ID: 1167095896

View in Genome Browser
Species Human (GRCh38)
Location 19:47375036-47375058
Sequence ACGACCAAGTGGAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167095896_1167095903 -5 Left 1167095896 19:47375036-47375058 CCCTCCTCTCTCCACTTGGTCGT 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1167095903 19:47375054-47375076 GTCGTTCTGGGATGAGGCCCAGG 0: 1
1: 0
2: 5
3: 36
4: 234
1167095896_1167095904 1 Left 1167095896 19:47375036-47375058 CCCTCCTCTCTCCACTTGGTCGT 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1167095904 19:47375060-47375082 CTGGGATGAGGCCCAGGACTTGG 0: 1
1: 0
2: 6
3: 48
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167095896 Original CRISPR ACGACCAAGTGGAGAGAGGA GGG (reversed) Intronic
901053123 1:6435676-6435698 ACTACCTAGAGGGGAGAGGATGG - Intronic
901531848 1:9858684-9858706 ACGTTCCAGTGGAGAAAGGAAGG - Intronic
901569855 1:10151509-10151531 ACAACTTGGTGGAGAGAGGATGG - Exonic
902481119 1:16712373-16712395 ACTACCTAGAGGGGAGAGGATGG + Intergenic
903455287 1:23483433-23483455 AAGACAAAGAGGAGAGGGGAGGG + Intronic
904488964 1:30846612-30846634 ACGGCTGAGTGGAGCGAGGAGGG - Intergenic
905635482 1:39548503-39548525 AGGAGCAAGTGGAGAGGGCAGGG + Intergenic
906268755 1:44457141-44457163 AGGAGGAAGAGGAGAGAGGAAGG - Intronic
908276682 1:62480567-62480589 ACGGCCAAGTGGACAGGGAAGGG + Intronic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
915445732 1:155973844-155973866 GAGACAAAGTGGAGAGAAGAGGG - Intronic
915783003 1:158574866-158574888 AAGACCTAGTGGGGAGAGAAGGG - Intergenic
916161699 1:161922781-161922803 AGGACCCAGTAGGGAGAGGAAGG + Intronic
920141969 1:203822574-203822596 AAGACCAAGTGGGGTTAGGAAGG - Intronic
920255614 1:204652225-204652247 AGGGCGAAGGGGAGAGAGGAGGG - Intronic
921370279 1:214415769-214415791 ACACCCAAGAGGAGAGAAGAAGG - Intronic
921384122 1:214552057-214552079 ACGTGGAAGTGGAGAGAGCAAGG + Intronic
921606339 1:217159996-217160018 ACCTCCATGTGGGGAGAGGAGGG + Intergenic
922289709 1:224200080-224200102 ACCACCAAGTAGAGAAATGAAGG - Intergenic
923446137 1:234073001-234073023 ATAACCCAGTGGAGAGATGATGG + Intronic
923736985 1:236619505-236619527 AAGGGCAAGCGGAGAGAGGAAGG + Intergenic
924362384 1:243255109-243255131 ACGACGAGGTGGGGGGAGGACGG - Intronic
1062964198 10:1594830-1594852 ACAACGAAGTGGTGGGAGGAAGG - Intronic
1062977032 10:1691451-1691473 AGGTCCAAGTGCAGAGAAGAAGG - Intronic
1063567549 10:7184100-7184122 ACGTCCAAGTGCATAGAGCAGGG + Intronic
1064105639 10:12498715-12498737 ACCTCCAAGGTGAGAGAGGATGG + Intronic
1064857744 10:19789896-19789918 GCGACAAAATGGAGAAAGGATGG + Intronic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1066653673 10:37681085-37681107 ACGACCTAGCGGGGAGAGGCTGG + Intergenic
1069080094 10:64079454-64079476 TTGACTAAGTGGAGAGAAGAGGG + Intergenic
