ID: 1167094838

View in Genome Browser
Species Human (GRCh38)
Location 19:47369635-47369657
Sequence CGGTGGGCACAGTGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167094827_1167094838 9 Left 1167094827 19:47369603-47369625 CCGCTGATTGCTGCTCAGGTGGA 0: 1
1: 0
2: 0
3: 21
4: 142
Right 1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG 0: 1
1: 0
2: 2
3: 48
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167094838 Original CRISPR CGGTGGGCACAGTGGGGGCT GGG Intronic
900186872 1:1336870-1336892 CCGGGGGGACAGTGGGGCCTTGG - Intronic
900314395 1:2049908-2049930 CTGGGGGCGGAGTGGGGGCTGGG + Intergenic
900947856 1:5841288-5841310 CTGTGGGGACCGTGGGGGCAGGG - Intergenic
901317889 1:8321467-8321489 AGTTGGGCACAGTGGGGGTGGGG - Intronic
901577370 1:10211138-10211160 CGCTGGGCACAGCCGGGGCCTGG - Intronic
901624719 1:10617483-10617505 CCGCAGGTACAGTGGGGGCTGGG - Intronic
901666977 1:10831647-10831669 CTGTGGGCCCAGTGGGCCCTGGG + Intergenic
902210846 1:14903394-14903416 AGGTGGGCACACTGGGGCCCTGG + Intronic
902395771 1:16131887-16131909 CAGAGGGCACAGTGGTGACTGGG - Intronic
902650930 1:17837105-17837127 GGATGGGGACAGTGGGGGTTTGG + Intergenic
902715984 1:18272987-18273009 TGGAGGGCCCAGTGGGGGCAAGG - Intronic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903196903 1:21696887-21696909 CGGTGGGGGCGGTGGGGGATGGG + Intronic
903639988 1:24852522-24852544 TGAAGGGTACAGTGGGGGCTTGG + Intergenic
904207476 1:28864381-28864403 CGGTGGCCACAGTGGGGCTTGGG + Intergenic
904319786 1:29689445-29689467 GGGTGGGCACAGCTGGGGATGGG - Intergenic
905329159 1:37180060-37180082 AGGTGGGCACTGTGTGGGCAGGG - Intergenic
907894552 1:58673888-58673910 AGGTGGGCAGGGTGTGGGCTGGG + Intronic
908097850 1:60759078-60759100 TGGTGTGCACACTGGGGGCTGGG - Intergenic
908656413 1:66393786-66393808 AGGTGGGAACAGCGGGGGCTAGG + Intergenic
909860125 1:80594340-80594362 GGGTGGGCACAGGGGGAGGTGGG + Intergenic
910197145 1:84653455-84653477 CAGTGGGCATAGTGAGGGATGGG - Intronic
912704850 1:111904307-111904329 AGGTTGGCCCAGTGGGTGCTGGG - Intronic
915270015 1:154747210-154747232 CCCTGGGTACAGTGGTGGCTGGG - Intronic
915310875 1:155005235-155005257 GGGTGGGGACAGTGAAGGCTGGG + Intronic
917853299 1:179082799-179082821 CAGTGGGCCGAGTCGGGGCTGGG + Intronic
918487482 1:185045289-185045311 CGGTGGGCGCCGGGGGGGCGTGG + Intergenic
919878776 1:201888982-201889004 CGGGTGGCATGGTGGGGGCTGGG - Exonic
920389365 1:205589334-205589356 CGGTAGGCAGGGTGGGGGATCGG + Intronic
921604604 1:217138622-217138644 AGGAAGGCACAGTGGGGGCGGGG + Intergenic
922706825 1:227794637-227794659 GGGTGGGCCCACTGGGTGCTGGG + Intergenic
922792435 1:228317695-228317717 CTGTGGGCCCTGTGGGTGCTGGG + Exonic
922955115 1:229592986-229593008 CGTTGGGGACAGTGTGGCCTAGG + Intergenic
923447445 1:234085583-234085605 GGGTGGGCACACTGAGGTCTGGG - Intronic
924570890 1:245236783-245236805 CCGTGAGCCCCGTGGGGGCTGGG + Intronic
1063381817 10:5590539-5590561 GGGGGGGCGCGGTGGGGGCTGGG - Intergenic
1065632757 10:27697808-27697830 TGGTGGGAACAGAGGGGGGTTGG + Intronic
1065794357 10:29292344-29292366 CGAGGGGCACATCGGGGGCTGGG - Intronic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1067694946 10:48527937-48527959 CAGTGGGCACAATGGGCTCTGGG + Intronic
1069079898 10:64077451-64077473 GGGTGGGGACAGTGGTGGGTGGG + Intergenic
1069430131 10:68327288-68327310 CGATGGTCACACTGGGGGCAGGG - Intronic
1069709723 10:70480493-70480515 GGGTGGGCACAGTAGGGCCCAGG + Intronic
1070005698 10:72422069-72422091 CATTGGGCACAGTAGGGGTTAGG - Intronic
1070121075 10:73577967-73577989 CTGTGAGCAAAGTGGAGGCTTGG - Intronic
1070332773 10:75430271-75430293 CGGAGGGCAGAGTGCTGGCTGGG + Intergenic
