ID: 1167101694

View in Genome Browser
Species Human (GRCh38)
Location 19:47407635-47407657
Sequence TAACCTCTAATTGCTGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167101694_1167101699 11 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101699 19:47407669-47407691 CTGATTAGAGAGACTGTGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 171
1167101694_1167101706 28 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101706 19:47407686-47407708 GTTGGGGGAGGGGGCTCCTGTGG 0: 1
1: 0
2: 13
3: 85
4: 752
1167101694_1167101698 10 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101698 19:47407668-47407690 TCTGATTAGAGAGACTGTGTTGG 0: 1
1: 0
2: 0
3: 18
4: 136
1167101694_1167101701 13 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101701 19:47407671-47407693 GATTAGAGAGACTGTGTTGGGGG 0: 1
1: 0
2: 2
3: 24
4: 1183
1167101694_1167101703 17 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101703 19:47407675-47407697 AGAGAGACTGTGTTGGGGGAGGG 0: 1
1: 0
2: 5
3: 79
4: 619
1167101694_1167101702 16 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101702 19:47407674-47407696 TAGAGAGACTGTGTTGGGGGAGG 0: 1
1: 0
2: 5
3: 51
4: 398
1167101694_1167101704 18 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101704 19:47407676-47407698 GAGAGACTGTGTTGGGGGAGGGG 0: 1
1: 0
2: 13
3: 74
4: 750
1167101694_1167101700 12 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101700 19:47407670-47407692 TGATTAGAGAGACTGTGTTGGGG 0: 1
1: 0
2: 0
3: 22
4: 189
1167101694_1167101705 19 Left 1167101694 19:47407635-47407657 CCTGTTCCAGCAATTAGAGGTTA 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1167101705 19:47407677-47407699 AGAGACTGTGTTGGGGGAGGGGG 0: 1
1: 0
2: 13
3: 103
4: 1010

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167101694 Original CRISPR TAACCTCTAATTGCTGGAAC AGG (reversed) Intronic
902157022 1:14496018-14496040 TAAACTCAAAATGCTGGATCAGG - Intergenic
902435439 1:16395471-16395493 TAAACTGTTATTGCTGGCACTGG - Exonic
902518329 1:17001843-17001865 GAACCTCCAATTCCTGGACCTGG + Intronic
903474529 1:23610426-23610448 TAACTTCTAAAAGCTGTAACAGG - Intronic
904962731 1:34347576-34347598 TCCCCTCTAATTGCTGCAGCTGG - Intergenic
909128139 1:71701353-71701375 TAGCCTCTAAAAGCTGGAAATGG - Intronic
909917489 1:81337815-81337837 GAACCTCAAAGGGCTGGAACTGG - Intronic
910639924 1:89448279-89448301 TATCCTCCAATACCTGGAACTGG + Intergenic
917373234 1:174318073-174318095 TAACTTCTTATTGCTGAAAGAGG - Intronic
919594415 1:199544440-199544462 TAACCTCTAATTTCTACAGCAGG + Intergenic
923956333 1:239025907-239025929 AAACCTCAAATGGCTAGAACCGG + Intergenic
1064017680 10:11785283-11785305 GCTCCTCTAATCGCTGGAACTGG + Intergenic
1066164091 10:32766870-32766892 TAACCTCATATTGCTGAAAGGGG - Intronic
1066315902 10:34246252-34246274 TATCTTCTTATTGCTGGAAGTGG - Intronic
1068516313 10:58030197-58030219 TAACCTCTAATGGGAGAAACAGG + Intergenic
1071730953 10:88247917-88247939 CAGCCTCTAGTTGCTGGAAAAGG + Intergenic
1079005154 11:16786345-16786367 TGACCTGCAGTTGCTGGAACGGG - Intronic
1079547845 11:21656680-21656702 GAAGCTCTAATGGCTGGCACAGG - Intergenic
1079588701 11:22156293-22156315 TACCCTCTACTTACTGGGACTGG + Intergenic
1081514267 11:43809866-43809888 TTAACTCTAAGTGCTGGAACTGG + Intronic
1082200982 11:49366952-49366974 TCATCTCTAATTGTTGGCACCGG - Intergenic
1082681263 11:56173608-56173630 TAGCCTCCACTTGCTGGAAGAGG + Intergenic
1084600477 11:70142558-70142580 TAACCTCTAGTTCATGGAAATGG + Intronic
1086513687 11:87588357-87588379 TAACTTCTAGTTGCTAGAAAGGG - Intergenic
1087876815 11:103369040-103369062 TAACTTCTTATTGCTGAAAGAGG + Intronic
1088009702 11:104985553-104985575 TAACTTCTTATTGCTGAAAGAGG + Intergenic
1088375889 11:109141145-109141167 TAAGTTCAAATTGCTGGGACTGG + Intergenic
1088912452 11:114202100-114202122 TGACCTCTGAGTGCTGGCACAGG - Intronic
1089637220 11:119822862-119822884 TGACCTCAAAATGCTGGAACGGG - Intergenic
1090545854 11:127766985-127767007 TATCCTCTAAGTGCTGGCAAAGG - Intergenic
1091816179 12:3439999-3440021 TAATCTTTAATTACGGGAACTGG + Intronic
1092574106 12:9760204-9760226 CATCCTCTAGTTGCTGGAAATGG - Intronic
1096369826 12:51059677-51059699 TAATTACTAATAGCTGGAACTGG + Exonic
1097147166 12:56949693-56949715 TAACCTCATATTGCTGAAAGAGG - Intergenic
1098368444 12:69732247-69732269 TAACCACTAATAACTGGACCTGG - Intergenic
1099017254 12:77358850-77358872 AAGCCTGTAATTGCTTGAACCGG - Intergenic
1099864635 12:88264311-88264333 TAGCCTTTAAATGCTGGAAAAGG + Intergenic
1106001076 13:25723987-25724009 TAACCTCTAGGTGCTGGGAGTGG + Intronic
1108221829 13:48242117-48242139 TAACCAGAAATTGCTAGAACAGG - Intronic
1109692835 13:65915600-65915622 TATCCTATGGTTGCTGGAACAGG + Intergenic
1113572228 13:111366217-111366239 TAACCTGTAGCTGCTGAAACTGG - Intergenic
1116587091 14:46720293-46720315 CAGCCTCTAATAGCTGGAAAAGG - Intergenic
1118065190 14:62183168-62183190 TAATCTGGAAGTGCTGGAACTGG + Intergenic
1120770958 14:88380036-88380058 CAAGCTCCAATTGCTGGAATGGG + Intergenic
1120827571 14:88969442-88969464 TGGCCTCTAATAGCTGGAAAAGG + Intergenic
1124412178 15:29445601-29445623 TAACCTCTTATTTGTGGAAAGGG - Intronic
1139262107 16:65604208-65604230 TGACCTCTTACTGCAGGAACTGG + Intergenic
1140503981 16:75458551-75458573 TGGCCTCTAAATGCTGGAAAAGG + Intronic
1152943993 17:83188960-83188982 TAACCTCTAGAAGCTGGAAGAGG + Intergenic
1153133245 18:1882085-1882107 TTACCTGTGATGGCTGGAACTGG + Intergenic
1156780868 18:40849037-40849059 AAAACTCTAAATCCTGGAACAGG - Intergenic
1167101694 19:47407635-47407657 TAACCTCTAATTGCTGGAACAGG - Intronic
1168469092 19:56626386-56626408 CAACCTCTAATTCCTGGACTCGG - Exonic
925497239 2:4465793-4465815 TGACCTCTAAATGCTTGAAAAGG + Intergenic
926601906 2:14854501-14854523 TAACTTCAAATTGCTGAAAAAGG + Intergenic
935391587 2:102558804-102558826 TAACCTCTAGAAGCTGGAAAAGG + Intergenic
935690114 2:105723401-105723423 TCCCTTCTATTTGCTGGAACAGG + Intergenic
937737359 2:125308406-125308428 TAACCTCTACCTGCTGTAAGAGG - Intergenic
941066876 2:160913412-160913434 CAGCCTCTGATTGGTGGAACTGG + Intergenic
941435983 2:165473366-165473388 TAACCTCTTATTGCTGGAAATGG + Intronic
941829110 2:169934854-169934876 TAGGCTCTTATTGCTGGAAAAGG + Intronic
944372576 2:199002539-199002561 TAACCTCTAGATGCTGGAAAAGG - Intergenic
1171024077 20:21612913-21612935 TAACCTCAAATTGCTATAAGTGG - Intergenic
1172697353 20:36831805-36831827 TAGCCAGTAAATGCTGGAACTGG - Intronic
1173951273 20:46995259-46995281 TAACGTTTCATTTCTGGAACTGG - Intronic
1174826585 20:53774189-53774211 GAACCTTTCATTCCTGGAACAGG - Intergenic
1175050583 20:56151903-56151925 TAAACTCCATTAGCTGGAACTGG - Intergenic
1181762949 22:25070347-25070369 TAACCTCTGGGTGCTGGAAATGG + Intronic
949135155 3:555382-555404 AAGCCTCTAAATGCTGGAAAAGG + Intergenic
950119835 3:10474494-10474516 TGACCTCTAATGGCTGGGGCTGG - Intronic
952706078 3:36379745-36379767 TAAACTATAATTGGTGAAACTGG - Intergenic
953194990 3:40723931-40723953 TAGCCTCTAATTGCTGAAAAGGG + Intergenic
