ID: 1167105280

View in Genome Browser
Species Human (GRCh38)
Location 19:47426814-47426836
Sequence ACTGATCTGCAGTGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167105280_1167105291 22 Left 1167105280 19:47426814-47426836 CCCACCTCCCACTGCAGATCAGT No data
Right 1167105291 19:47426859-47426881 CCACAAACCTGTTCTCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167105280 Original CRISPR ACTGATCTGCAGTGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr