ID: 1167096276

View in Genome Browser
Species Human (GRCh38)
Location 19:47376530-47376552
Sequence CTGGAGGCCAGCAACTGCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167096267_1167096276 24 Left 1167096267 19:47376483-47376505 CCACCTGCGTCTTCGCTGGCAGC 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG 0: 1
1: 0
2: 0
3: 14
4: 150
1167096265_1167096276 26 Left 1167096265 19:47376481-47376503 CCCCACCTGCGTCTTCGCTGGCA 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG 0: 1
1: 0
2: 0
3: 14
4: 150
1167096268_1167096276 21 Left 1167096268 19:47376486-47376508 CCTGCGTCTTCGCTGGCAGCCCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG 0: 1
1: 0
2: 0
3: 14
4: 150
1167096270_1167096276 2 Left 1167096270 19:47376505-47376527 CCCCGAGGTGCTGCACGCACAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG 0: 1
1: 0
2: 0
3: 14
4: 150
1167096273_1167096276 0 Left 1167096273 19:47376507-47376529 CCGAGGTGCTGCACGCACAGGAG 0: 1
1: 0
2: 0
3: 15
4: 213
Right 1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG 0: 1
1: 0
2: 0
3: 14
4: 150
1167096272_1167096276 1 Left 1167096272 19:47376506-47376528 CCCGAGGTGCTGCACGCACAGGA 0: 1
1: 0
2: 2
3: 8
4: 135
Right 1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG 0: 1
1: 0
2: 0
3: 14
4: 150
1167096266_1167096276 25 Left 1167096266 19:47376482-47376504 CCCACCTGCGTCTTCGCTGGCAG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG 0: 1
1: 0
2: 0
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167096276 Original CRISPR CTGGAGGCCAGCAACTGCGA CGG Exonic
900713118 1:4127587-4127609 CGGGAGGCCAGCAACTCAGGGGG - Intergenic
902513287 1:16977408-16977430 CAGGAGGCCAGCAACAGGAAGGG - Intronic
902592371 1:17484273-17484295 CAGGAGGCCAGCAGGTGCAAAGG + Intergenic
902790617 1:18765413-18765435 ATGGAGGCCACTAACTGAGATGG + Intergenic
904286291 1:29454997-29455019 CGGGAGGCCAGACACTGCCAGGG - Intergenic
907782401 1:57579347-57579369 CTGAAGGCCAGCAAGTGATAGGG - Intronic
910327837 1:86030314-86030336 TTGGAGGCCACCAACTGGGGTGG + Intronic
911125410 1:94336883-94336905 CTGAAGGCCAGCCACTGCAGGGG + Intergenic
912717929 1:111995022-111995044 CTGGAGCCCAGCAAGTTGGATGG - Intergenic
913328259 1:117646518-117646540 CTGGAAGCCAGCAGCTCTGAGGG + Intergenic
913495714 1:119426451-119426473 CTGTAGGCAAGCAACAGCTATGG - Intergenic
917084441 1:171291873-171291895 CTGCAGGCAAGCAACAGCCATGG - Intergenic
917968292 1:180192177-180192199 CTGGAGACCAGCAGGTGCAAAGG + Intronic
921888895 1:220334007-220334029 CTGGAAGCCAGCAAATGGAATGG - Intergenic
922496411 1:226061916-226061938 CCGGAGGCCAACACCGGCGAGGG + Intronic
1063655580 10:7985305-7985327 ATGGAGGCCAGCAGCTGAGGAGG - Intronic
1065563326 10:26985048-26985070 CTGCAGGCAAGCAACAGCGATGG - Intergenic
1065921275 10:30395080-30395102 GAGGAGGACAGCAACTGAGAAGG - Intergenic
1076410346 10:130244746-130244768 CTGGAGGCTAGCAAGTGCTCAGG - Intergenic
1076846642 10:133072435-133072457 CGGGAGGCCTGCAGCTGCCACGG + Intronic
1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG + Intronic
1082768531 11:57187513-57187535 CTGGTGGCCAGCAGCTGTGGCGG - Exonic
1083431294 11:62614770-62614792 CTGCAGGCCAGCACCTGAGGAGG + Exonic
1083986778 11:66220800-66220822 CTGGAGGCCAGCTACAGAGAGGG - Intronic
1084657297 11:70527057-70527079 CTGGAGGCCAGGATCAGGGAAGG - Intronic
1084793552 11:71489945-71489967 CTGGAGGCCTGCACCAGCGTTGG + Intronic
1090461535 11:126895603-126895625 CTGAAGGCCAGAACCTGAGAGGG + Intronic
1092051479 12:5473839-5473861 CTGCATGTCAGCAACTGCAAAGG - Intronic
1092055605 12:5505916-5505938 CTGGTGCCCAGCAAGTGCCATGG + Intronic
1096155384 12:49338813-49338835 CTGGAGGTGAGCAGCTGCAAAGG + Intergenic
1096256340 12:50064302-50064324 CTGGATTCCTGCAACTGCAATGG - Intronic
1099991733 12:89729554-89729576 CTGTAGTCCAGCTACTCCGAAGG + Intergenic
1102748082 12:115267711-115267733 CTGAATGCCAGCAACTCCCATGG + Intergenic
1103253835 12:119523418-119523440 CTGGAGCCCAGCAAATGTTAAGG - Intronic
1104715473 12:131013325-131013347 ATGGAGCCCAGCAACAGCAATGG - Intronic
1107449084 13:40492459-40492481 CTGGGGACCAGCATCTGGGAGGG - Intergenic
1107554000 13:41501719-41501741 CTGTAGCCCAGCTACTGGGAAGG + Intergenic
1108451626 13:50572356-50572378 CTGGAGATCAGCAAGTGCAAAGG - Intronic
1117094565 14:52284007-52284029 CTGCAGGCAAGCAACAGCGATGG + Intergenic
1118262339 14:64259369-64259391 CTGGAGGGCAGCGACTGCACTGG - Intronic
1118712070 14:68528020-68528042 CTGGAGCCCACAAACTGAGATGG - Intronic
1121806914 14:96835672-96835694 CTTGAAGCCAGAAACTGGGAAGG + Intronic
1123402686 15:20003427-20003449 CTGGAGGTCAGCAGCTGCCTAGG + Intergenic
1123512025 15:21010081-21010103 CTGGAGGTCAGCAGCTGCCTAGG + Intergenic
1125744942 15:41991598-41991620 CTGCATGCCAGGAACTGCGCTGG - Intronic
1127819048 15:62639353-62639375 CTGGAAGCCAGCAACTTGGCTGG + Intronic
1128352149 15:66898197-66898219 CAGGAGGCCTGCAGCTGGGATGG + Intergenic
1128509681 15:68305747-68305769 CTGGGGGCCAGCAAATGGCAGGG + Intronic
1130422821 15:83765020-83765042 CTAGAGGCCATCAACTGTCAGGG + Intronic
1132338093 15:101061502-101061524 CTGGAGGCCGGGATTTGCGATGG + Intronic
1132564726 16:616681-616703 CTGCAGCCCAGGAACTGCCAAGG - Intronic
1132630666 16:915735-915757 CTGGAGGCCAGCAGCCGTGTGGG + Intronic
1134670960 16:16054690-16054712 CTGGAGGCCAGGGACTGAAATGG - Intronic
1134827848 16:17298765-17298787 CTGGAGAACAGCAAGTGCAAAGG - Intronic
1135295606 16:21277288-21277310 CTGGATACCAGCAACAGTGAAGG - Intronic
1139478843 16:67217118-67217140 CTGGAGGCCAGGACCTGATAAGG - Intronic
1139665066 16:68449224-68449246 AAGGAGGCCAGGACCTGCGATGG - Intergenic
1141432397 16:83977211-83977233 CTGGGGGCCAGGAACTGTCATGG + Intronic
1142240990 16:88944987-88945009 CTGAAGGTCAGCAACAGTGATGG - Intronic
1142872144 17:2827924-2827946 CTGGAGGCCAGCTACTGCTCCGG + Intronic
1143282648 17:5766318-5766340 CTGCAGCTCAGCAACTGTGAAGG + Intergenic
1144634199 17:16893737-16893759 CTTGAGGCCAGCAGCAGGGAAGG + Intergenic
1144756951 17:17685649-17685671 CTGCTGGCCAGCACCTGGGAGGG - Intronic
1145007054 17:19344009-19344031 CTGGAGCCCAGCCACTGGGAAGG - Intronic
1145168296 17:20633581-20633603 CTTGAGGCCAGCATCAGGGAAGG + Intergenic
1146164388 17:30576547-30576569 CTTGAGGCCAGCATCAGGGAAGG + Intergenic
1147755300 17:42763293-42763315 CTGGGGGCCTGCAACTGGGGAGG + Intergenic
1147874306 17:43610162-43610184 CTGGAGTCCAGGAAGTGCTATGG - Intergenic
1148716955 17:49722767-49722789 CTGGAGGACATGAACTGGGAAGG - Intronic
1149055379 17:52356937-52356959 CTGTAGGCCAGCTACTTGGAAGG + Intergenic
1149297539 17:55273995-55274017 CTGGAGGCCAGCTCCTGCCAAGG + Intronic
1149326326 17:55534034-55534056 CTGGAAGCCAGCAGCAGAGATGG + Intergenic
1153954784 18:10087007-10087029 CTGGAGGCCAGGAAGAGCCAGGG + Intergenic
1158558426 18:58493796-58493818 CTGGCTGGCAGCCACTGCGAGGG + Intronic
1159208375 18:65283088-65283110 CTGGATGACAGCAACTACGTTGG + Intergenic
1159604181 18:70457944-70457966 CTGGAGTCCTGCAACTCAGAAGG + Intergenic
1161270472 19:3386895-3386917 CTGGAGGCCAGCCACAGCCTGGG - Intronic
1162449458 19:10745903-10745925 CAGGAGGCCAGCATGTGCAAAGG + Intronic
1163019650 19:14475385-14475407 CTGGAGGCCAGCAAGGGCGGCGG - Intergenic
1163571631 19:18085444-18085466 CTGGAGACCAGCAGCAGGGAGGG - Intronic
1163645531 19:18486974-18486996 GTGGAGGCCAGCATCTTGGAAGG - Intronic
1165072852 19:33265513-33265535 CTGGAGGCCAGCAGCACAGAGGG + Intergenic
1165453029 19:35896217-35896239 CTGGAAGCCAGAGACTTCGAGGG - Exonic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1166919924 19:46222167-46222189 CTGGAGACCAGCCAGTGCCAAGG - Intergenic
1167096276 19:47376530-47376552 CTGGAGGCCAGCAACTGCGACGG + Exonic
1167163384 19:47781538-47781560 GTGGAGGACAACAACTGAGATGG + Intronic
1168120974 19:54252379-54252401 CTGGATGTCAGCAACTGGGCTGG + Exonic
925833827 2:7923296-7923318 CTGGAGTCCAGATACTGCTATGG - Intergenic
926313365 2:11691474-11691496 CTGGAGGTCAGCACCTGAGGAGG - Intronic