965310566 3:167122513-167122535 TAACCTCCAATTCCAGCAACTGG + Intergenic
967691981 3:192485541-192485563 TATCAACTAATTGCTGGAATTGG - Intronic
969328545 4:6458843-6458865 TCACCTCTCATTGCTGGGGCTGG + Intronic
973817307 4:54630922-54630944 CAGCCTCTAATAGCTGGAAAAGG - Intergenic
974524643 4:63033212-63033234 TGACCTCTAAAAGCTGGAAAAGG + Intergenic
978169329 4:105650431-105650453 TAATCTCTAGTTGCTGGTACTGG - Intronic
978863975 4:113485061-113485083 TAACCACTAAGTGCTTTAACAGG - Intronic
979559250 4:122083555-122083577 TAGCCTCTAAAAGCTGGAAAAGG + Intergenic
980459237 4:133084565-133084587 CAAACTCTAAGAGCTGGAACTGG - Intergenic
984058750 4:174964989-174965011 TAACTAATAATTGCTGGAGCTGG - Intronic
988101941 5:26690885-26690907 CAGCCTCTAGTTGCTGGAAAAGG + Intergenic
990326433 5:54680536-54680558 TTCCCTCTAATTGCTTGATCTGG + Intergenic
991331601 5:65498736-65498758 TAACCTCAAATTCCTGGGTCAGG + Intergenic
998018047 5:138748502-138748524 TAACCTCTAAATGTTAGAGCAGG - Intronic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998652295 5:144134484-144134506 AAACTTCTATTTGCTGTAACTGG + Intergenic
999016883 5:148116474-148116496 CAACCTCTAATTTCAGTAACTGG + Intronic
1008352053 6:50503466-50503488 TTTCCTCTAAGTGCTGGAACAGG + Intergenic
1010814267 6:80338397-80338419 TAAACGCTAATTGCTGGTTCCGG - Intronic
1013195379 6:107840446-107840468 TAACCTATGATAGCTGAAACAGG + Intergenic
1017828656 6:158103374-158103396 TACACTCTACCTGCTGGAACAGG + Intergenic
1018711751 6:166502260-166502282 TAACCACTATTTTCTGGAAATGG + Intronic
1021086340 7:16424379-16424401 CAACCTCTAAAAGCTGGAAAAGG + Intergenic
1021538515 7:21731546-21731568 TAATCTCTATTTTCTGAAACTGG + Intronic
1022514913 7:30969390-30969412 GAACCTGTAAGTGCTGGACCTGG + Intronic
1022748323 7:33196286-33196308 TAACTTCTAATTGTCTGAACTGG + Intronic
1029308493 7:99639666-99639688 TGCCTTCTAATTGCTGAAACAGG - Intergenic
1029976340 7:104838046-104838068 TAAGCTCTGATTACTGGAGCTGG - Intronic
1032145643 7:129377526-129377548 TTACCTCTAACTGCAGGAAGTGG + Intronic
1036046050 8:5141888-5141910 TATCCTCTCTTTGATGGAACTGG - Intergenic
1037809456 8:22078534-22078556 TCACCTCCAATTGCTGGAAATGG - Intronic
1040868221 8:52071904-52071926 TAACATCCAATTTATGGAACTGG + Intergenic
1042444922 8:68872509-68872531 TGACCTCTAAAAGCTGGAAGTGG + Intergenic
1045853011 8:106725555-106725577 TAACATCTAATTTCTTGAAAAGG - Intronic
1046347184 8:112945817-112945839 TGAACTCTATTTTCTGGAACAGG + Intronic
1046978664 8:120312394-120312416 TAAACTCTAATCTATGGAACTGG - Intronic
1050186850 9:2983689-2983711 CAACCTCTAAAGGCTGGAAAAGG + Intergenic
1050710064 9:8451346-8451368 TCACCTCTGATTGGTGGAATGGG - Intronic
1051742154 9:20262583-20262605 TAACCTCTAATATCTACAACTGG + Intergenic
1058979171 9:110153099-110153121 TGACCTCTAGTGGCTAGAACTGG + Intronic
1059515249 9:114888728-114888750 TAACTTCAAATTGCTGAAAGAGG + Intergenic
1186197506 X:7124486-7124508 TGGCCTCTAATAGCTGGAAAAGG + Intronic
1187959553 X:24555434-24555456 TAACCTCTAGAAGCTGGAAAGGG + Intergenic
1188974572 X:36657591-36657613 TAACTTCTTATTGCTGAAAGAGG - Intergenic
1189668614 X:43383909-43383931 TATCCTGGAATTGCTGGAATTGG - Intergenic
1190295981 X:49028005-49028027 TGACCTCTGAGGGCTGGAACTGG - Intergenic
1190374486 X:49775579-49775601 TAACTTCATATTGCTGAAACAGG - Intergenic
1195975986 X:110527495-110527517 TTTCCTCTAATAACTGGAACAGG + Intergenic
1197697802 X:129569518-129569540 TAACCTCTCAATGCTGCAAATGG - Intronic
1199160045 X:144597882-144597904 TAACATCATATTGCTGGAAGAGG - Intergenic