ID: 1167092264

View in Genome Browser
Species Human (GRCh38)
Location 19:47352772-47352794
Sequence GGATGGACACAAGTTCATTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167092264_1167092268 3 Left 1167092264 19:47352772-47352794 CCAGAATGAACTTGTGTCCATCC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1167092268 19:47352798-47352820 AGATCACTGCAGATGTCATGAGG 0: 1
1: 0
2: 1
3: 21
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167092264 Original CRISPR GGATGGACACAAGTTCATTC TGG (reversed) Exonic
900722063 1:4183263-4183285 TGATGGAAACAACTTTATTCTGG + Intergenic
903395516 1:22999069-22999091 TGATGGACACAGCTTTATTCTGG + Intergenic
904381870 1:30116875-30116897 GGAAAGACACAAGCTCATGCTGG + Intergenic
907135242 1:52134342-52134364 AGAGGGACACAACTTCATTTGGG + Intergenic
910320462 1:85937775-85937797 AGTTGGAGGCAAGTTCATTCTGG + Intronic
912404097 1:109422194-109422216 GAATGGATCCAAGTTGATTCAGG - Intronic
913095282 1:115510699-115510721 TGATGGACACAGATTTATTCTGG + Intergenic
916928092 1:169544398-169544420 GGATGGTCAAAATTTCATTCTGG + Exonic
919686778 1:200490597-200490619 GGAAGGACAAAAGTGCATGCTGG + Intergenic
921520463 1:216149884-216149906 CGATGGACACAGCTTTATTCTGG - Intronic
922368987 1:224890921-224890943 CGATGGACACAGCTTTATTCTGG - Intergenic
922967107 1:229699522-229699544 GGGTGGACACAACCTAATTCAGG + Intergenic
923075624 1:230606340-230606362 CGATGGACACAGCTTTATTCTGG - Intergenic
1063553041 10:7051515-7051537 GGATGAAGACAAGCTCATACTGG + Intergenic
1069314176 10:67077249-67077271 GCATTGACAAAAGTTCATTCTGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073130440 10:101185435-101185457 TGATGGACACAGCTTTATTCTGG + Intergenic
1073395259 10:103212056-103212078 CGATGGACACAGCTTTATTCTGG - Intergenic
1073643590 10:105277136-105277158 AGATGGACCCTAGGTCATTCTGG + Intergenic
1073724464 10:106213746-106213768 AAATGGAAACAAGCTCATTCTGG - Intergenic
1073855216 10:107665584-107665606 TAAAGGACCCAAGTTCATTCTGG - Intergenic
1073907976 10:108306377-108306399 GGATAGACACAAGATCAGTTTGG - Intergenic
1075538749 10:123294781-123294803 GGAGGCACTCAAGTTCATTAGGG - Intergenic
1077141616 11:1027302-1027324 GGAGGGTTACAAGTTCATCCTGG - Exonic
1078432906 11:11301477-11301499 TGATGAACATAAGATCATTCTGG - Intronic
1078720898 11:13882318-13882340 GGCTGGAGCCAAGTTCACTCAGG + Intergenic
1081643396 11:44773773-44773795 GGATGGACACAAGACCAGCCTGG + Intronic
1081738494 11:45421830-45421852 GGATGGAGACAGGTCCAGTCAGG + Intergenic
1084354701 11:68630075-68630097 CGATGGACACAGCTTTATTCTGG - Intergenic
1087197388 11:95315008-95315030 CGATGGACACAGCTTTATTCTGG - Intergenic
1087487545 11:98775295-98775317 AGATAAACACAAGTTGATTCAGG - Intergenic
1089433699 11:118444232-118444254 GGATGGACAGAAGTTGAATATGG - Intronic
1089953842 11:122552828-122552850 CGATGGACACAGCTTTATTCTGG - Intergenic