927520085 2:23693277-23693299 CTGACGGCCAGCAACTGCCTGGG + Exonic
931196298 2:60054969-60054991 CTGGAGACCAGCACCTGCTGAGG + Intergenic
931713183 2:65007105-65007127 CTGGAGTCCAGCACCTGGGAAGG - Intronic
932895712 2:75637636-75637658 CTGGAGAACAGCAACTTCTAAGG - Intergenic
933282721 2:80349774-80349796 CTGAATGCCAGCAACTCCGGAGG - Intronic
935152119 2:100447257-100447279 ATGGATGACAGCAGCTGCGATGG + Intergenic
938843320 2:135183417-135183439 CTGGAAGCCAGCAACACCCAAGG + Intronic
942308798 2:174634881-174634903 CTGGAGTTCAGCAGCTGAGAAGG + Intronic
942715336 2:178885109-178885131 CTGGAGGTCAGAAACTGACAGGG + Intronic
945724884 2:213463827-213463849 CTGTAGTTCAGCAAGTGCGAGGG + Intronic
946353334 2:219169572-219169594 CTGGAGGCCAGGAGCTGAGAAGG + Exonic
948850556 2:240703453-240703475 CTGGAGGCCAGCCCCTGCCTAGG - Intergenic
948933925 2:241150250-241150272 CTGGAGGCGAGAAGCTGGGAAGG - Exonic
1169935675 20:10880799-10880821 CTGGAAGGCAGCAACTGCATAGG - Intergenic
1172482107 20:35277409-35277431 CTGGAAGCCAGCGACAGAGAGGG + Intergenic
1172865738 20:38095611-38095633 CGAGAGGCCAGCATCTGGGAAGG - Intronic
1173422545 20:42915357-42915379 CTGGGGGCCAGCTACTGTCAGGG - Intronic
1174273674 20:49387847-49387869 CTGGAGGCTACCAATTGAGATGG - Intronic
1176098655 20:63355256-63355278 CCGGAGGCCACCATCTGCCACGG + Intronic
1176122311 20:63459561-63459583 CAGGAGACCGGCAACTGCCAGGG + Intronic
1176243632 20:64086442-64086464 TTGGGGTCCAGCAACTGTGAGGG + Intronic
1180085908 21:45507789-45507811 CGTGAGGCCAGCAGCTGAGACGG - Intronic
1181326220 22:22049143-22049165 CAGGAGGGCAGGAACTGGGAGGG - Intergenic
1181880389 22:25974861-25974883 CTGGAGGCCAGACACTGCCCTGG - Intronic
950392266 3:12705961-12705983 CTGAAGGCCACCAACCTCGATGG - Intergenic
955485646 3:59432143-59432165 CTGGACTCCAGCATGTGCGACGG - Intergenic
959705338 3:109334082-109334104 GTGGAGTCCAGTAACTGCGTTGG - Intronic
961821569 3:129578067-129578089 CTGGGGGCCAACAGCTGCCAAGG - Intronic
965030971 3:163367477-163367499 ATGGAGGCCAGCAAATGAGAGGG - Intergenic
965319941 3:167241013-167241035 CTGGAGGCAAGCAGATGTGAGGG + Intronic
969619743 4:8273074-8273096 CTGGAGGCCAGGAAGGGTGAGGG + Intronic
972396962 4:38665129-38665151 CTGGAGCCCAGGAGCTGCCAGGG + Intronic
975712749 4:77176720-77176742 TGGGAGGCAAGCAACTGCAACGG + Intronic
977017928 4:91717349-91717371 CTGGAGGCCAGAAACAGGGTTGG + Intergenic
981487228 4:145300345-145300367 CTGGAGGGCAGAAACTGAGATGG + Intergenic
982399742 4:154953565-154953587 CTTGAAGCCAGCAACTGACAGGG + Intergenic
983646412 4:169996149-169996171 CTGGAGACCAGAAATTGCCAGGG + Intronic
985905748 5:2834671-2834693 CTGGAGTGTAGTAACTGCGATGG + Intergenic
