ID: 1167090743

View in Genome Browser
Species Human (GRCh38)
Location 19:47341949-47341971
Sequence GCTATGTGCAAGGCCTTTTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167090739_1167090743 12 Left 1167090739 19:47341914-47341936 CCTTCCTTCATTCAACAGATATC 0: 1
1: 1
2: 13
3: 108
4: 540
Right 1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 163
1167090740_1167090743 8 Left 1167090740 19:47341918-47341940 CCTTCATTCAACAGATATCCATC 0: 1
1: 0
2: 5
3: 30
4: 262
Right 1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 163
1167090741_1167090743 -10 Left 1167090741 19:47341936-47341958 CCATCATGCACTTGCTATGTGCA 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167090743 Original CRISPR GCTATGTGCAAGGCCTTTTT AGG Exonic
904638815 1:31905998-31906020 GCTATTTTCAAGGACTGTTTTGG - Intergenic
906626232 1:47328143-47328165 ACTATGTGCCAGGCATTTTTTGG - Intergenic
907013939 1:50992748-50992770 ACTATGTGCCAGGCCGTTTTAGG + Intergenic
909586306 1:77292524-77292546 GCTTTGTGCAAGTGCCTTTTGGG + Intronic
912512280 1:110197692-110197714 GCTATGTGCCAGGCCTTGCCAGG + Intronic
915234505 1:154470537-154470559 GCGAGGTGAAAGGCCTTTTAAGG + Intronic
916911179 1:169348661-169348683 GCTTTGTGAAATGGCTTTTTGGG - Intronic
918270014 1:182889308-182889330 GCTATGTGGAAGCACTTTCTGGG - Intergenic
919095261 1:193026325-193026347 GCTCTGTGAAAGACCATTTTGGG + Intronic
922936483 1:229426759-229426781 GCTATGTCCTAGGGCTTTTGAGG - Intergenic
1063313066 10:4973524-4973546 GACATGTGCAAAGCCTTTTCAGG + Intronic
1063314928 10:4994524-4994546 GACATGTGCAAAGCCTTTTTAGG - Intronic
1068122899 10:52802247-52802269 GATATGTGCAAAGTGTTTTTAGG + Intergenic
1069943061 10:71968593-71968615 GCTGTCTGCAAGGCCCTTATTGG + Intronic
1070698657 10:78582649-78582671 GCTATGTGCAAGGGCCTCTGAGG - Intergenic
1072939908 10:99752646-99752668 GCTGTGTGCAAGGCATTACTTGG + Intronic
1078487654 11:11738993-11739015 TCTAACTGCCAGGCCTTTTTAGG - Intergenic
1078598196 11:12707370-12707392 GCTATCTGCAAGCCATTTTAAGG + Intronic
1078686348 11:13535650-13535672 CCTATTTGCAAGATCTTTTTGGG + Intergenic
1079001455 11:16760662-16760684 GCTATGTGCCAGGCAGTCTTAGG + Intergenic
1079482847 11:20900266-20900288 GAAATGTGCATGGCCTTTTGAGG + Intronic
1083057484 11:59836923-59836945 ACTATGTGCAAAGCATTTTGTGG - Intronic
1083233045 11:61335185-61335207 GATATGTTCAAGGCTTGTTTTGG - Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1084088027 11:66863683-66863705 GCCATGTGCAAGGCCCTTGGTGG + Intronic
1085803038 11:79609152-79609174 ATTATGTGCAAGGCTTTTTGAGG - Intergenic
1086721197 11:90123540-90123562 GCTATGGAAAAAGCCTTTTTGGG - Intergenic