1095054250 12:37581447-37581469 GGATGGTCACTAGGTCCTTCGGG + Intergenic
1095806258 12:46323942-46323964 TGATGGACACAGCTTTATTCTGG + Intergenic
1098055062 12:66496467-66496489 GGCTGAACACAAGGTCATACAGG + Intronic
1100643081 12:96501465-96501487 AGAAGGACACAAACTCATTCTGG - Intronic
1102780932 12:115563746-115563768 GGGTGTGCACAAGCTCATTCAGG - Intergenic
1103689251 12:122757678-122757700 GCATGGATAGAAGTTCATTGTGG + Intronic
1106179509 13:27358695-27358717 AGATGGGCACAAGTCAATTCAGG - Intergenic
1111996128 13:95167829-95167851 GAATGGACACACATTCATCCTGG + Intronic
1113732934 13:112655474-112655496 GTATGGACAAAGGTTCACTCTGG + Intronic
1117174670 14:53133960-53133982 CGATGGACACAGCTTTATTCTGG - Intronic
1119198464 14:72734854-72734876 GGATGTACCAAAGCTCATTCAGG - Intronic
1121309620 14:92928791-92928813 GGATGGACAGAAATACATCCAGG - Intronic
1122041395 14:98990139-98990161 CGATGGACACAGCTTTATTCTGG - Intergenic
1127707356 15:61560393-61560415 GGATGGACAGAAGTTCAGGTAGG + Intergenic
1128692574 15:69736358-69736380 GGATGTACACAAGTCCCTCCAGG - Intergenic
1130911836 15:88276187-88276209 AGATGGACCCAACTTCCTTCTGG - Intergenic
1133766335 16:8840693-8840715 CGATGGACACAGCTTTATTCTGG + Intronic
1136270300 16:29144492-29144514 GGATGGAGAAAAATTCCTTCAGG - Intergenic
1139719562 16:68841634-68841656 GTATGGGCACAGGTTCATTTGGG - Intergenic
1142073890 16:88106326-88106348 GGATGGAGAAAAATTCCTTCAGG - Intronic
1142934505 17:3317128-3317150 AGATGAGCAGAAGTTCATTCTGG + Intergenic
1147232367 17:39028825-39028847 GGCTTGACATAAGTTCCTTCTGG - Intergenic
1147312038 17:39601201-39601223 GGCTGGATCCAAGTTCAATCAGG - Intergenic
1150419126 17:65015172-65015194 GGATGAAAACAAGTAGATTCTGG - Intronic
1150826753 17:68483144-68483166 GCATGGACCCAAGTTCATATTGG + Intergenic
1158394248 18:57067397-57067419 CGATGGACACAGCTTTATTCTGG + Intergenic
1159622838 18:70658467-70658489 CGAAGGAAACAAGTTCTTTCAGG + Intergenic
1160317850 18:77864991-77865013 GGATAGACTCAAGTAAATTCAGG - Intergenic
1162898421 19:13779267-13779289 GGATGGGCAGAAGTGAATTCTGG - Intergenic
1163899680 19:20090458-20090480 CGATGGACACAGCTTTATTCTGG + Intronic
1164153449 19:22573740-22573762 CGATGGACACAGCTTTATTCTGG - Intergenic
1164705853 19:30319132-30319154 GCATGGCCACAAGTGTATTCTGG + Intronic
1166397127 19:42449693-42449715 TGATGGACACAGCTTTATTCTGG + Intergenic
1167092264 19:47352772-47352794 GGATGGACACAAGTTCATTCTGG - Exonic
1168570653 19:57466282-57466304 GGTTGGACACAAGTTCTGGCTGG - Intronic
1168632531 19:57968546-57968568 GGAGGCAAACAAGGTCATTCTGG + Intronic
925705586 2:6681732-6681754 GGTTGGCCACAAATTCATGCTGG - Intergenic
932127216 2:69155159-69155181 GGCTGGCAACAAGTTAATTCAGG - Intronic
933178377 2:79201961-79201983 AGATGTACACTAGTTCAGTCCGG + Intronic
934227422 2:90146337-90146359 CGATGGACACAGCTTTATTCCGG + Intergenic
936280715 2:111137341-111137363 GAATGGAGACAACTTAATTCTGG - Intronic
