566529-10566551 CTGTCTCATTATAGTCACACTGG - Intronic
953386434 3:42508850-42508872 CAGTGTGATCACAGGCACACAGG - Intronic
953450538 3:43001729-43001751 CAGTCTAATTACATCCGCAGGGG - Intronic
956405135 3:68920750-68920772 TAGTGTTATTACAGCCACTTAGG - Intronic
957566992 3:81896713-81896735 CAGTGTTATTACCTGCACACTGG + Intergenic
963378713 3:144503047-144503069 CATTCTTTAAACAGCCACACAGG - Intergenic
963608121 3:147431001-147431023 CAGTCTTACTCCAGTCTCACAGG + Intronic
963686826 3:148445987-148446009 CATACTTATTAAAGTCACACAGG + Intergenic
963766018 3:149336665-149336687 CAGTAATTTTTCAGCCACACTGG - Intergenic
967315184 3:188145389-188145411 CTGTCTTATTACAGACACATAGG + Intergenic
967975068 3:195029767-195029789 CAGACACATTACAGCCACAGAGG - Intergenic
969982565 4:11173224-11173246 CTGCTTTATTCCAGCCACACTGG - Intergenic
975197564 4:71543270-71543292 CTCTCTCATTGCAGCCACACAGG - Intronic
978463106 4:108979606-108979628 CATTCTTATTCCAGGCACTCGGG - Intronic
979220949 4:118224196-118224218 CAGTCTTATTGCACCAACATGGG + Intronic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
987332292 5:16867723-16867745 CAGACTTCTTCAAGCCACACTGG - Intronic
988167447 5:27612733-27612755 CAGTCTTCCTACAGACAAACTGG + Intergenic
993432412 5:87848198-87848220 CAATCATCTTACAGCCACACAGG + Intergenic
994915786 5:105977250-105977272 CATTATTATTTGAGCCACACTGG + Intergenic
1003613704 6:7636093-7636115 CTGTCTGATCACAACCACACTGG - Intergenic
1003717129 6:8659638-8659660 GAGTTTAATTATAGCCACACTGG - Intergenic
1004148803 6:13094910-13094932 CTGTCCAAATACAGCCACACTGG - Intronic
1006646899 6:35521154-35521176 CAGTCTTAGTTCAGCCAGAGAGG + Intergenic
1006697935 6:35947336-35947358 TAGTCTTAATAGAGACACACAGG + Intronic
1007411726 6:41667111-41667133 CAGTCCAATTAAAGTCACACTGG + Intergenic
1009941078 6:70288609-70288631 TAGTCTCATTCCAGCCACACTGG + Intronic
1010364997 6:75040650-75040672 CTGTCTTATTATAGCCACCTAGG + Intergenic
1014905859 6:127026042-127026064 CTGTTTTCTAACAGCCACACTGG + Intergenic
1016151170 6:140744939-140744961 CAGCTTTATTCTAGCCACACTGG + Intergenic
1017517821 6:155173588-155173610 CAGTCATATTACAGGCAGAAGGG - Intronic
1023111691 7:36819159-36819181 CAGTCCAATTAAAGTCACACTGG + Intergenic
1024100416 7:46027041-46027063 AAGTGTTATTTCAGCAACACTGG + Intergenic
1028366097 7:90034373-90034395 CAGGCTAATTCCAGACACACTGG + Intergenic
1029210891 7:98907719-98907741 CTGACTTGTTGCAGCCACACTGG + Intronic
1033786829 7:144742048-144742070 CTGTCTTAACACAGTCACACTGG + Intronic
1036089571 8:5650774-5650796 CAGTCTTTTTACTGAAACACTGG - Intergenic
1037668790 8:20996859-20996881 CCATCTAATCACAGCCACACAGG + Intergenic
1041712158 8:60904541-60904563 CACATTTATTCCAGCCACACGGG - Intergenic
1044763981 8:95551915-95551937 CATTCTTGGTACAGCCACAGTGG - Intergenic
1045839112 8:106559299-106559321 CATTCTGATCACAGTCACACAGG + Intronic
1046752198 8:117937861-117937883 CAGGCTGATTACAGACCCACAGG - Intronic
1047727858 8:127699965-127699987 CATTCTTATGACAGCCAAATTGG - Intergenic
1051276418 9:15403340-15403362 GAGTCTTATCACATGCACACAGG - Intergenic
1052353058 9:27476699-27476721 TAGTCTCATGGCAGCCACACTGG - Intronic
1188432205 X:30116978-30117000 CAGTCTTATTTTAGCCATTCTGG + Intergenic
1192606946 X:72528345-72528367 CAGTCTCATGACAGCCATTCAGG - Intronic
1200911477 Y:8535077-8535099 CAGTCCAAGCACAGCCACACAGG - Intergenic