1092231602 12:6778680-6778702 GCAAGGGGCAAGGGCTTTTTCGG - Intergenic
1092831610 12:12449422-12449444 GCCATTTGCAAGGCCTTTTGTGG + Intronic
1093109719 12:15135113-15135135 CCTATGTGCAAGACCTCTATGGG - Intronic
1095722956 12:45421062-45421084 GCTATGATCATGGCCTATTTTGG - Exonic
1099240413 12:80131446-80131468 GCTGTGTGCAAAGTCCTTTTTGG - Intergenic
1099929547 12:89057913-89057935 CCTATGTGCAAAGCCTTTTGTGG + Intergenic
1106418796 13:29568556-29568578 GCTGTGTGCAAGGTGATTTTAGG - Intronic
1107197343 13:37668351-37668373 GCTTTGTCTAAGGCATTTTTAGG + Intronic
1107437224 13:40390595-40390617 GCTGTGCGCAAGGCCTCATTTGG - Intergenic
1107973951 13:45671591-45671613 GCTATGAGCAAGGGGATTTTAGG + Intergenic
1109985870 13:69984088-69984110 GGTCTGGGCAAGGACTTTTTTGG + Intronic
1110623459 13:77624952-77624974 ACTATGTGCAAGGCCATGTTAGG + Intronic
1112789045 13:102983335-102983357 ACTATGTGCCAGCCCTCTTTTGG - Intergenic
1113166672 13:107450638-107450660 GCAATGTGCAAGGCTTCTTGGGG + Intronic
1114669758 14:24403129-24403151 GCTATGTGCAAGGCATAATGAGG - Intronic
1118130502 14:62957660-62957682 GTGGTGTGCAAGGCCTTTTGAGG - Intronic
1119923379 14:78468529-78468551 GATAAGTGCAAGGTCTCTTTAGG + Intronic
1120188134 14:81415703-81415725 GCTATGTGCAAGGCAGCTATAGG - Intronic
1121801185 14:96775416-96775438 GCTCTGTTCCAGGCCTCTTTTGG + Intergenic
1126364837 15:47883454-47883476 GCTATGTGCAGGCCCTTCTCAGG + Intergenic
1133773206 16:8879791-8879813 CCTCTGTGCCAGGCCTTATTTGG + Intergenic
1135695016 16:24577928-24577950 ACTATGTGCAAGGCATGGTTTGG - Intergenic
1138022658 16:53498487-53498509 GTTATGGGCAAAGCATTTTTGGG + Exonic
1138809120 16:60128111-60128133 GCTATGTTCAAGGCCTTTCCAGG - Intergenic
1141483241 16:84321065-84321087 GCTATTTGCAGGGCTTTGTTTGG + Intronic
1141789448 16:86224434-86224456 TCTGTGTTCAAGGCCTTTCTCGG + Intergenic
1142542231 17:668959-668981 ACTATGTGCCAGACTTTTTTCGG + Intronic
1142953662 17:3505423-3505445 GCTATCTGGAAGGGCTTCTTTGG + Intronic
1143939711 17:10527591-10527613 CCTATGTGCAAGGTCATCTTGGG - Intronic
1146132877 17:30293633-30293655 GCTAAGAGCAAGGCATGTTTTGG + Intergenic
1150206014 17:63408205-63408227 GCTATGTGCAAGAGGTATTTTGG + Intronic
1150704911 17:67477846-67477868 GCCATGAGCAAGACTTTTTTTGG - Intronic
1152059549 17:78060400-78060422 GCTATGTGCTTGGCTTTTTAAGG - Intronic
1156213226 18:34970027-34970049 GCTATGTGCAAGGAATTCTGAGG - Intergenic
1159926187 18:74271163-74271185 ACTATGTGCAAGGCATTGTGTGG + Intronic
1162534539 19:11254974-11254996 AGTATGTGCAAGGCCCTCTTTGG - Intronic
1164144575 19:22504228-22504250 GTGAAGTGCAAGGCCTTCTTGGG + Intronic
1165649994 19:37478270-37478292 AAGATGTGCAAAGCCTTTTTTGG - Intronic