1070585951 10:77766271-77766293 AAGTCCAGGTGGAAAGAGGAAGG + Intergenic
1071796352 10:89010579-89010601 AACACCAAGTGCAAAGAGGAAGG + Exonic
1072739237 10:97899830-97899852 AGGACCAGGTGGGGAAAGGAGGG - Intronic
1073163302 10:101420404-101420426 CAGACCCAGTGGAGTGAGGAGGG - Intronic
1076137135 10:128052908-128052930 ACTACCGAGCGGAGAGAGAAAGG + Intronic
1076979425 11:196778-196800 AAGCCCATGAGGAGAGAGGAAGG + Exonic
1077868532 11:6242298-6242320 ACAGCCAAGTGGAAAGAGAAAGG + Intronic
1077924072 11:6663138-6663160 AGGTCCCAGAGGAGAGAGGAGGG + Intergenic
1078369598 11:10734074-10734096 AGGACCAAGAGGACAAAGGAGGG + Intergenic
1079490580 11:20984703-20984725 ACCACCAAGAGGACACAGGATGG - Intronic
1080633486 11:34103309-34103331 AGGATCAAGTGGAAAGAGAAAGG + Intergenic
1081055837 11:38409857-38409879 ACTACCAAATGGAGATAGCAAGG - Intergenic
1081685552 11:45040642-45040664 AAGACCACGTGGAGATAGAAGGG - Intergenic
1083297432 11:61722664-61722686 AGGACCAAATGGTGACAGGACGG + Intronic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1087675125 11:101152708-101152730 ACCAGAAACTGGAGAGAGGAGGG - Intergenic
1087916895 11:103821434-103821456 AACACCAAGTGGAGAGAATAAGG + Intergenic
1088653616 11:111978432-111978454 ATGGCCAAGTGGAGAGATAAAGG - Intronic
1089085628 11:115814822-115814844 GAGACCATGTGGAGGGAGGAGGG - Intergenic
1089164739 11:116466984-116467006 ACGTCCAAGGGGAGGGAGAAGGG - Intergenic
1090378884 11:126311144-126311166 ACGACATAATGGAGAGAGCATGG + Intronic
1091513472 12:1153772-1153794 CCGACCATGTGAAGAAAGGAGGG - Intronic
1091583916 12:1805283-1805305 GCGACCAAGTGATGAGAGGTTGG + Intronic
1091643430 12:2254866-2254888 CCATCCAAGTGAAGAGAGGACGG - Intronic
1092618420 12:10236548-10236570 AAGAAAAAGTGGATAGAGGAGGG + Intergenic
1093163746 12:15781368-15781390 ACAACCAAGTGGAAAGGGCATGG + Intronic
1094213676 12:27918868-27918890 ATGACCAAAAGGAGAGATGATGG + Intergenic
1094417838 12:30236077-30236099 ATGAACAAGTGGAGAGAGACAGG + Intergenic
1096575582 12:52550723-52550745 AGGACCAAGGAGGGAGAGGAGGG - Intronic
1096785620 12:54015667-54015689 GGGACCAAGTGGAGAGATGCCGG + Intronic
1096907665 12:54949948-54949970 AGGCCCAAGTGAAGAGAGGAAGG - Intronic
1098479746 12:70944328-70944350 ATATCCAAGGGGAGAGAGGATGG - Intergenic
1101011373 12:100453845-100453867 CCTACGAAGAGGAGAGAGGAAGG + Intergenic
1102016090 12:109648851-109648873 GGGACCAAGTGGAGAGGAGAGGG + Intergenic
1104393370 12:128409794-128409816 CCCACCCAGTGGAGAGAGGGTGG + Intronic
1105068663 12:133220618-133220640 AGGCCCTAGTGTAGAGAGGATGG + Intronic
1107193018 13:37612741-37612763 ACTACAAAGCGGAGAGAGGAAGG + Intergenic
1110592060 13:77274874-77274896 ACAGACAAGTGAAGAGAGGAAGG - Intronic
1111900005 13:94188903-94188925 ACGATTGAGGGGAGAGAGGATGG - Intronic
1112379738 13:98877548-98877570 AGGACCAGGTGGAGAGAGAGTGG - Intronic
1113433117 13:110267254-110267276 ATGACCCAGTGGAGGGAGGAGGG + Intronic
1113650132 13:112028580-112028602 AGGACAACTTGGAGAGAGGACGG + Intergenic
1113668563 13:112159272-112159294 ACCACCCAGGGGAGAGAGGATGG - Intergenic
1114781959 14:25547807-25547829 ACCACCACGTGGAGTCAGGATGG - Intergenic
1115670045 14:35600603-35600625 ACAACCAAGTGGAGTGGGAATGG - Intronic
1116133236 14:40887729-40887751 AAGACTCAGTGGAGGGAGGAAGG + Intergenic
1122460103 14:101887634-101887656 ACGTCCAAGAGGGGAGAGGCAGG + Intronic
1123197645 14:106631679-106631701 ATGACCAAGTGGAGACAGCTGGG + Intergenic
1123680045 15:22756538-22756560 AGGACCAAGAGCAGAGAGTATGG - Intergenic
1124332258 15:28830991-28831013 AGGACCAAGAGCAGAGAGTATGG - Intergenic
1124721649 15:32115777-32115799 AAGACAAGATGGAGAGAGGAAGG + Intronic
1126072180 15:44874849-44874871 ACGACAAAGAGGACTGAGGAAGG + Intergenic
1127381761 15:58436742-58436764 ACTTCCAAGTGGAGGGAAGAAGG + Intronic
1127651347 15:61011175-61011197 AATACAAAATGGAGAGAGGAAGG - Intronic
1128300830 15:66565456-66565478 AAGGCCAAGTGGGGAGAGGAAGG + Exonic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129139686 15:73586149-73586171 AAGTCCAAGTGCAGAGAGGCAGG - Intronic
1130323858 15:82863042-82863064 AAGAAGCAGTGGAGAGAGGAGGG - Intronic
1130680754 15:85994301-85994323 ACCAACAGCTGGAGAGAGGAAGG - Intergenic
1130903239 15:88222990-88223012 ACCAAGAAGTGGGGAGAGGAGGG + Intronic
1131579928 15:93633165-93633187 ACTAACAAGTGTACAGAGGAGGG - Intergenic
1135247312 16:20868049-20868071 GGGACTAAGTGGAGAGGGGAAGG - Intronic
1135675155 16:24408783-24408805 AGGAGAAAGAGGAGAGAGGAGGG + Intergenic
1138965040 16:62074016-62074038 ATGACAAAGTGGAGAATGGAAGG - Intergenic
1139846467 16:69924888-69924910 ACGCCGAGGTGGAGGGAGGAGGG + Intronic
1141910076 16:87052999-87053021 CCGACCCAGTGGTGAGTGGATGG - Intergenic
1142467002 17:141803-141825 AAGCCCATGAGGAGAGAGGAAGG + Intergenic
1144365647 17:14541890-14541912 ACGGAGAAATGGAGAGAGGAAGG - Intergenic
1145416086 17:22715102-22715124 ACAAGCATGGGGAGAGAGGAAGG - Intergenic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1151403594 17:73872304-73872326 ACTACCCAGTGCAAAGAGGAGGG - Intergenic
1152161538 17:78671395-78671417 AGAGCCAAGAGGAGAGAGGAGGG + Intergenic
1157346733 18:46843413-46843435 ACTACCAAGAGGAGATGGGAGGG - Intronic
1160187159 18:76684753-76684775 ACAGCCAAGTGCAGAGAGAAGGG - Intergenic
1163214976 19:15869897-15869919 GCGGCCAAGTGCAGAGAGGGAGG + Intergenic
1163633440 19:18428158-18428180 TGGACCAAGTGGAGGGTGGAAGG - Intronic
1164800682 19:31073690-31073712 AGGACGGAGTGGAGAAAGGAGGG - Intergenic
1165934790 19:39382777-39382799 AGGTCCAAGTGGGGACAGGAAGG + Intronic
1166236569 19:41461297-41461319 ATATCCAAGTGGGGAGAGGATGG - Intergenic
1166279707 19:41783543-41783565 AAGACCAAGTGGGGAGAACAGGG - Intergenic
1166737193 19:45093186-45093208 ACGACCACTAGGAGAGCGGACGG + Exonic