1070382462 10:75893231-75893253 CTGAGGGCTCAGTGGGTGCTAGG + Intronic
1070541734 10:77420289-77420311 CGGTGGGTGCAGGGGAGGCTAGG - Intronic
1071495912 10:86167520-86167542 CTGTGGGGACAGTGGTTGCTGGG + Intronic
1074110183 10:110417404-110417426 CGGTGGGGATACTGTGGGCTTGG - Intergenic
1076314459 10:129530965-129530987 AGGTGGGCAGAGTGGCGGTTAGG - Intronic
1076525935 10:131112400-131112422 TGGGAGGCACAGTGGGGGCCTGG - Intronic
1076529920 10:131137290-131137312 GGGAGGGCACAGTGAGAGCTCGG - Intronic
1076809208 10:132878129-132878151 GGGTGGGCAGAGTGGGCGGTGGG - Intronic
1077142601 11:1031073-1031095 GGGTCAGCACCGTGGGGGCTGGG + Intronic
1077352681 11:2100127-2100149 GGCGGGGCAGAGTGGGGGCTGGG + Intergenic
1077551872 11:3204083-3204105 TGGGGGGCAGAGTGGGGGCTGGG - Intergenic
1078107775 11:8369527-8369549 AGGTGGGGGCAGTGGGGCCTGGG + Intergenic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1081773319 11:45662900-45662922 CGGTGGGGACTGTGAGGGGTGGG - Intronic
1083429393 11:62606088-62606110 CGGCTGGTACAGTGGGGGCCCGG - Exonic
1083688623 11:64392697-64392719 CGGGGGGCCCTGTTGGGGCTGGG + Intergenic
1083702805 11:64490837-64490859 CAGTGGGCAGCGTGGGGACTGGG - Intergenic
1083734579 11:64672141-64672163 TGGGGAGTACAGTGGGGGCTGGG - Intronic
1084657035 11:70525714-70525736 CAGGGGGCAAAGTGGTGGCTTGG - Intronic
1084792123 11:71481571-71481593 AGGTGGGCACAGTGGCTGGTGGG + Intronic
1084857874 11:72000480-72000502 TGCTGGGAACACTGGGGGCTGGG - Exonic
1084899345 11:72298100-72298122 TGGTGGGAGGAGTGGGGGCTGGG + Intronic
1085122719 11:73977587-73977609 CAGTGGGTAGAGTGGGGACTTGG - Intronic
1085201439 11:74704576-74704598 CGCTGAGGCCAGTGGGGGCTGGG + Exonic
1085460004 11:76687876-76687898 GGGTGGGCAGGGTGAGGGCTGGG + Intergenic
1085800545 11:79585388-79585410 ATATGGGCAGAGTGGGGGCTTGG + Intergenic
1088989808 11:114942957-114942979 CAGTGGCCACAGTGGGGACCCGG - Intergenic
1089302533 11:117507336-117507358 GAGTGGCCACAGTGGGGGATGGG + Intronic
1089310891 11:117557440-117557462 GGTTGGGTACAGTGGGAGCTGGG + Intronic
1089334276 11:117712302-117712324 GGGTGTGGACAGTGGGGGTTGGG + Intronic
1089343831 11:117777716-117777738 AGGTGGGCACGGTGGGGGAAGGG - Intronic
1089519886 11:119056711-119056733 CTGTGGGCACAGCGGGGCCGGGG - Intronic
1089787500 11:120918531-120918553 TGGTGAGCAGAGTGAGGGCTGGG - Intronic
1090029347 11:123194480-123194502 GGGTGAGCAGAGTGGGGGATAGG - Intronic
1091280265 11:134377826-134377848 CAGTGGGCTGAGTGGGGGCATGG - Intronic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1091664920 12:2412062-2412084 AGGTGGGCATGGGGGGGGCTTGG - Intronic
1092149276 12:6236077-6236099 TGGTGGGCAGAGGGTGGGCTGGG - Intronic
1093011946 12:14116432-14116454 GGCTGGCCACAGTGGTGGCTGGG + Intergenic
1093937925 12:25020776-25020798 TGGTGGGCACTGTGGGGGTGGGG - Intergenic
1094350122 12:29515265-29515287 CAGTGGGGTCAGTGGGTGCTGGG - Intronic
1095749812 12:45697468-45697490 CCGTGGGGCCAGTGGGAGCTGGG - Intergenic
1096675460 12:53223430-53223452 CGTTGGGCAGGATGGGGGCTGGG + Intronic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1101963222 12:109265305-109265327 CGGTGAGCACAGGGGGTGCTGGG + Intronic
1102962340 12:117100714-117100736 CGGTGCCCACAGAGGGGACTCGG + Intergenic
1103558293 12:121779007-121779029 CGGAGGCCACCGAGGGGGCTGGG - Exonic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1103780762 12:123397326-123397348 CGGTGGTCACTGTGGGGGTGAGG - Intronic
1103915197 12:124372437-124372459 GGGTGGGCTCAGTGGGGGCCGGG + Exonic
1104192354 12:126494286-126494308 CTCTTGGCACAGTGAGGGCTGGG + Intergenic
1104392142 12:128400245-128400267 GGGTGGGCACAGTGAGGGAAGGG - Intronic
1104774976 12:131385702-131385724 CGCTGGGCTCAGTAGGGGCGTGG - Intergenic
1104875148 12:132028713-132028735 CGGTGGGCACGGTGGGCACCCGG + Intronic
1105295912 13:19087825-19087847 GGGTGGGCTCAGTGTGTGCTGGG - Intergenic
1105303002 13:19152029-19152051 CGGTGGCCCCAGAGGCGGCTGGG - Intergenic
1105882458 13:24616273-24616295 CGTGGGGTCCAGTGGGGGCTTGG - Intergenic
1106582755 13:31032016-31032038 TGGTAGGCACAGCGGGGGGTGGG - Intergenic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1110722716 13:78782906-78782928 GAGTGGGGAAAGTGGGGGCTTGG + Intergenic
1112486605 13:99825886-99825908 TGGTGGGCAGAGAGGGGACTGGG - Intronic
1113781676 13:112980926-112980948 ACATGAGCACAGTGGGGGCTTGG + Intronic
1113794728 13:113050643-113050665 CGGTGGGAGCCGTGGGGGCCGGG + Intronic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1114712697 14:24794608-24794630 GGGTGGGCACATTGGGGCTTGGG + Intergenic
1115559203 14:34568070-34568092 TGGTGGTGACAGTGGTGGCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119703184 14:76768804-76768826 GGGTGGGCTCAGTGTGGCCTTGG + Intronic
1120764021 14:88311903-88311925 AGGGGGGCACAGTGGCGTCTTGG + Intronic
1121007664 14:90500646-90500668 ATGTGAGCACAGTGGGGGCCTGG + Intergenic
1122206803 14:100151748-100151770 CGGGGGGCCCACTGGAGGCTGGG - Intronic
1122352581 14:101104558-101104580 AGGTGGGCTCTGTGGGGGCCCGG - Intergenic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1122772351 14:104103038-104103060 CAGTGGGCACAGTGGGTGCCTGG + Intronic
1122871557 14:104641187-104641209 CAGTGGGGACGGTGGGGGCTGGG - Intergenic
1124340972 15:28888942-28888964 CTGTGTGCCCGGTGGGGGCTGGG + Intronic
1124340988 15:28889001-28889023 CTGTGTGCCCAGCGGGGGCTGGG + Intronic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1127574080 15:60273156-60273178 CAGTGGCCACTGTGGGGGATGGG + Intergenic
1127964246 15:63912064-63912086 CGGGGGACAGGGTGGGGGCTAGG - Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1129382808 15:75178547-75178569 GGGCGGGCACTGTGGGGGGTGGG + Intergenic
1131826898 15:96329669-96329691 GGGTGTGCACAGGGGAGGCTGGG + Intronic
1132841186 16:1979183-1979205 GGGTGGGCACGGTGGGGGGAGGG + Exonic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133225077 16:4337113-4337135 CGGTGGGGGCAGTGGGGGTGGGG + Exonic
1133907993 16:10039128-10039150 CAGTGGGGACATTGGGGGGTGGG - Intronic
1134014480 16:10878841-10878863 TGGTGGCCACAGTAGGTGCTTGG + Intronic
1134125593 16:11613759-11613781 CCGAGGGCACAGAGGTGGCTGGG + Intronic
1134307421 16:13045751-13045773 TGGGGGACACAGTGGGGGCAGGG - Intronic
1135278783 16:21136294-21136316 TGGTGGGCATAAAGGGGGCTGGG - Intronic
1135821949 16:25692635-25692657 CGGCGGGCTCGGCGGGGGCTCGG - Exonic
1136087742 16:27897642-27897664 TGGGGGCCACAGTGCGGGCTAGG - Intronic
1137236776 16:46623980-46624002 GGGGGGGCACAGTGGCGGCGGGG + Intergenic
1137251798 16:46746796-46746818 CGGTGCAGACAGCGGGGGCTAGG + Intronic
1137607277 16:49795292-49795314 GGGTGGGGACAGTGGTGGCGTGG - Intronic
1138529407 16:57626994-57627016 AGGGAGGCACAGTGGGGACTGGG - Intronic
1138535236 16:57656449-57656471 GGGTGGACACAGTGGGGTCCTGG + Intronic
1139423555 16:66864486-66864508 CGGTGGGGACATGTGGGGCTTGG - Intronic
1141144101 16:81516691-81516713 CTGTGGGCTCCCTGGGGGCTGGG + Intronic
1141281897 16:82636387-82636409 GGATGGGCACCGTGGGGGCCTGG + Intronic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144366 16:88486710-88486732 CTGGGGGCACAGTGGATGCTGGG + Intronic
1142312866 16:89323994-89324016 AGCTGGGCACACTGGGGGTTTGG - Intronic
1142419202 16:89960119-89960141 AGGTGGGCTCAGAGGTGGCTGGG + Intronic
1142492101 17:285986-286008 CGGGGTGCACAGTGGGGCCTGGG - Intronic
1142959635 17:3544540-3544562 GGGTGGGCACAGTGGGTGGAGGG + Intronic