992158194 5:73975259-73975281 CTGGCAGCCAGCAACTGAGTAGG - Intergenic
997202669 5:132021225-132021247 CTGGAGGGCAGAAACTTCAACGG + Intergenic
997530048 5:134576524-134576546 CTGGAGTCCAGGTCCTGCGAGGG + Intronic
1000987247 5:167874647-167874669 CAGCAGGCAAGCAACTGCAAAGG + Intronic
1001542858 5:172551341-172551363 CTGGAGCCCAGGAAATGCCAGGG + Intergenic
1002455450 5:179343771-179343793 GTGGCGCTCAGCAACTGCGATGG - Exonic
1002921594 6:1577026-1577048 TTGGAGCCAAGCAACTGAGATGG + Intergenic
1003107676 6:3228207-3228229 CTGGAGGCCAGCGACTGCCCAGG + Intronic
1008834736 6:55811942-55811964 CTGGAGGCCAGGGACTGTGGTGG - Intronic
1009519721 6:64665928-64665950 CTGGAGGCCAGGAACTTGGATGG + Intronic
1014471091 6:121815875-121815897 CTGGAGGCTAGAATCTGCTAGGG + Intergenic
1018880876 6:167878813-167878835 CAGGGGACCAGCAACTGCTAAGG - Intronic
1018971128 6:168530202-168530224 CTTGAGGCCAGCCACAGCGGAGG + Intronic
1019581087 7:1763549-1763571 CTTCAGGCCAGCCACTGTGAGGG - Intergenic
1029732615 7:102447894-102447916 CTGGAGGCCAGTGGCTGCGGGGG - Exonic
1030138089 7:106277672-106277694 CTGGATGACAGCAACGGCGGTGG + Intronic
1033081527 7:138303340-138303362 CTGGAGGACAGAAACTGGGAGGG + Intergenic
1038184271 8:25258778-25258800 CTGCATGCCAGGCACTGCGAAGG + Intronic
1043258571 8:78167790-78167812 GTGGTGGCCAGCAACTGAGGAGG - Intergenic
1047408079 8:124601758-124601780 CTGGAGGCCAGCACTAGCCACGG + Intronic
1048460698 8:134619384-134619406 CTGGTGGTCCGCAACTGCAATGG - Intronic
1048473250 8:134721803-134721825 CTGCAGGCCAGCAGCAGGGACGG + Intergenic
1049773913 8:144396073-144396095 GTGGAGGCCAGGCCCTGCGAGGG + Intronic
1054795554 9:69298156-69298178 CTGGCTACCAGCAAATGCGATGG + Intergenic
1055820312 9:80254103-80254125 CAGGAGGCCAGCAACAGGCAAGG - Intergenic
1056801995 9:89698817-89698839 GTGGAGGCCAGCAGCTGCCCAGG - Intergenic
1059417205 9:114169335-114169357 CTGGAGGACAGGAATTGCGCCGG - Exonic
1059781354 9:117531336-117531358 CTGGAGGTCAGCAAAGGCCATGG - Intergenic
1060343970 9:122800784-122800806 CTGGAGCACGGCAGCTGCGATGG - Exonic
1060967779 9:127721264-127721286 CTGGAGGCCAGAGCCTGAGAAGG + Intronic
1061070185 9:128305085-128305107 CTGTAGGCCAGCCACTGCTCTGG - Intergenic
1061574832 9:131499674-131499696 CTGGAGGCCACCAAGTGGGGTGG - Exonic
1061894934 9:133642258-133642280 CTGGAGGCCATCAACGGCTCGGG + Exonic
1193294825 X:79821888-79821910 CTGCAGGCAAGCAACAGCTATGG - Intergenic
1196052572 X:111321304-111321326 CTGAAGGGCACCAACTGAGAGGG - Intronic
1198770260 X:140123391-140123413 CTGGATACCAGCACCTGCTATGG + Intergenic
1199708871 X:150453800-150453822 CAGGAGGGCAGCAAGTGGGAAGG - Intronic