1166804187 19:45475123-45475145 AGAACCAAGGGGAGAGGGGACGG - Exonic
1167095896 19:47375036-47375058 ACGACCAAGTGGAGAGAGGAGGG - Intronic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
1168519397 19:57036512-57036534 ATGACCACGTGAGGAGAGGAGGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929594630 2:43168553-43168575 CGGACCAAGTGCAGAGGGGATGG + Intergenic
930926644 2:56826281-56826303 AAGAACAAGTGAAGAGAGGTAGG - Intergenic
933994482 2:87657839-87657861 GTGACCAGGTGGAGAGAGGAAGG + Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935253090 2:101282822-101282844 ACAGCCCAGTGGAGGGAGGAGGG - Intronic
936299376 2:111293074-111293096 GTGACCAGGTGGAGAGAGGAAGG - Intergenic
936491452 2:112976228-112976250 AGGACCAAGTGGAATGAGGGCGG + Intronic
936667035 2:114608883-114608905 ACTAGAAAGGGGAGAGAGGAAGG + Intronic
936923283 2:117710894-117710916 AGGACCCAGTTGAGAAAGGAGGG + Intergenic
937645104 2:124257821-124257843 CAGACCAAGTAGAGAGATGAAGG - Intronic
939045069 2:137240202-137240224 ACTAGAAAGAGGAGAGAGGATGG - Intronic
939878664 2:147605581-147605603 AGGCCCAAGAGGAGATAGGAGGG + Intergenic
941553869 2:166951076-166951098 ACGACGGAGTGGAGAATGGAAGG + Intronic
943442669 2:187945158-187945180 TTGAGCAAGTGGGGAGAGGATGG - Intergenic
943995861 2:194764736-194764758 AGGACCAACTGGAGAAAGCAAGG - Intergenic
944295664 2:198059610-198059632 ACGAGAAAGCTGAGAGAGGATGG + Intronic
945392235 2:209278199-209278221 TTGACCAAGAGGAGAGAAGAGGG - Intergenic
948075048 2:235159360-235159382 AGGCCCAAGTGGAGAGTGGAGGG + Intergenic
948223452 2:236291127-236291149 AACACCAAGGGAAGAGAGGAAGG + Intergenic
1168948513 20:1780848-1780870 AGGACCAAGTTGGGATAGGAAGG + Intergenic
1171968801 20:31550305-31550327 ACGACCAAGTGGCCAGGGGCCGG - Intronic
1175250234 20:57604765-57604787 ACGACCTAGGGAAGAGAAGATGG + Exonic
1177466734 21:21493714-21493736 AGGAACTAGTGGAGAAAGGAGGG - Intronic
1177618709 21:23558887-23558909 AGGAGCGAGTGGAGAGAGGGAGG - Intergenic
1179528410 21:42000035-42000057 ATGACCCAGATGAGAGAGGATGG + Intronic
1181030013 22:20145163-20145185 ACGAACACGGGGACAGAGGACGG - Intronic
1181513250 22:23398150-23398172 ACGAACACGGGGACAGAGGACGG + Intergenic
1182047198 22:27284676-27284698 GGGACCAATTGGAGAGAAGAAGG - Intergenic
1183481102 22:38066005-38066027 AGGATAAAGGGGAGAGAGGATGG - Intronic
1184913299 22:47550277-47550299 TCTCCCATGTGGAGAGAGGAAGG - Intergenic
1185191371 22:49438617-49438639 ACAGCCCAGTGGAGGGAGGAGGG + Intronic
949546758 3:5079728-5079750 AGGAACATGTGGGGAGAGGAGGG - Intergenic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
950547751 3:13648611-13648633 GGGACCAAGTGGGGAGAGGATGG + Intergenic
950726247 3:14918836-14918858 ACGGGCAGGTGGAGGGAGGATGG + Intronic
952751340 3:36827302-36827324 TGGAGCAAGTGGACAGAGGAGGG - Exonic
953559996 3:43980615-43980637 CCCACTAACTGGAGAGAGGAGGG - Intergenic
953802499 3:46035955-46035977 CCCAACCAGTGGAGAGAGGAAGG + Intergenic
954079972 3:48207836-48207858 ACTTCCAAGAGGAGAGAGTAAGG - Intergenic
958537438 3:95423247-95423269 AAGACCAAGAAGAGAGAGAAAGG + Intergenic
960117693 3:113912824-113912846 ACCACCAATAGGAGAGAGAAAGG + Intronic
961088426 3:124090022-124090044 AGGACCTAGTGGAGAGGGCATGG + Intronic
968189034 3:196654086-196654108 ATGAACAACTGGAGAGTGGACGG - Intronic
968546229 4:1200392-1200414 GGGAGCAAGTGGAGGGAGGAAGG + Intronic
968792018 4:2671781-2671803 ACGACAGAGTAGAGAGGGGATGG - Intronic
968964511 4:3763223-3763245 ACGACCAGGAGGGGCGAGGAAGG - Intergenic
973047103 4:45548254-45548276 ACTACCAAGAGGAGGGCGGAAGG + Intergenic
977860913 4:101958743-101958765 AAGAGCATGTGTAGAGAGGATGG - Intronic
979449550 4:120854184-120854206 ACATTCAACTGGAGAGAGGAGGG + Intronic
981263605 4:142753538-142753560 AAGAGCAAATGGAGAGAGGGGGG - Intronic
982448264 4:155520944-155520966 AAGAACAAGTGGAGAGAGTAGGG - Intergenic
985522932 5:387374-387396 AGGACAAAGTGGTGAGAGAAAGG + Intronic
986391004 5:7288286-7288308 AGGACCAAGAGCAGAGAGTATGG - Intergenic
986701406 5:10412919-10412941 AGGAACAAGGGGAGAGATGAGGG + Intronic
987938444 5:24500901-24500923 GAGAAGAAGTGGAGAGAGGAGGG + Intronic
987989583 5:25193192-25193214 ACAAGCAGGTGGAGAGAGGTGGG + Intergenic
989414363 5:41156202-41156224 ACAACCAAGTGGAGACATGGAGG - Intronic
989667568 5:43874192-43874214 GCAACCAAGTGGAGAGACCAGGG + Intergenic
992395692 5:76367719-76367741 AGTACCAAGTGGAGGGAGAAAGG - Intergenic
992468481 5:77030560-77030582 ACGAGCAAGGGGACCGAGGATGG - Exonic
994275603 5:97833044-97833066 ATGAGCAAGTGAAGAGAGAAGGG - Intergenic
994327185 5:98462120-98462142 AAGATCAAGTGGAGACATGATGG + Intergenic
1002081089 5:176737876-176737898 AGGACCAAGTGAAGTGGGGAGGG + Intergenic
1002309995 5:178308638-178308660 ACAAGCACGTGGAGATAGGAAGG - Intronic
1003867424 6:10376006-10376028 ACGAGCGAGTGAAGAGGGGAAGG - Intergenic
1007795412 6:44342935-44342957 ACGCCCAGGTGGAGGGAGTAAGG + Exonic
1008333448 6:50270943-50270965 ACGGGCAAGAGGAGAGAGGAAGG + Intergenic
1008387009 6:50903240-50903262 AGGAACAATTGGAGAGAGGTGGG + Intergenic
1013272812 6:108559448-108559470 AGGAAGAAGTGGGGAGAGGAGGG - Intergenic
1013414506 6:109912809-109912831 AAGAGAAAGTGGACAGAGGAGGG - Intergenic
1013836298 6:114340594-114340616 ATGACCAAACAGAGAGAGGAAGG + Intronic
1014152896 6:118079205-118079227 ACTACCAAGAGCTGAGAGGAAGG - Intronic
1015463236 6:133517639-133517661 AAGTCCAAATGGAGAGCGGAGGG + Intronic
1015864254 6:137711713-137711735 ATGACCACGTGGAGTGAGCAGGG + Intergenic
1019478257 7:1254511-1254533 ATGACAGAGTGGGGAGAGGAAGG - Intergenic
1020011466 7:4807915-4807937 AGGAGGAAGTGGAGAGAGGGAGG - Intronic
1020426499 7:8072137-8072159 ACTTTCAAGTGGAGAGAGGAAGG - Intronic
1020788267 7:12594721-12594743 ACGACAAAGACGAGAGAGGGCGG + Intronic