1143042571 17:4049773-4049795 CGGTGGGCACAGTGACTGGTAGG + Exonic
1143088672 17:4435501-4435523 GGGAGGGCACAGTGGGGGTGGGG + Intronic
1143217099 17:5233295-5233317 TGGGGAGCCCAGTGGGGGCTAGG - Intronic
1143276208 17:5712881-5712903 AGGTGGGCATAGTGGGTGTTCGG - Intergenic
1143639614 17:8188673-8188695 GGATAGCCACAGTGGGGGCTGGG + Exonic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145263762 17:21369642-21369664 CCGGGGGCCCAGTGTGGGCTGGG - Intergenic
1145273631 17:21417633-21417655 CTGTGGGCCCAGTGGGGACGGGG - Exonic
1145311826 17:21705075-21705097 CTGTGGGCCCAGTGGGGACGGGG - Intergenic
1145779470 17:27552793-27552815 TGGTGGCCACAGTGGGGTCCTGG + Intronic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148339758 17:46866320-46866342 CGGAGAGCACAGGAGGGGCTAGG + Intronic
1148630707 17:49106187-49106209 AGCTGGGCACAGTTGGAGCTGGG + Intergenic
1148644430 17:49211025-49211047 GAAGGGGCACAGTGGGGGCTTGG - Intronic
1148687571 17:49509275-49509297 GGGTGGGCAAAGTGGGGGCTGGG + Intronic
1148778916 17:50110860-50110882 GTCTGGGCACAGTGGGGGCTGGG - Exonic
1149563902 17:57628351-57628373 AGGAGGGCAGAGTGAGGGCTTGG + Intronic
1149657644 17:58318781-58318803 CCTTGTGCAGAGTGGGGGCTTGG - Intronic
1150141607 17:62734393-62734415 CGGTGGGCACAGGGGTGTCTGGG + Intronic
1150274066 17:63884651-63884673 AGGTGGGCACAGGGGTGGCAAGG + Intergenic
1150278379 17:63914185-63914207 AGGTGGGCACAGGGGTGGCGAGG + Intronic
1151691946 17:75692035-75692057 AGGTGGGCAAAGAGGAGGCTGGG - Intronic
1151833509 17:76569318-76569340 TGGGGGGCACAGCGGGGGTTAGG + Intronic
1152244247 17:79177022-79177044 CAGGGGGCATAGTGGGGACTAGG - Intronic
1152391770 17:80007799-80007821 AGGTGTGCACAGTGGGGGGTGGG + Intronic
1152432898 17:80259760-80259782 CCGTGGGCACCGTGGGGAGTGGG + Intergenic
1152587360 17:81195033-81195055 CTGTGGGCACAGTCAGGGCCGGG + Intronic
1152648410 17:81481045-81481067 CGGTGGCCTCAGCGGAGGCTTGG - Intergenic
1152773803 17:82187579-82187601 CGGGGGGCACTGGTGGGGCTCGG + Intronic
1152892744 17:82891753-82891775 TGGGGGACACAGAGGGGGCTGGG + Intronic
1152900420 17:82937922-82937944 CCGTGAGCACAGTGCGGGCCTGG - Intronic
1153465218 18:5380888-5380910 AGGTGGGCACATTGGGATCTAGG - Intergenic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1153885897 18:9465622-9465644 TGGTGGTTTCAGTGGGGGCTAGG - Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154437413 18:14357568-14357590 GGGCGGGGACAGTGGGTGCTGGG - Intergenic
1155169986 18:23260116-23260138 GGAGGGGTACAGTGGGGGCTGGG - Exonic
1158341226 18:56468778-56468800 GGGTTGGCACAGTGGATGCTAGG - Intergenic
1159431225 18:68356310-68356332 AGGTGGGCTGAGTGGGGGGTGGG + Intergenic
1160542850 18:79634590-79634612 TTGGGGGCACAGTGGGGGCGAGG - Intergenic
1160567700 18:79797726-79797748 CGGTGTGCAGAGTGGGGCCTGGG + Intergenic
1160710323 19:548455-548477 CAACGGGCACAGTGGGGGCCGGG + Intronic
1160864900 19:1252210-1252232 CGGTGGGGGCGGAGGGGGCTGGG - Intronic
1160865541 19:1254379-1254401 TGGTGGGCACCGGGGGGACTCGG - Exonic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162796266 19:13089179-13089201 AGGTGGGCAGGGTGGGGGATGGG + Intronic
1163015281 19:14450870-14450892 TGGTGGGAAGTGTGGGGGCTGGG - Intronic
1163638913 19:18450666-18450688 CGAGGCGCACAGTGGGGGCTGGG + Exonic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1163828265 19:19535693-19535715 AGGGGGGCACATTGGGGCCTGGG + Exonic
1164671786 19:30076564-30076586 GGGTGGGGACAGTGAGGGGTGGG - Intergenic
1164918595 19:32071828-32071850 AGGTGGTGACAGTGGGGGCGGGG - Intergenic
1165856396 19:38881233-38881255 CGGAGGCCACAGTGGGAGTTGGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166195515 19:41203305-41203327 CTTTGGGCTCAGTGAGGGCTGGG + Intronic