1166459779 19:42976454-42976476 GCTATTTGCATTTCCTTTTTTGG - Intronic
1166477098 19:43136509-43136531 GCTATTTGCATTTCCTTTTTTGG - Intronic
1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG + Exonic
1167972126 19:53194636-53194658 ACTATGTGCAAGGCATTATTCGG + Intergenic
926473032 2:13285126-13285148 GCTGGGTCCAAGGCCTTTTATGG + Intergenic
928021318 2:27707187-27707209 ACTATGTACCAGGCCTTTTGGGG + Exonic
932892369 2:75608280-75608302 GCTATATGCAAAGCATTTTGAGG - Intergenic
933111125 2:78401597-78401619 GCTATGTGTAGGCTCTTTTTTGG - Intergenic
934603103 2:95673398-95673420 GGCATGTTCAAGGACTTTTTAGG + Intergenic
934712685 2:96526326-96526348 GCTATGTGCCTGGCCCTTCTGGG + Intergenic
940202211 2:151164128-151164150 GCTATATCCAAGGCTTGTTTGGG + Intergenic
940926770 2:159372196-159372218 GCTATGTGCTAGACATTTCTAGG - Intronic
941207013 2:162586286-162586308 GCTATAAGGAAGGCCTTTTGAGG - Intronic
941252256 2:163180323-163180345 GCTATGAGCATGGCCTTATATGG - Intergenic
942114817 2:172717805-172717827 GCTATGTGAGGGGCTTTTTTTGG + Intergenic
944852931 2:203738487-203738509 GTTATCTGCAAGGCCATTTGAGG + Exonic
945746542 2:213725513-213725535 GCTATGGGGAAGTCCTTTGTTGG - Intronic
947378119 2:229517961-229517983 ACTATGTGCAATGCATTTTCAGG - Intronic
1169515061 20:6307516-6307538 GAAGTGTGCAAGGCCTCTTTAGG + Intergenic
1172920370 20:38476286-38476308 GACATGTGCAAAGACTTTTTGGG + Intronic
1174104278 20:48151149-48151171 GGTGTGTGCCAGGACTTTTTTGG - Intergenic
1175517594 20:59578801-59578823 GCTATCTGCCAGGCCTTCTGTGG + Intronic
1176018606 20:62951633-62951655 GCTATGGGCTAGGGCTGTTTGGG + Intergenic
1176148543 20:63576621-63576643 GGGATGTGAAAGGCCTTTCTAGG + Intergenic
1180834544 22:18923303-18923325 GCCATGTGCAAGGACTTCATGGG - Intronic
1203284633 22_KI270734v1_random:148602-148624 GCCATGTGCAAGGACTTCATGGG - Intergenic
950155340 3:10717654-10717676 GCTATGTGCCAGGCACTGTTTGG + Intergenic
950182995 3:10928132-10928154 GCGATGTGCCAGGCTGTTTTAGG - Intronic
951739082 3:25899913-25899935 GCTGTGTGCCAGGTCTATTTAGG - Intergenic
951864916 3:27297548-27297570 GCTAAGTGCCAGGCATGTTTTGG - Intronic
953839657 3:46379333-46379355 GCTATGTTCATGTCCTTTGTAGG - Intergenic
954741385 3:52753650-52753672 GTTATGGGCAAAGCATTTTTGGG - Intronic
955997925 3:64696690-64696712 CCTAGGTGCAAGGGCTTCTTGGG - Intergenic
956439651 3:69267531-69267553 TCTATGTGCTAGGCCTATATAGG - Intronic
956456894 3:69430336-69430358 ACTATGGGCAAGGCCTATTTAGG + Intronic
957362756 3:79180665-79180687 ACTATGTGCCAGGCCATTTCAGG - Intronic
957497270 3:81008044-81008066 GTTATGTGAAAGGCCTTATCTGG - Intergenic
959329554 3:104985954-104985976 ATTATGTGCAAGGCTGTTTTAGG - Intergenic
