ID: 1167094054

View in Genome Browser
Species Human (GRCh38)
Location 19:47364242-47364264
Sequence TGGGCGTGGCCACGAGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167094054_1167094064 26 Left 1167094054 19:47364242-47364264 CCTCAGTCTCGTGGCCACGCCCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1167094064 19:47364291-47364313 TCCTTGTGCTCAGGAACAAAAGG 0: 1
1: 0
2: 2
3: 27
4: 234
1167094054_1167094058 -6 Left 1167094054 19:47364242-47364264 CCTCAGTCTCGTGGCCACGCCCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1167094058 19:47364259-47364281 CGCCCAACCGTGAAGGAGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 92
1167094054_1167094059 -5 Left 1167094054 19:47364242-47364264 CCTCAGTCTCGTGGCCACGCCCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1167094059 19:47364260-47364282 GCCCAACCGTGAAGGAGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 143
1167094054_1167094056 -10 Left 1167094054 19:47364242-47364264 CCTCAGTCTCGTGGCCACGCCCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1167094056 19:47364255-47364277 GCCACGCCCAACCGTGAAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 55
1167094054_1167094063 17 Left 1167094054 19:47364242-47364264 CCTCAGTCTCGTGGCCACGCCCA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1167094063 19:47364282-47364304 GAAGTGTAGTCCTTGTGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167094054 Original CRISPR TGGGCGTGGCCACGAGACTG AGG (reversed) Intronic
900249883 1:1663043-1663065 TGGGCATGGAGAGGAGACTGAGG + Exonic
900260919 1:1728953-1728975 TGGGCATGGAGAAGAGACTGAGG + Intronic
900392901 1:2441395-2441417 TGGGGGTGGGCAGGAGCCTGGGG + Intronic
901381548 1:8878108-8878130 TGGAGATGGCCACGAGGCTGCGG - Intronic
907431287 1:54413524-54413546 TGGGCTTGGCCATGTGACTTGGG - Intergenic
916140569 1:161693538-161693560 TGGGCGTGGCAAAGCGGCTGTGG + Intergenic
920009512 1:202857691-202857713 TGCCCGTGGCCACTACACTGCGG - Intergenic
1063211006 10:3881300-3881322 TGGGCGGGGCCACGGGAGCGGGG + Intergenic
1063374322 10:5545018-5545040 GGGGCATGGCCACAGGACTGAGG - Intergenic
1069796288 10:71053754-71053776 TGTGCGGGGCCAGGTGACTGAGG - Intergenic
1071031275 10:81184610-81184632 TGGGGATGGCTAGGAGACTGGGG + Intergenic
1076533122 10:131158851-131158873 TGGGCTTGGCCGCGAGAGGGAGG + Intronic
1077390079 11:2296777-2296799 TGGGGGTGGCCACGAGGCCCCGG - Intronic
1077405813 11:2382082-2382104 TGGGCGTGGCCCCCTGCCTGAGG - Intronic
1078023534 11:7673783-7673805 GGGGCGACGCCACGAGTCTGCGG - Exonic
1083319634 11:61837912-61837934 TGGGGGTGGAGACGAGGCTGGGG + Intronic
1083751903 11:64765656-64765678 TGGGCTGGGCCAAGCGACTGAGG - Intronic
1084373511 11:68760514-68760536 TGGGTGGGGCCCCCAGACTGGGG + Intronic
1085024360 11:73228029-73228051 TGGGCGTGGCCCCAGGCCTGGGG + Exonic
1085339416 11:75721655-75721677 TGGTCGTGACCTCGAGTCTGGGG + Intronic
1085389168 11:76173585-76173607 TGGGCGTAGCCAAGCGCCTGAGG + Intergenic
1088691728 11:112334285-112334307 TGGGTGTGCACATGAGACTGGGG - Intergenic
1091302210 11:134514879-134514901 TGGGCGTGGCAGTGAGGCTGAGG + Intergenic
1091321920 11:134657742-134657764 AGGGCGTGGCCAGGAGCCTCAGG + Intergenic
1092489335 12:8930848-8930870 TGGGAGTGGCCAGCAGAATGTGG + Exonic
1095942652 12:47736968-47736990 TGGGCGTGGCAGGGAGGCTGAGG - Intronic
1096946457 12:55413689-55413711 TGGGAGTGGCCAGCAGAATGTGG - Intergenic
1097269489 12:57765453-57765475 GGAGCGGGGCCAGGAGACTGCGG + Exonic
1100658307 12:96670496-96670518 TAGGTGTGGCCATGTGACTGTGG - Intronic
1100977462 12:100137322-100137344 TGGGATTGGCCACTAGATTGAGG - Intronic
1101112664 12:101501361-101501383 TGGGCGCAGCCACGACACTGTGG - Intergenic
1102298260 12:111753709-111753731 TGGGGGTGGCCACGAGAGGCGGG - Intronic
1106411452 13:29514246-29514268 TGGCCGGGGCCACTAGGCTGCGG - Exonic
1108114863 13:47116110-47116132 TGTGTGTGGCCTTGAGACTGTGG + Intergenic
1108379152 13:49840221-49840243 TGGGTGTGGCCATGAGATTAAGG - Intergenic
1113584845 13:111458178-111458200 GGGGCGTGGGCTCCAGACTGTGG - Intergenic
1118485740 14:66213028-66213050 TGGGTGGGGCCACGGGAATGGGG + Intergenic
1121432287 14:93896141-93896163 TCAGCGTGGCCATGTGACTGGGG + Intergenic
1122088197 14:99321213-99321235 TGGGCGAGGACCCGAGCCTGCGG - Intergenic
1122904130 14:104794252-104794274 TGGGCGTGGCCTGGAGGCAGAGG + Intronic
1128146066 15:65333144-65333166 AGGGCGAGTCCAGGAGACTGGGG + Intronic
1128385852 15:67147650-67147672 TGGACCTGGACACGACACTGGGG - Intronic
1129035113 15:72644405-72644427 TGGGCAGGGCCACTAGGCTGAGG + Intergenic
1129214769 15:74092811-74092833 TGGGCAGGGCCACTAGGCTGAGG - Intergenic
1129390616 15:75218850-75218872 TGGGCCGGGCCACTAGGCTGAGG + Intergenic
1129525608 15:76211990-76212012 TTGGCCTGTCCACTAGACTGTGG - Intronic
1130655863 15:85791882-85791904 TGGGCTTTGGCACCAGACTGGGG - Intronic
1139212421 16:65092606-65092628 TGGGCTTGGCCACTTGGCTGTGG - Intronic
1147964441 17:44186700-44186722 GGGGCGTGGCTTCGCGACTGCGG - Intergenic
1148463488 17:47851195-47851217 TGGGCGGGGCCGCGAGTCCGGGG - Intronic
1151551314 17:74824053-74824075 GGGGGCTGGCCATGAGACTGGGG + Intronic
1154502642 18:15004359-15004381 TGGGTGCGGCCTGGAGACTGGGG - Intergenic
1158137770 18:54224765-54224787 GGGGCGTGGCCCCGAGAAGGCGG - Exonic
1161489656 19:4555015-4555037 TGGGCCTGTCCCCGAGGCTGCGG + Exonic
1163478398 19:17540063-17540085 TAGGCGTGGCCTTGAGGCTGAGG + Intronic
1163605837 19:18274842-18274864 TGGGTGTGGCTCTGAGACTGCGG + Intergenic
1164589168 19:29496660-29496682 TGGCAGTGGCCAGGGGACTGGGG - Intergenic
1164741518 19:30579600-30579622 TGGGTGTGGCCATGTGACTGTGG - Intronic
1165160509 19:33813023-33813045 TGGCCGTGGGCATGAGACCGAGG + Exonic
1166293864 19:41879467-41879489 TGGGCGGGGCCAGGAGGCTAGGG + Intronic
1167094054 19:47364242-47364264 TGGGCGTGGCCACGAGACTGAGG - Intronic
1167293292 19:48635916-48635938 TGGGCCAGGCCTGGAGACTGCGG - Exonic
1167330370 19:48852124-48852146 TGGGCGGGGCCTCGATTCTGTGG + Intronic
1168119923 19:54246140-54246162 TGGGGGAGGACACGAGAGTGTGG + Intronic
925046005 2:773651-773673 TGGGTGGGGGCACCAGACTGGGG - Intergenic
925046065 2:773862-773884 TGGGTGGGGGCACCAGACTGTGG - Intergenic
925046129 2:774073-774095 TGGGTGGGGGCACCAGACTGGGG - Intergenic
932085249 2:68751908-68751930 TGGGAGTGGCCACTAGATGGCGG + Intronic
935181286 2:100693145-100693167 TGGGTGTGGCCAAGAGTCTGAGG + Intergenic
936934955 2:117830396-117830418 TAGGAGTGGCCACGTGACTGTGG - Intronic
938501811 2:131834529-131834551 TGGGTGCGGCCTGGAGACTGGGG - Intergenic
942378319 2:175359923-175359945 TGGTGGTTGCCACGTGACTGGGG + Intergenic
947415965 2:229896494-229896516 TGGGCATGGTCAGGAGGCTGAGG + Intronic
947826005 2:233106479-233106501 TGGGCTTGGCCACATGACTCTGG - Intronic
948444410 2:238020947-238020969 TGGGCGTCCCCACCAGCCTGAGG - Intronic
1169795048 20:9453120-9453142 TGGGCATGTTCACTAGACTGAGG + Intronic
1172409246 20:34709744-34709766 GGGGCGTGGCCAAGAGGCTGGGG + Intronic
1172799064 20:37563919-37563941 TGGGTGGGGCCACAGGACTGGGG - Intergenic
1173071817 20:39775403-39775425 TGGAGGTGTCCACGAGGCTGGGG + Intergenic
1173102660 20:40101633-40101655 AGGGCTTAGCCACTAGACTGGGG + Intergenic
1173821308 20:46022099-46022121 TGGGCGTGGCCACGAGGGAAAGG + Intronic
1175479541 20:59301510-59301532 TGGCCCTGGCGAGGAGACTGTGG + Exonic
1175947656 20:62566232-62566254 TGGGAGTGGCCGAGAGGCTGGGG + Intronic
1176230333 20:64029479-64029501 TGGCCGTGGCCAAGTGAGTGGGG + Exonic
1178514648 21:33236399-33236421 TGGACGTGGCCACTACACTGTGG - Intronic
1179007510 21:37528561-37528583 TGGGAGTGGGAAGGAGACTGGGG - Intergenic
1180915374 22:19482428-19482450 TGAGCCTGTCCACGAGACTTGGG + Intronic
1182368822 22:29796812-29796834 TGTGCTGGGCCAGGAGACTGAGG + Intronic
1183398656 22:37588075-37588097 TTGGCGTGGCCCTGAGACGGAGG - Intergenic
1184217900 22:43079432-43079454 TTGGCGTGGCCCCGTGTCTGCGG - Intronic
1185015051 22:48338337-48338359 TGGGGGTGGCCATGAGGATGGGG + Intergenic
949785060 3:7731821-7731843 TGGGTGGGGCCACAAGAGTGGGG - Intronic
950055051 3:10017710-10017732 TGGGCCAGGCCAGGAGCCTGAGG + Intergenic
953558344 3:43964699-43964721 TGGGGGTGGCCAAGGGCCTGGGG - Intergenic
954294130 3:49664826-49664848 TGGGCATGGTCACCAGAATGAGG - Exonic
954628881 3:52037660-52037682 TAGGCGGGGCCAGGAGGCTGAGG - Intergenic
954808645 3:53234598-53234620 AGGACGTGGCCACCAAACTGAGG + Intronic
955215496 3:56981986-56982008 TGGGAGTGGCCCCAAGACTTTGG + Intronic
960012527 3:112849241-112849263 TGGGAGAGGCCAGTAGACTGAGG - Intergenic
960785850 3:121372227-121372249 TGGGAGAGGCCAGAAGACTGAGG + Intronic
962788984 3:138793580-138793602 TGGGCGTTGCAGCGAGACTCTGG + Intronic
964194275 3:154044887-154044909 TGGCAGTGGCCACCACACTGAGG - Intergenic
966912253 3:184566138-184566160 TGGGTCTGGCCAGGAGGCTGGGG - Intronic
967204591 3:187107994-187108016 TGGCCATGGGCACAAGACTGTGG - Intergenic
968199430 3:196739866-196739888 TGCGCGTGGCCACAACCCTGGGG - Exonic
980148768 4:129021579-129021601 TGGGCGTGGCAAAGTGGCTGTGG + Intronic
981090507 4:140727399-140727421 TGAACGTGGCCACCAGAATGGGG - Intronic
981447319 4:144854947-144854969 TGAGCTTGGCCATGAGACTCTGG - Intergenic
983485873 4:168331111-168331133 TGGGCATGGCAAAGAGATTGTGG - Intergenic
984752342 4:183289863-183289885 TGGGCGTGGCCAGTAGGGTGAGG + Intronic
985517464 5:354330-354352 TGGGCATGGTCAGGAGGCTGAGG + Intronic
987033753 5:13999369-13999391 TGGTGGTGGCCAGGAGGCTGGGG - Intergenic
987576849 5:19739556-19739578 TGTGTGTGGCCACTAAACTGTGG + Intronic
988372407 5:30388398-30388420 TGGGTGGGGCCATGAGAGTGGGG - Intergenic
997597077 5:135114192-135114214 TGGGTGCAGCCACGAGGCTGGGG + Intronic
1006487361 6:34354300-34354322 TGGGCCTGGCCAGGAGTTTGAGG + Intronic
1007190950 6:40017949-40017971 TGGGTGTGGTTATGAGACTGTGG - Intergenic
1012972715 6:105748857-105748879 TGAGCGATGCCATGAGACTGGGG + Intergenic
1013316868 6:108951678-108951700 CGGGTGTGGCCAGGAAACTGGGG - Intronic
1013752536 6:113423742-113423764 TGGACGTGGCCATGGGGCTGGGG - Intergenic
1019531534 7:1505995-1506017 TGGGTGTGGCCATTTGACTGTGG + Intergenic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1019719418 7:2559282-2559304 TGCGCGGGGCCCCGAGGCTGCGG - Intronic
1019733769 7:2640713-2640735 TGGGCATGGCCAGGAGGCCGCGG + Intronic
1020092275 7:5348454-5348476 GGGGCGTTGGCAGGAGACTGTGG - Intronic
1027135726 7:75622641-75622663 TGGGGGAAGCCAGGAGACTGTGG + Intronic
1035024820 7:155818602-155818624 TGGGCGGGGCCACGATCCAGTGG - Intergenic
1035174544 7:157040747-157040769 TGGGCGTGGTCAGGAGGCTGAGG + Intergenic
1035644242 8:1206222-1206244 GGTGCGTGGCCAAGAGACTGTGG - Intergenic
1038726044 8:30083207-30083229 TGGGCGGGGCCAAGGGCCTGGGG + Exonic
1042135374 8:65628364-65628386 CGGGCGTGGCTAGGAGGCTGAGG - Intronic
1045897772 8:107239288-107239310 TGAGGATGGCCATGAGACTGCGG - Intergenic
1049261259 8:141640458-141640480 TGGCCGTGGGCACCACACTGCGG + Intergenic
1049408667 8:142462818-142462840 TGGGGGTGGTGAGGAGACTGAGG + Intronic
1049812213 8:144580649-144580671 TGGGCGGGGCCACGTGAGAGCGG - Intronic
1052851875 9:33383556-33383578 TGGGCGTGGAGACGAGAGCGGGG - Intergenic
1059153664 9:111970944-111970966 TGGGGGTGGCCATGAGCCTGTGG + Intergenic
1062586291 9:137251433-137251455 TGGGAGTGGCCAGGGGGCTGAGG + Intronic
1188771384 X:34158233-34158255 TGGGAGAGGCCAGCAGACTGAGG + Intergenic
1192935164 X:75851103-75851125 TGGGCAAGGCCAGCAGACTGAGG + Intergenic
1197262419 X:124333144-124333166 TGCGAGTGGCCACGAGGCAGCGG + Intronic
1197439375 X:126471321-126471343 TGGTGGTGGCCATGAGAGTGGGG + Intergenic
1199601602 X:149544466-149544488 GGGGCGGGGCCACGGGCCTGAGG + Intronic
1199648775 X:149935017-149935039 GGGGCGGGGCCACGGGCCTGAGG - Intronic
1199792317 X:151166918-151166940 TGGGAGTGGACACGAGAGGGAGG + Intergenic
1199808696 X:151327752-151327774 AGGGCCTGGCCAGGAGGCTGGGG + Intergenic