1166295850 19:41888880-41888902 GGGTGGGCACAGGGAGGGGTGGG + Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167793748 19:51695809-51695831 CGGAGGCCCGAGTGGGGGCTGGG + Intergenic
1168494967 19:56840383-56840405 GAGTGGGCACAGTGGCGGCCAGG - Intronic
925278273 2:2665719-2665741 GGCTGGGCACAGTGAGGCCTTGG - Intergenic
925732115 2:6926593-6926615 GTGTGGGTACAGTGTGGGCTGGG + Intronic
926152917 2:10434688-10434710 TGGTGGGCACAGGGGAGGATTGG + Intergenic
926361654 2:12093836-12093858 TGGTTGGCAAGGTGGGGGCTTGG - Intergenic
927174545 2:20396342-20396364 CAGTGGGCACGGTGGGGATTTGG - Intergenic
927211571 2:20642178-20642200 CTGTGGGCACAGTCCGGGCCTGG - Intronic
927455188 2:23242752-23242774 CAGTGTGCTCAGTGTGGGCTTGG - Intergenic
927490668 2:23518996-23519018 CTGTGGGCCTAGTGAGGGCTGGG + Intronic
927857504 2:26536690-26536712 CGCTTGGCTCTGTGGGGGCTGGG - Intronic
928180524 2:29065261-29065283 GGGTGGGCGCTGTGGGAGCTGGG + Intronic
929872206 2:45768558-45768580 AGGAGGGGACAGTGAGGGCTGGG + Intronic
930432995 2:51304495-51304517 TGCTTGGCACAGTGAGGGCTGGG - Intergenic
931944046 2:67285333-67285355 CTGTGGGCACAGTGGTTCCTAGG + Intergenic
932152641 2:69387142-69387164 CGGTGGGCAATCTGCGGGCTCGG + Exonic
933466675 2:82659889-82659911 CCATGGGCACTGTGGGGGCGGGG + Intergenic
933658038 2:84905452-84905474 CGCTGGGCACACTGCGAGCTGGG + Intronic
935242529 2:101190867-101190889 CAGCTGGCTCAGTGGGGGCTGGG - Intronic
936064360 2:109319376-109319398 CTGTGGGCTCAGTGGGGTCCCGG + Intronic
936449993 2:112626768-112626790 CAGTGGGCAGTGAGGGGGCTAGG - Intergenic
936520536 2:113209720-113209742 CGGTGGGGACAGTGGGTGAAAGG - Intergenic
937034327 2:118768511-118768533 CTGTGGGCCCAGTGCTGGCTAGG - Intergenic
937852725 2:126649935-126649957 CGGTGGGCCCAGTGGGTCCCCGG - Intergenic
937992460 2:127672324-127672346 CCGTGGGAAGAGAGGGGGCTCGG - Intronic
938934503 2:136116828-136116850 CGGTGGGCACGCGGGGGGCCGGG + Intronic
945922149 2:215765983-215766005 CTGAGGGCCCAGTGGGAGCTAGG + Intergenic
948231357 2:236351683-236351705 CGGTGGGCACAGTGAGGACAAGG + Intronic
948548883 2:238754114-238754136 CGGTGGGCAGGGTGGGCGGTGGG + Intergenic
948777218 2:240296055-240296077 TGCTGGCCACTGTGGGGGCTGGG - Intergenic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
1169913108 20:10662986-10663008 CCGTGGGTGCAGTGAGGGCTTGG - Intronic
1170696654 20:18665206-18665228 AGGTGGGTTCAGTTGGGGCTGGG + Intronic
1171768624 20:29303597-29303619 GGGTCTGCACAGTGGGGCCTGGG - Intergenic
1171811323 20:29745861-29745883 CGGTCTGCACAGTGGGGCCAAGG - Intergenic
1171908346 20:30919878-30919900 GGGTCTGCACAGTGGGGCCTAGG + Intergenic
1172054187 20:32142697-32142719 CGGTGGGCACAGGGGAGTCTAGG + Intronic
1172457987 20:35092707-35092729 CGGCAGCCACAGTGGCGGCTTGG - Exonic
1172597245 20:36157825-36157847 CCGAGGCCACAGTGGGGACTGGG + Intronic
1172948501 20:38706576-38706598 CAGAGGGGACAGTGGGGGCAGGG + Intergenic
1174062984 20:47845597-47845619 CGGTCTGCACAGTGGGAGGTTGG + Intergenic
1174170885 20:48617639-48617661 CGGTGGTGACACTGAGGGCTAGG + Intergenic
1174463530 20:50699722-50699744 CTGTGCCCAGAGTGGGGGCTTGG - Intergenic
1174500621 20:50981366-50981388 GGGTGGGCACAGTGCGGGGCTGG + Intergenic
1174504627 20:51009341-51009363 TGGTGGGCACAGTGGAGGCCAGG + Intronic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175340898 20:58228488-58228510 CGGCGGGCCCAGGGTGGGCTCGG - Exonic
1175873514 20:62219291-62219313 CGGTGGGGAAGGTGGGGGTTGGG - Intronic
1176247136 20:64102630-64102652 CGGAGGGCAAACTGGGGGCAGGG + Intergenic
1176423894 21:6535917-6535939 GGGTGGGCAGAGTGGGGGGCAGG + Intergenic
