ID: 1167097960

View in Genome Browser
Species Human (GRCh38)
Location 19:47385389-47385411
Sequence GCTGGGCTGCAGCGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167097960_1167097965 -7 Left 1167097960 19:47385389-47385411 CCCTCCACCCGCTGCAGCCCAGC No data
Right 1167097965 19:47385405-47385427 GCCCAGCTCCTCCGTCTCCCAGG No data
1167097960_1167097973 23 Left 1167097960 19:47385389-47385411 CCCTCCACCCGCTGCAGCCCAGC No data
Right 1167097973 19:47385435-47385457 AATATTCTTTTTTTTTGAGATGG 0: 6
1: 102
2: 2737
3: 16285
4: 131738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167097960 Original CRISPR GCTGGGCTGCAGCGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr