ID: 1167103638

View in Genome Browser
Species Human (GRCh38)
Location 19:47418728-47418750
Sequence ATAGAGAGGCAGAAAGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3115
Summary {0: 1, 1: 0, 2: 18, 3: 304, 4: 2792}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167103619_1167103638 28 Left 1167103619 19:47418677-47418699 CCCAGGAACAGAGGAGAGAGACT 0: 1
1: 0
2: 5
3: 50
4: 404
Right 1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG 0: 1
1: 0
2: 18
3: 304
4: 2792
1167103620_1167103638 27 Left 1167103620 19:47418678-47418700 CCAGGAACAGAGGAGAGAGACTG 0: 1
1: 0
2: 4
3: 42
4: 420
Right 1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG 0: 1
1: 0
2: 18
3: 304
4: 2792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167103638 Original CRISPR ATAGAGAGGCAGAAAGAGGG GGG Intronic
Too many off-targets to display for this crispr