ID: 1167105954

View in Genome Browser
Species Human (GRCh38)
Location 19:47429961-47429983
Sequence GAGAAGGGAGGCCGAGTCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 288}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167105951_1167105954 -8 Left 1167105951 19:47429946-47429968 CCAGGGGAGGGGGCGGAGAAGGG 0: 1
1: 0
2: 10
3: 113
4: 983
Right 1167105954 19:47429961-47429983 GAGAAGGGAGGCCGAGTCCCAGG 0: 1
1: 0
2: 3
3: 32
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167105954 Original CRISPR GAGAAGGGAGGCCGAGTCCC AGG Exonic
900223162 1:1520187-1520209 GCGAGTGGAGGCCGAGGCCCGGG + Exonic
900479516 1:2891297-2891319 CAGACGGGAGGCAGGGTCCCCGG + Intergenic
901448133 1:9320365-9320387 GTGAAAGGAGGCAAAGTCCCCGG - Intronic
901657402 1:10777309-10777331 GAGAGGGGCGTCCGAGTCCTGGG + Intronic
901696586 1:11012530-11012552 CAGGAGGCAGCCCGAGTCCCTGG + Exonic
902334402 1:15746806-15746828 GAGCAGGGAGGTCCAGTCCGGGG + Intronic
902466872 1:16624023-16624045 GGCCAGGGAGGCTGAGTCCCAGG - Intergenic
902507728 1:16948751-16948773 GGCCAGGGAGGCTGAGTCCCAGG + Intronic
903375491 1:22863216-22863238 GCGATGGCTGGCCGAGTCCCAGG + Intronic
903557117 1:24202214-24202236 GAGAAGAGAGGACCAGTCCCAGG - Intergenic
904618570 1:31762787-31762809 GAGAAGGGGTGGCGGGTCCCAGG + Intronic
905183144 1:36178706-36178728 GGCACGGGAGGCCGAGGCCCGGG + Exonic
906063555 1:42963554-42963576 GAGAGGGCAGGCAGAGTCCACGG - Intergenic
906595200 1:47069684-47069706 GAGAAGGGAGGCTTAGTTTCTGG + Intronic
906692657 1:47802761-47802783 GAGAAGGGAGGGGGTGTGCCCGG - Intronic
907473382 1:54689207-54689229 GAGAAGAGAGGCCCAGACACAGG + Intronic
910863844 1:91769380-91769402 GAGAATGTGGGCCGAGTCCAAGG - Intronic
913475114 1:119229681-119229703 GAGAAGGAGGGCCCATTCCCTGG - Intergenic
915461628 1:156073963-156073985 GAGAGGGGAGGAGGAGTCCATGG + Exonic
920232238 1:204478284-204478306 GAGATGCGAGGCAGGGTCCCTGG - Intronic
921890928 1:220353134-220353156 GAGAAGGAAGACAGGGTCCCTGG + Intergenic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
924533626 1:244915019-244915041 AAGAAAGGAGGCCAAGTCACTGG + Intergenic
924800294 1:247324892-247324914 GAGAAGAGTGGCAGAGTCCCTGG - Intronic
1062823332 10:550924-550946 CAGAGGGGAGACCGAGGCCCGGG - Intronic
1063426247 10:5952302-5952324 GAGTAGGAAGGCAGAGTCCAAGG - Intronic
1063487328 10:6432190-6432212 GTGAATGGAGGTCAAGTCCCTGG - Intronic
1063540402 10:6927949-6927971 GTGAAGGCAGGCGGAGGCCCAGG - Intergenic
1064412664 10:15120848-15120870 GAGAGGCCAGGCCGCGTCCCTGG - Intronic
1065456966 10:25916980-25917002 CAGGAGGGAGGCTGACTCCCAGG - Intergenic
1066459595 10:35601527-35601549 GAGAAGAGCAGCTGAGTCCCAGG - Intergenic
1067362407 10:45594681-45594703 AATAAGGGCGGCCGAGCCCCCGG - Intronic