1176553692 21:8243329-8243351 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1176572614 21:8426353-8426375 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1176580523 21:8470914-8470936 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1179296352 21:40066156-40066178 AGGTGGGCACAGTATGAGCTGGG - Intronic
1179509246 21:41861542-41861564 CGGTGCGCACAGTTGGGGATTGG - Exonic
1179699387 21:43144232-43144254 GGGTGGGCAGAGTGGGGGGCAGG + Intergenic
1180081106 21:45488030-45488052 TGGAGGGGACAGTGGGGGCAGGG - Intronic
1180089802 21:45528075-45528097 CAGTGGGGACAGTGGAGGCTCGG + Intronic
1180201432 21:46227190-46227212 AGGTGGGCAGAGTGGTGGGTGGG - Intronic
1180341784 22:11626039-11626061 GGGTCTGCACAGTGGGGCCTAGG + Intergenic
1180606137 22:17060290-17060312 CAGTGGGCACCGTGGGGGTCAGG - Intergenic
1180701407 22:17783326-17783348 CGGTGAGCTCAGCTGGGGCTGGG - Intergenic
1180986071 22:19904550-19904572 TGGTGCCCACAGTGGGGCCTGGG - Intronic
1181084601 22:20433745-20433767 GGGTGGAGACAGTGGGGGCAGGG - Intronic
1181138573 22:20786916-20786938 CCGTGGTCACAGTGGTGGCTTGG - Exonic
1181668947 22:24416855-24416877 GGGTGGGCACGGGGAGGGCTTGG + Exonic
1182053467 22:27331025-27331047 CAGTGGCCAAAGAGGGGGCTGGG + Intergenic
1183098341 22:35568061-35568083 CTGAGGGCTCAGTGGGGGCGGGG - Intergenic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1183358694 22:37372413-37372435 GGGTGGGCACAGGGCGGGCAGGG + Exonic
1183411079 22:37655420-37655442 GGGGTGGCACTGTGGGGGCTCGG - Exonic
1183598850 22:38828449-38828471 CGGTGGGCACAGCAGAGACTGGG + Exonic
1183691599 22:39392765-39392787 GTGTGGGGACAGTGGGGGCCAGG - Intergenic
1183693478 22:39404858-39404880 CGGTGGGAGAAGTGGGGGCCAGG + Intronic
1184111759 22:42399636-42399658 CGCTGGTCACAGTGGAGGCTGGG + Intronic
1184512024 22:44939529-44939551 CTGTGAGCACAGTGGGGACCAGG + Intronic
1203258696 22_KI270733v1_random:160361-160383 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
950193915 3:10995749-10995771 AGGTGGGCACATTTTGGGCTAGG - Intronic
950406463 3:12808173-12808195 AGGTGGGCACAGTGAGGCCCTGG - Intronic
950668901 3:14513553-14513575 CACTGGGCACAGAGGGGGATGGG + Intronic
950669873 3:14519601-14519623 CAGAGGGCACAGTTGGGGCCAGG - Intronic
952062928 3:29532432-29532454 CAGTGGGCACAGTGTTGGCAAGG - Intronic
952211245 3:31231269-31231291 CGGTGGGGTCAGTGGGGGGTGGG + Intergenic
953241302 3:41151710-41151732 AGGTAGGCAGAGTGGGAGCTTGG - Intergenic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953404454 3:42653724-42653746 AGAGGGGCACAGTGGGGCCTGGG + Exonic
954662203 3:52232153-52232175 CGGGAGGCGCAGTGGGAGCTGGG - Intronic
955422140 3:58749354-58749376 CTGTGGGTAAAGTGGGGGTTAGG - Intronic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
961038605 3:123661217-123661239 AGCTGGGCATCGTGGGGGCTGGG + Intronic
961039320 3:123666181-123666203 GGGTGGGCACTGGGGGTGCTGGG - Intronic
961317610 3:126051259-126051281 CCGTAAGCACACTGGGGGCTGGG + Intronic
961443526 3:126967032-126967054 CAGTGGGCAGAGGGTGGGCTGGG - Intergenic
961573251 3:127815700-127815722 TGGTGAGCAGAGTGTGGGCTGGG - Intronic
961651457 3:128418597-128418619 TGCTGGGCAGAGTGGGGGCAGGG - Intergenic
961651848 3:128420838-128420860 GAGGGGGCACAGTGGGGCCTGGG - Intergenic
961681647 3:128603784-128603806 CGGTGGGCAGAGTCTGGGCAGGG - Intergenic
961749895 3:129088677-129088699 CGGGGGGCACAGTGGCGGCGGGG + Exonic
967684888 3:192408248-192408270 CGGAGGGCGCAGTAGAGGCTGGG - Exonic
967867961 3:194205737-194205759 CGGTGGGCACAGCAGTGGATTGG + Intergenic
968234343 3:197022936-197022958 CGGTGAGCGGAGTGGGGGCAGGG - Exonic
968442080 4:629224-629246 CGGGGTGCACAGCGGGGGATGGG - Intronic