1026947375 7:74325168-74325190 CCCACCCAGTGGAGAGGGGAGGG + Intronic
1028146795 7:87328426-87328448 AGGACCCAGAGGAGACAGGAGGG - Intergenic
1028387399 7:90272694-90272716 AAGACAATGTAGAGAGAGGAGGG - Intronic
1029171606 7:98633567-98633589 ACAAAAAAGTGGAGAGGGGATGG + Intergenic
1030186109 7:106763844-106763866 ACGACAAGGAGGAGAGGGGAGGG - Intergenic
1031586100 7:123534058-123534080 AAGACCAAGGGTGGAGAGGAAGG + Intronic
1032447871 7:132000136-132000158 TCAACCTAGTGGAGTGAGGAGGG + Intergenic
1034191719 7:149218243-149218265 CAGACCAAGTGGAGAGATGCTGG + Intronic
1034211354 7:149365782-149365804 AAAACCAAGTGGAAAGTGGAAGG - Intergenic
1034889543 7:154827744-154827766 GAGCCCAAGTGGAGTGAGGAGGG + Intronic
1034966648 7:155395551-155395573 AGCACCAAGGGGACAGAGGAAGG - Exonic
1037957237 8:23069178-23069200 GCGTCCAAGTGGGGAGGGGAGGG + Exonic
1038637667 8:29300584-29300606 ATATCCAAGGGGAGAGAGGAAGG - Intergenic
1039816647 8:41100486-41100508 AGTCCCCAGTGGAGAGAGGATGG + Intergenic
1040033758 8:42849136-42849158 ATGATCAAGTGTAGTGAGGAAGG - Intergenic
1041176380 8:55201561-55201583 AGGTCAAAGTGGAGACAGGAGGG - Intronic
1041919749 8:63168575-63168597 ACGTCAGAGTGGAGAGCGGAAGG + Intronic
1044149677 8:88759915-88759937 AAGACCAAGTGATTAGAGGATGG - Intergenic
1046095958 8:109560777-109560799 ACGGCTATGTGGAGAAAGGATGG + Intronic
1047772431 8:128040071-128040093 ACATCCAAGTGGAGACAGTAAGG + Intergenic
1048416422 8:134232239-134232261 ACTAAAAAGTGGAGAGAGGAAGG + Intergenic
1049271170 8:141697049-141697071 ATGACCAAGAGGAGAGAGCTGGG + Intergenic
1050041402 9:1497777-1497799 AGGACCTACTGGAGGGAGGAGGG - Intergenic
1055231365 9:74070522-74070544 AGGACCCACTTGAGAGAGGAGGG - Intergenic
1055475754 9:76662261-76662283 ACCACCAAATGGAGAAAGAACGG + Intronic
1055649844 9:78396397-78396419 GAAACCAAGTGTAGAGAGGAGGG - Intergenic
1057245327 9:93450609-93450631 AAGAACAAATGGAGAGATGAAGG + Intronic
1057808030 9:98234685-98234707 ACGACCACTGGGAGACAGGATGG - Intronic
1060051579 9:120382280-120382302 ACGACAGAGTGGAAAGAAGAAGG + Intergenic
1060251188 9:121987934-121987956 ACATCCAAGTGGAGAGATTAAGG - Intronic
1061899686 9:133666522-133666544 AGGAAAAAGGGGAGAGAGGAAGG - Intronic
1192289076 X:69772631-69772653 ACTACCAAATGGAGGGAGGGAGG - Intronic
1194088317 X:89555855-89555877 ACCACCAAATGGAGAAAGCATGG - Intergenic
1195141355 X:101963760-101963782 AGGGCCAAGAGTAGAGAGGAAGG + Intergenic
1195169118 X:102248771-102248793 ACTCACAACTGGAGAGAGGAGGG + Intergenic
1195189739 X:102438317-102438339 ACTCACAACTGGAGAGAGGAGGG - Intronic
1198441924 X:136671831-136671853 ACTAACAAATGGAAAGAGGAAGG - Intronic
1199814651 X:151386859-151386881 GAGACCATGTGGAGAGAGGGAGG - Intergenic
1200178408 X:154134790-154134812 CAGACCAAATGGAGAGAGTATGG + Intergenic
1200440990 Y:3211897-3211919 ACCACCAAATGGAGAAAGCATGG - Intergenic