939310007 2:140463817-140463839 GGAGAGACACAAGTTTATTTTGG - Intronic
941455664 2:165710332-165710354 CGATGGACACAGCTTTATTCTGG + Intergenic
943412459 2:187560692-187560714 CGATGGACACAGCTTTATTCTGG + Intronic
1169531745 20:6492406-6492428 GGATGGAAATAACTCCATTCCGG - Intergenic
1178151859 21:29804046-29804068 GGATGGACAGAAGCTCATAATGG + Intronic
1182921587 22:34085108-34085130 GGATGGATTCAAGTACATTTTGG - Intergenic
1184436992 22:44485118-44485140 AGATGGGGACAAGTGCATTCTGG - Intergenic
949671562 3:6402615-6402637 CGATGGACACAGCTTTATTCTGG - Intergenic
952297407 3:32073453-32073475 TGATGGATACAACTTTATTCTGG - Intronic
955452157 3:59080699-59080721 TGATTGACACATATTCATTCTGG - Intergenic
959101985 3:102021137-102021159 GGATGGACACAAAATAATTCAGG + Intergenic
959244885 3:103852891-103852913 GGATGAATAAATGTTCATTCAGG + Intergenic
959574104 3:107915694-107915716 AGATGGAAACAAGTTGACTCAGG - Intergenic
965458511 3:168932469-168932491 TGATGGACACAGCTTTATTCTGG + Intergenic
966067332 3:175833453-175833475 CGATGGACACAGCTTTATTCTGG - Intergenic
968412508 4:402304-402326 TGATGGACACAGCTTTATTCTGG + Intergenic
970819508 4:20196439-20196461 CGATGGACACAGCTTTATTCTGG - Intergenic
971005766 4:22373076-22373098 GCATGGCCACAACTGCATTCTGG + Intronic
971911399 4:32800777-32800799 GAATGGACACAAGTTCAATTTGG - Intergenic
975633703 4:76424820-76424842 GGAGGGACACAGGTTCCTTGAGG - Intergenic
976288055 4:83389231-83389253 GGATGAACACGTGTTCTTTCAGG - Intergenic
977042077 4:92028367-92028389 CGATGGACACAGCTTTATTCTGG - Intergenic
979268402 4:118730936-118730958 GCTTGGAGACAAGTTCCTTCAGG - Intronic
980285697 4:130776288-130776310 AGATAGACACCAGGTCATTCAGG - Intergenic
980384827 4:132075224-132075246 GGATGAACACAAATTGATTCAGG - Intergenic
981652466 4:147075512-147075534 GGATGGACCAATGCTCATTCTGG - Intergenic
981968206 4:150632596-150632618 GGATGGAAAGTAGTTCATTGTGG - Intronic
983328645 4:166293657-166293679 GGATAGACACAACTTGATCCAGG + Intergenic
983454063 4:167940642-167940664 AGAAGAACACAAGTTCCTTCAGG - Intergenic
986210586 5:5667769-5667791 AAATGGACACAAGTTATTTCTGG + Intergenic
986368454 5:7058151-7058173 CGATGGACACAGCTTTATTCTGG + Intergenic
989660318 5:43790981-43791003 TGATGGACACAGCTTTATTCTGG - Intergenic
993111099 5:83658260-83658282 TGATGGACACAAATCCATCCTGG - Intronic
993151804 5:84172174-84172196 GGTTGGAGACAAGTCCATTTTGG + Intronic
996358219 5:122619652-122619674 CGATGGACACAGCTTTATTCTGG + Intergenic
996894806 5:128468081-128468103 GAATGGACACAAGTTCTTTTTGG - Intronic
1001213424 5:169832566-169832588 GGATGGAAACCAGTTCAAACAGG + Intronic
1001270297 5:170306129-170306151 CGAGGGACTCAAGTCCATTCTGG + Intergenic
1004881095 6:20009287-20009309 GGATGGTGACAAGGGCATTCTGG - Intergenic
1006377079 6:33677581-33677603 GGATGCCCACAAGGTCATGCTGG + Exonic
1008632620 6:53377900-53377922 GGGTGGAGACTAGTTCATTCAGG + Intergenic