968468607 4:765788-765810 CGGTGTGCACAGTGGTCACTGGG + Intronic
968520393 4:1032400-1032422 CTGGGGGCACAGTGGCTGCTGGG + Intergenic
968583507 4:1405616-1405638 GGGCGGGCACAGTGGGGGCGGGG + Intronic
968648369 4:1750780-1750802 CTGTGGGCACAGGGGGGTCGGGG - Intergenic
969408446 4:7011330-7011352 GGGTGGTGACAGTGGGGGGTAGG + Intronic
974459024 4:62164028-62164050 CAGTGGGCCCAGTGGGTTCTGGG + Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
982324425 4:154114787-154114809 CGGTGGGGCCTGTGGGGGATGGG + Intergenic
983578947 4:169288368-169288390 GGGTGGGCAGTGTGGGGGCGGGG + Intergenic
983999136 4:174218654-174218676 CGGTGGCCACAGGGGTAGCTGGG + Intergenic
984069705 4:175095113-175095135 CGTTGGGTACAGTGGCAGCTAGG - Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
984677110 4:182562566-182562588 CCCTGGGCATAGTGGGGGTTGGG + Intronic
985699362 5:1361238-1361260 CAGTGGGCTCATTGGGGGGTGGG + Intergenic
986485115 5:8228404-8228426 CTTTGGGCACAGTGGGAGTTAGG - Intergenic
986984455 5:13484557-13484579 CGGAGGGCACAGTGTTTGCTGGG - Intergenic
995854071 5:116574588-116574610 CGGGGGGCGGGGTGGGGGCTGGG + Exonic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
997415406 5:133724105-133724127 CAGGGGGCACAGTGGAGGTTGGG + Intergenic
997526907 5:134559575-134559597 AGTAGGGCACAGTGGGGGATGGG - Intronic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1001605684 5:172958568-172958590 CCGTGGGCACCGTGGCGGCAGGG - Intergenic
1002567402 5:180119640-180119662 AGGTGGGCCCGGTGGGGGCACGG + Intronic
1002570740 5:180137980-180138002 CTGTGGGCTCGGTGGGGGGTGGG + Exonic
1002581505 5:180211886-180211908 GGGTGGGCAGGGTAGGGGCTGGG - Intergenic
1006180336 6:32150356-32150378 CGGTGGGCACGGTGAGTGCCGGG - Exonic
1007520757 6:42450783-42450805 CTGCGGGCTCTGTGGGGGCTGGG - Intronic
1007747408 6:44051494-44051516 GGGAGGGGACGGTGGGGGCTGGG + Intergenic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1009775021 6:68195063-68195085 GGCTAGGCACAGTGGGGGATGGG - Intergenic
1009933384 6:70203561-70203583 CGGTGGGCATGGTGGGGGTGGGG - Intronic
1011019052 6:82789925-82789947 CAGTGGTCACTGTGGGGCCTTGG + Intergenic
1011789769 6:90885638-90885660 CGGGGGGCACAGTGGGCTTTTGG - Intergenic
1012499688 6:99875078-99875100 CGGTGGGCAGAGTGGGAGGGAGG - Intergenic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1017073864 6:150600200-150600222 CGGTGGGGACAGAGGGCGCCGGG + Intronic
1017073877 6:150600232-150600254 CGGTGGGGACGGAGGGCGCTGGG + Intronic
1017760248 6:157562886-157562908 ACCTGGGCACAGTGGGTGCTTGG - Intronic
1017983441 6:159422364-159422386 CGGGGCTGACAGTGGGGGCTGGG + Intergenic
1018425016 6:163671932-163671954 GGGTGGGCAGTGTGGGGCCTGGG + Intergenic
1019572494 7:1719542-1719564 GGGAGGGCACTGCGGGGGCTGGG - Intronic
1019642404 7:2111167-2111189 GGGCGGGCACAGTGGACGCTCGG - Intronic
1019648284 7:2142527-2142549 CCGTGGGCTCAGTGGCAGCTAGG - Intronic
1020101985 7:5399095-5399117 AGGGGGGCACTGTGGGGGCTTGG - Intronic
1023764726 7:43499974-43499996 CATTGGGCACAGAGGGGGCCCGG - Intronic
1023862335 7:44224265-44224287 GGGGAGGCAGAGTGGGGGCTGGG - Intronic
1024035641 7:45505711-45505733 TGGGTGGCACAGCGGGGGCTTGG + Intergenic
1026155366 7:67821258-67821280 AGGTGGGAACTGTGGGGGATGGG + Intergenic
1026968533 7:74454545-74454567 GGGTGGGAGCAGAGGGGGCTGGG + Intronic
1029406030 7:100374448-100374470 CGGTGGGCAAAGCGGGTGCCAGG - Intronic
1032016894 7:128385804-128385826 AGGAGGCAACAGTGGGGGCTAGG + Intergenic
1032087532 7:128891681-128891703 GGGTGGGCACAGGGGGCCCTGGG + Exonic
1035259897 7:157654309-157654331 CGGCGGGCACAGTGTGGAGTTGG - Intronic
1036045915 8:5140369-5140391 GGGCTGGCACAGTGGGGACTGGG - Intergenic