959578792 3:107963274-107963296 GCTATCTGAAAGCCCATTTTGGG + Intergenic
967533112 3:190571773-190571795 GCCATATTCAAGGCCGTTTTGGG - Intronic
967576023 3:191094211-191094233 TCTATGTGCAAAGCATATTTGGG - Intergenic
967936538 3:194732656-194732678 GCTATTTCCAAGGTCTGTTTGGG + Intergenic
969153825 4:5192914-5192936 TCTATGAGCATGACCTTTTTAGG + Intronic
969506108 4:7588814-7588836 GGTATGAGCAAGACTTTTTTTGG + Intronic
970208734 4:13684346-13684368 GCTCTGGGCAATGCTTTTTTTGG - Intergenic
971162675 4:24149670-24149692 TCTATTTGCAAGTCCATTTTAGG - Intergenic
971612986 4:28749811-28749833 ACTATATGCTAGGCCTTTCTAGG + Intergenic
971887461 4:32471855-32471877 GCTATGTGCAAGGGCAATATTGG - Intergenic
972832084 4:42826175-42826197 ACTATATACAAGGCCTGTTTTGG - Intergenic
973077255 4:45944996-45945018 GTTATGTGGGAGGCCATTTTGGG - Intergenic
973295038 4:48509215-48509237 CCTAAATGCAAGCCCTTTTTTGG - Intronic
974184513 4:58429620-58429642 GCTTTGTGCAGGGCCTTTATTGG + Intergenic
977536039 4:98258172-98258194 GCTATGTGCTAGCACTATTTAGG + Intergenic
980076737 4:128301924-128301946 GCTATGTGCAAGACATTGTATGG + Intergenic
980164572 4:129209789-129209811 GCTTAGAGCAAGTCCTTTTTTGG - Intergenic
980949539 4:139359463-139359485 ACTATGTGCCAGGCAGTTTTGGG + Intronic
981405507 4:144362886-144362908 ACTATGTGCAAGGCATTTTTAGG - Intergenic
981678415 4:147365979-147366001 GCCATGTGCATGGCCTGTTTGGG + Intergenic
982635376 4:157889064-157889086 TCTATGTGCCAGGCATTGTTAGG + Intergenic
982897866 4:160957035-160957057 GCTTTGTTCTTGGCCTTTTTTGG - Intergenic
983245131 4:165279208-165279230 GCTAAGTGGAAGGCCTGTCTTGG + Intronic
984839159 4:184052110-184052132 GATCTGTGCAAGGCCCATTTGGG - Intergenic
985213465 4:187621413-187621435 GCTTTCTACAAGGCATTTTTAGG + Intergenic
987912809 5:24170500-24170522 GTTATGGGCAAAGCATTTTTGGG - Intronic
988942331 5:36159057-36159079 GTTATGTGCCAGGCATTGTTAGG + Intronic
992006010 5:72478205-72478227 GCTCTGTGCCAGGCCTTGTGTGG + Intronic
992020128 5:72614727-72614749 GGTCTGGGCAAGGACTTTTTTGG - Intergenic
993564398 5:89455388-89455410 GTTATGTGGAAGAACTTTTTAGG + Intergenic
993732090 5:91434285-91434307 GCTTTCTTCCAGGCCTTTTTAGG - Intergenic
996346919 5:122497657-122497679 GCCATGTGAAAAGCCTTTTCTGG + Intergenic
997248145 5:132369424-132369446 GCTTTTTGCAAGGCCTACTTGGG - Intergenic
999126347 5:149249006-149249028 TCTATGTGCCAGGCATTTGTAGG + Intronic
999182404 5:149679400-149679422 ACTATGTGCAATCTCTTTTTAGG - Intergenic
1003219518 6:4146420-4146442 ACTATGTGCTAGGCCTGTCTTGG + Intergenic
1008382712 6:50852008-50852030 ACTAGGTGAAAGGCCCTTTTGGG + Intergenic