1010586220 6:77660763-77660785 CGATGGACACAGCTTTATTCTGG + Intergenic
1011819358 6:91232925-91232947 AGATGTACACAAATTCATACAGG + Intergenic
1012145397 6:95673976-95673998 GGATGGACTCAAGGGCATACTGG - Intergenic
1013419145 6:109950440-109950462 GGATGCACACTGGTTCACTCTGG + Intergenic
1015104875 6:129524046-129524068 GGATGCAAACAAGTTCTTTCTGG + Intergenic
1015636678 6:135282179-135282201 GGATGGACACAATTATATGCAGG - Intergenic
1020361502 7:7331420-7331442 TTTTGGACACAAGTTGATTCCGG - Intergenic
1023493664 7:40770797-40770819 GGAGGGACACCAGTGCATTGGGG - Intronic
1023537111 7:41225240-41225262 GGATGGACACAGCCACATTCAGG + Intergenic
1024097329 7:45993182-45993204 GGATGGATATAATTTCATTTGGG + Intergenic
1024343661 7:48291645-48291667 GGTTGCACACTAGTTCATCCAGG + Intronic
1026180099 7:68031699-68031721 GGGTGGACACACGTTCATTTAGG - Intergenic
1032104032 7:129009971-129009993 TGATGGACTCATGTTCATTTAGG - Intronic
1032834406 7:135660041-135660063 GGATGCATACAAGTACATCCAGG + Intergenic
1036904788 8:12699111-12699133 GAATGGGCACAGGATCATTCGGG - Intergenic
1037659181 8:20912479-20912501 GGAAGGTCACTAGTTCTTTCTGG + Intergenic
1038218907 8:25588845-25588867 AGATGGACAGAAGTTAATACAGG - Intergenic
1041196544 8:55407209-55407231 GGCTGGCCCCAAGTTCTTTCTGG - Intronic
1041961784 8:63625744-63625766 CTATTGAAACAAGTTCATTCTGG + Intergenic
1043721317 8:83549048-83549070 GGATGGACACAGCTTTATCCTGG - Intergenic
1046271391 8:111902172-111902194 GGGTGGACACCACCTCATTCTGG - Intergenic
1046396139 8:113642206-113642228 AGAAGAACACAAGTTTATTCTGG + Intergenic
1046544380 8:115630156-115630178 GGATGACCACAAGTTCCTTCTGG + Intronic
1046782088 8:118226505-118226527 AGATGGACAGAAGTTCTTTCAGG - Intronic
1049035990 8:140076523-140076545 GGATGGACACACGTTGGCTCGGG - Intronic
1050871231 9:10572821-10572843 GGATGGACACTGTTTCATTCTGG - Intronic
1052271100 9:26628664-26628686 GGCTGGAATCAAGGTCATTCAGG + Intergenic
1054182322 9:61919366-61919388 AGATGGAAAAAAGTTCAGTCTGG + Intergenic
1054656188 9:67669113-67669135 AGATGGAAAAAAGTTCAGTCTGG - Intergenic
1055370253 9:75590751-75590773 AGATGGACACTATTACATTCTGG + Intergenic
1055646531 9:78366901-78366923 GGATGGACACAGGGTACTTCAGG + Intergenic
1056870247 9:90270725-90270747 GCATGGGCACATATTCATTCAGG + Intergenic
1060096828 9:120798543-120798565 GAAAGGACACGTGTTCATTCAGG - Intergenic
1185701279 X:2232302-2232324 AAGTGGATACAAGTTCATTCAGG - Intronic
1187947991 X:24445168-24445190 GGATGGTCACAAGTTGTCTCAGG - Intergenic
1193065227 X:77252731-77252753 GGTAGAACACAAGGTCATTCTGG + Intergenic
1194496889 X:94627308-94627330 CGATGGATACAAGTTCCTTGTGG - Intergenic
1196022526 X:111005415-111005437 AGATTGACCCAAATTCATTCAGG + Intronic
1200066181 X:153505116-153505138 GGATGGCTCCAAGTTCATGCTGG + Intronic
1201937615 Y:19424906-19424928 CGATGGACACAGCTTTATTCTGG - Intergenic
1202076042 Y:21038863-21038885 TGATGGACACAGCTTTATTCTGG + Intergenic