1036640333 8:10579603-10579625 CGCTGGGCCCAGTGGGGGGCCGG - Intergenic
1036768039 8:11561227-11561249 CGGGGGACACAGTGTGGGCTCGG + Intronic
1036913840 8:12785532-12785554 TGTAGGGCACTGTGGGGGCTTGG + Intergenic
1038765409 8:30423414-30423436 CGGAGGGGACAGTGAGGGCTGGG + Intronic
1039292443 8:36111080-36111102 CAGTGGGCCCAGTGGGCGCCTGG - Intergenic
1040545104 8:48392973-48392995 CGATGGGCACACTGGGTCCTGGG - Intergenic
1041191928 8:55363667-55363689 CGTTGGGCACAGGGGTGACTGGG - Intronic
1042398473 8:68318008-68318030 CCGTGTGCAGAGTGGGAGCTGGG - Intronic
1042815389 8:72873020-72873042 CGGTGCACACAGTGGAGTCTAGG - Intronic
1043729987 8:83665234-83665256 CAAAGGGCACAGTGGTGGCTTGG - Intergenic
1049367843 8:142249298-142249320 CTGTGGGCAGAGGGTGGGCTGGG + Intronic
1049412235 8:142478481-142478503 TGGGGTGCACAGTGGGGTCTGGG + Intronic
1049615680 8:143574924-143574946 CGGTGGGCAGGGTGAGGGCGGGG + Intronic
1053311666 9:37024638-37024660 CTGGCAGCACAGTGGGGGCTGGG - Intronic
1053576046 9:39358005-39358027 CGGAGGGCAGAGTGGGTGCTCGG - Intronic
1053840561 9:42185942-42185964 CGGAGGGCAGAGTGGGTGCTCGG - Intronic
1054097617 9:60916696-60916718 CGGAGGGCAGAGTGGGTGCTCGG - Intergenic
1054119019 9:61192326-61192348 CGGAGGGCAGAGTGGGTGCTCGG - Intronic
1054588733 9:66990236-66990258 CGGAGGGCAGAGTGGGTGCTCGG + Intergenic
1055794370 9:79959075-79959097 AGGTGGGCACAGTGGTTACTTGG - Intergenic
1056584649 9:87920182-87920204 CGGAGGGCAGAGTGGGCGCTTGG - Intergenic
1056612224 9:88132757-88132779 CGGAGGGCAGAGTGGGCGCTTGG + Intergenic
1057160428 9:92884813-92884835 CGGAGGTCAGAGTGGGCGCTCGG - Intergenic
1058467662 9:105244998-105245020 CGGTGCGCTCAGGGGAGGCTGGG - Intronic
1060806870 9:126583229-126583251 CGGTGGGCAGAGGGGAGGCGGGG + Intergenic
1060826808 9:126692344-126692366 CGGGAGGCCCAGTGGTGGCTGGG + Intronic
1061035857 9:128114067-128114089 GGGAGGGCACAGTGGGGGCAGGG + Intergenic
1061061054 9:128250755-128250777 CTGGGGGCACGGCGGGGGCTCGG - Exonic
1061203141 9:129148559-129148581 GAATGGGCCCAGTGGGGGCTGGG + Exonic
1061825978 9:133258445-133258467 CTGTGGGCAGAGAGGAGGCTGGG + Intronic
1062004278 9:134231510-134231532 CAGAGGGGGCAGTGGGGGCTTGG + Intergenic
1062310545 9:135933546-135933568 CTGTGGGCTGAGTGGGGGCGTGG - Intronic
1062439320 9:136562648-136562670 AGGTGGGCTCAGTGGGCACTTGG + Intergenic
1062536707 9:137024244-137024266 GGGTGGGCCCAGTGAGGGATAGG + Intronic
1062595125 9:137295929-137295951 CGGCGGGGACGGTGGGGGCGGGG - Intergenic
1062622258 9:137428418-137428440 CTGGGGGCACAGTGGAGGGTGGG - Intronic
1203474886 Un_GL000220v1:142372-142394 CGGTCTGCACAGTGGGGCCTAGG + Intergenic
1185487947 X:497511-497533 CGGCGGACACAGGGTGGGCTCGG + Intergenic
1186434129 X:9528699-9528721 GGGTGGGGTCAGTGGGGGCGGGG + Intronic
1190303450 X:49069221-49069243 CCATGGGCACAGAGGGGGTTGGG - Intronic
1190773428 X:53533819-53533841 TGCTAGACACAGTGGGGGCTGGG - Intronic
1191134111 X:57045169-57045191 CAGTGGGTACAGTGGGTCCTCGG - Intergenic
1193511816 X:82411379-82411401 CAGTGGGCACAGACGTGGCTTGG - Intergenic
1193556509 X:82960617-82960639 CAGTGGCCACTGTGGGGGATGGG - Intergenic
1195203124 X:102568296-102568318 AGGTGGGCAGAGCAGGGGCTTGG + Intergenic
1196734649 X:118973718-118973740 CGGTGGGTACTCTGGGGGCGTGG - Intergenic
1198287198 X:135202897-135202919 GGGAGGGGACAGTGGGGGATCGG - Intergenic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1200064341 X:153497413-153497435 CGGTCGGCAGGGTGGGGGCCAGG - Intronic
1200124303 X:153806020-153806042 CGACGGGCACAGCGGGGCCTTGG + Intronic
1200126155 X:153816008-153816030 CGGTCGGCAGGGTGGGGGCCAGG + Intronic
1201891122 Y:18945137-18945159 AGGTGGGCAAGGTGGGGGCGGGG + Intergenic