1008645983 6:53515453-53515475 GCTATGTGCAGAGCCTTTTGGGG - Intronic
1008950762 6:57156468-57156490 GCTATGTGCAAGGAGTTATCTGG - Intronic
1013683252 6:112548206-112548228 GTTTTGTGCTAGGCTTTTTTGGG + Intergenic
1014256448 6:119164460-119164482 GCTTTTGGCAAGACCTTTTTTGG - Intergenic
1015403787 6:132814907-132814929 GCTGAGTGCAAGGCCTTATGTGG + Intronic
1015870271 6:137769195-137769217 GCTCTGTGCCAGGCCCTGTTAGG + Intergenic
1022012191 7:26318004-26318026 GATATGGGAAAGGCCTTTATGGG + Intronic
1026359826 7:69592591-69592613 GCTGTGTTCAAGGCCTTTCATGG - Intergenic
1030648969 7:112096468-112096490 CCACTGTGCCAGGCCTTTTTAGG + Intronic
1033511297 7:142062802-142062824 GCTATGTCCAAAGTCTTCTTTGG - Intronic
1035544966 8:473300-473322 GCTGTGAGCCAGGGCTTTTTAGG - Intergenic
1038106062 8:24435791-24435813 TCTATATGCAAGACCTTGTTAGG + Intergenic
1038332389 8:26619164-26619186 GCTCTGTGCAAGTCATTTTCAGG + Intronic
1040300529 8:46185663-46185685 GAGATGTGAAAGGCCTTTTAGGG + Intergenic
1040303775 8:46201665-46201687 GCGATGGGAGAGGCCTTTTTTGG - Intergenic
1040304336 8:46204231-46204253 GAAATGTGAGAGGCCTTTTTGGG - Intergenic
1042301763 8:67290469-67290491 ACTTTGTGCATGGCATTTTTAGG + Intronic
1044901571 8:96951336-96951358 CCTGTGTTCAAGGCCCTTTTAGG + Intronic
1046355031 8:113071378-113071400 GATATGTGCAATGATTTTTTTGG - Intronic
1050168184 9:2788392-2788414 TCTATTTGCAAGGTCTTTTGGGG + Intronic
1050298925 9:4236708-4236730 ACTATGTGTAAGGCAATTTTAGG + Intronic
1051147054 9:14038135-14038157 GCTATGTGCATTACTTTTTTGGG - Intergenic
1051873488 9:21766436-21766458 ACTATGTGCTAGGCCATTCTGGG + Intergenic
1053452845 9:38207655-38207677 GCGGTGTGCAAGGCCTCTTGAGG + Intergenic
1054737773 9:68772914-68772936 ACTGTTTGCAAGGCCTTTTATGG + Intronic
1054915509 9:70491995-70492017 GCTATGTGCAAGGTTCTCTTAGG + Intergenic
1056573609 9:87837401-87837423 GCTATGGCAAAGGCCATTTTTGG + Intergenic
1056933894 9:90900838-90900860 ACTTTGTGAAATGCCTTTTTTGG - Intergenic
1060167150 9:121427311-121427333 GGTTTGTGCAAAGACTTTTTGGG + Intergenic
1060379157 9:123149864-123149886 ACTATGTGCAAGACAATTTTAGG + Intronic
1186187156 X:7032110-7032132 GCTATTTGCATTTCCTTTTTTGG - Intergenic
1188487138 X:30694401-30694423 GCTAAGTGGAAGGCCTGTCTTGG - Exonic
1189773415 X:44448557-44448579 GATATGTGCAAGTCCTTATTTGG - Intergenic
1189901501 X:45711640-45711662 ATTATGTGCAAAGCCTTTTGGGG + Intergenic
1191718777 X:64211782-64211804 GATATGGGCAAGGCCAGTTTAGG + Intergenic
1193467873 X:81869193-81869215 GCTCTGTGCAGGGCCTCCTTGGG - Intergenic
1195123363 X:101780103-101780125 GCTAAGTGGAAGGCCTGTCTTGG + Intergenic
1198624820 X:138559087-138559109 GCTGTGTGCACTGCCTTTTGTGG + Intergenic