ID: 1167090743

View in Genome Browser
Species Human (GRCh38)
Location 19:47341949-47341971
Sequence GCTATGTGCAAGGCCTTTTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167090739_1167090743 12 Left 1167090739 19:47341914-47341936 CCTTCCTTCATTCAACAGATATC 0: 1
1: 1
2: 13
3: 108
4: 540
Right 1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 163
1167090740_1167090743 8 Left 1167090740 19:47341918-47341940 CCTTCATTCAACAGATATCCATC 0: 1
1: 0
2: 5
3: 30
4: 262
Right 1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 163
1167090741_1167090743 -10 Left 1167090741 19:47341936-47341958 CCATCATGCACTTGCTATGTGCA 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1167090743 19:47341949-47341971 GCTATGTGCAAGGCCTTTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167090743 Original CRISPR GCTATGTGCAAGGCCTTTTT AGG Exonic