1070732658 10:78842041-78842063 CAGAAGGGAGGCCGAGTGGAGGG + Intergenic
1070988294 10:80707642-80707664 GGTGAGGGAGGCTGAGTCCCTGG + Intergenic
1072656769 10:97335022-97335044 GGGGAGGGAGGCCGCGGCCCAGG - Intergenic
1073379352 10:103066164-103066186 GAAAAGGGAGGCCCAGACCACGG - Intronic
1074445696 10:113519669-113519691 GACAGGGGTGGCCGAGCCCCAGG - Intergenic
1075115996 10:119627589-119627611 CAGAAGGGAAGCCGGGTCCAAGG + Intergenic
1075519872 10:123136876-123136898 GAGAAGGGACGCCGAGTCCTGGG - Intronic
1075732436 10:124644546-124644568 GAGAAGGGTTGCTGAGTGCCAGG - Intronic
1076043316 10:127269994-127270016 GAGGAGGCAGGTGGAGTCCCCGG - Intronic
1076903967 10:133353126-133353148 GAGGAGGGTGGCCGAGTGCCTGG + Intergenic
1079373640 11:19872839-19872861 GGGCAGGGAGGCCTAGTCCAGGG - Intronic
1083333300 11:61909067-61909089 GGGAAGGGAGGGCGAGGGCCCGG + Intronic
1083672505 11:64307025-64307047 AAGAAGGGGGGCAGAGTCCAAGG - Intronic
1083846074 11:65334259-65334281 GAGGAGCGGGGCCGAGGCCCGGG + Intronic
1084154746 11:67307280-67307302 GATACGGGAAGCCGAGACCCAGG - Intronic
1084211694 11:67627241-67627263 AAGAGGGGAGCCCGAGCCCCTGG + Intergenic
1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG + Exonic
1084606365 11:70174665-70174687 CAGATAGGAGGCCGAGGCCCAGG + Intronic
1084709554 11:70835581-70835603 GAGAAGAGATGTCCAGTCCCTGG + Intronic
1084751092 11:71204880-71204902 GGGAAGGGACGCCTGGTCCCAGG + Intronic
1084810254 11:71607611-71607633 GAGGAGGGAGGCTGAGTCCGTGG - Intergenic
1084899763 11:72300805-72300827 GAGAAGAGAGGCCTCATCCCCGG + Intronic
1085471093 11:76758629-76758651 GAGAGGGACGGCCGAGACCCAGG - Intergenic
1088722953 11:112610743-112610765 GAGAATGAAGGTCCAGTCCCTGG - Intergenic
1089297205 11:117476921-117476943 GAGAAGGGAAGCAGAGACACAGG + Intronic
1089582451 11:119489780-119489802 CAGAGGGAAGGACGAGTCCCAGG - Intergenic
1094839168 12:34335756-34335778 GAAAGGGGAGGTCGAGTCACCGG + Intergenic
1094841938 12:34345901-34345923 GAAAGGGGAGGTCGAGTCTCCGG - Intergenic
1094842436 12:34347763-34347785 GAAAGGGGAGGTCGAGGCCCTGG - Intergenic
1094842539 12:34348130-34348152 GAAAAGGGAGGTCGAGGCACTGG - Intergenic
1096395480 12:51262915-51262937 AAGAAAGGGGGCCGAGTCCCAGG - Intronic
1096533419 12:52256109-52256131 GCGACGGGAGGCCGAGTGCATGG - Intronic
1096538848 12:52291854-52291876 GAGAAGGGAGGCCAGGTGCTGGG + Intronic
1097053061 12:56235182-56235204 GAGAAGGGAGGCTGAGCAACAGG - Exonic
1097284441 12:57866721-57866743 GAGGCAGGAGGCAGAGTCCCTGG + Intergenic
1102757086 12:115350556-115350578 GCGAAGGGAGGCAGAATCCGTGG - Intergenic
1103844416 12:123891596-123891618 GAGAGGGCAGGCAGAGCCCCGGG + Intronic
1104533425 12:129594771-129594793 GAGAGGGGAGGGGGAGTCCGTGG - Intronic
1104711122 12:130987401-130987423 GAGAAAGGAGGCCGATACCAGGG - Intronic
1104935089 12:132360201-132360223 GAGAAGGGCGGCCGGGTCCCCGG + Intergenic
1105004194 12:132710920-132710942 GAGCACGGCGGCCGAGCCCCCGG - Exonic
1108714291 13:53063749-53063771 GAGAAGGGAAGCCAAGTGCCTGG - Intergenic
1111343079 13:86913825-86913847 GAGCAGGGAGGCCCTGTGCCTGG - Intergenic
1112041505 13:95552665-95552687 GAGGCGGGAGGCGGAGCCCCGGG + Intronic
1112692808 13:101916329-101916351 CAGAAGGGAGGCCGGGGCCGGGG + Intronic
1113579748 13:111420647-111420669 GGGGAGGGAGGCCCAGGCCCGGG - Intergenic
1113615439 13:111677094-111677116 GCGGAGGGAGGCCAAGTCACAGG - Intergenic
1113620907 13:111762000-111762022 GCGGAGGGAGGCCAAGTCACAGG - Intergenic
1113777636 13:112957460-112957482 CAGATGAGAGGCCGAGGCCCCGG + Intronic
1113807105 13:113116304-113116326 GAGGTGGCAGGCTGAGTCCCAGG - Intronic
1114270945 14:21099574-21099596 GAGGAGGGAGGCAGGGTCCTGGG - Intronic
1115480051 14:33851719-33851741 CAGATGGGAGGAGGAGTCCCCGG + Intergenic
1117323603 14:54648118-54648140 GGGAATGGAGGCTGACTCCCTGG + Intronic
1119030581 14:71189096-71189118 GAGAGGGGAGACTGAGGCCCAGG - Intergenic
1119481687 14:74962057-74962079 GAGAAGAGGGGCACAGTCCCGGG - Intergenic
1122324451 14:100874283-100874305 GCTAAGGGAGGCCCAGGCCCTGG + Intergenic
1123038002 14:105479091-105479113 GAGGAGTGAGGCCGAGCCCCGGG - Intronic
1124356015 15:28995259-28995281 GAGAAGGTGGGCTGAGACCCTGG + Intronic
1124469154 15:29968356-29968378 GAGGCGGGAGGCCGACGCCCGGG + Intronic
1124637324 15:31373540-31373562 GAAAAGGGAGGAGGAGTCCAGGG - Exonic
1125426719 15:39556292-39556314 GAGAAGCAAGGACTAGTCCCTGG - Intergenic
1125722218 15:41850809-41850831 GGGGAGGGCGGCCGACTCCCTGG - Intronic
1128181743 15:65611073-65611095 GAGTGGGGAGGCCGAGGGCCCGG - Intronic
1128612380 15:69084477-69084499 GAGAAGTCAAGCTGAGTCCCAGG + Intergenic
1128770957 15:70282115-70282137 CAGAAGTGAGGCTGAGACCCAGG - Intergenic
1129174422 15:73829815-73829837 GTGCAGGGAGGCCCAGTCTCAGG + Intergenic
1129267506 15:74401851-74401873 GAGAGGGGAGGGGGAGTCTCCGG - Intergenic
1129675945 15:77632535-77632557 GAGGCGGGAGGCCGCGGCCCCGG + Intronic
1131087081 15:89585856-89585878 GAAAAGGGAAGCTGTGTCCCGGG - Exonic
1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG + Intergenic
1131258640 15:90877227-90877249 GAGAAGGGAGGCAGAGACCGGGG - Intronic
1131279045 15:91006253-91006275 GAGAGGGGAGGCTGAGTCTATGG - Intronic
1132332526 15:101022645-101022667 GAGAAGGGAGAAGGAGTCCAAGG - Intronic
1132684480 16:1156595-1156617 GGGAGGGGAGGCTGAGGCCCAGG - Intronic
1132809154 16:1789455-1789477 GAGAAGGGAGCTCCAATCCCAGG + Intronic
1133851028 16:9503816-9503838 GACAAGGGAGGCCCAGGCCAAGG - Intergenic
1135020855 16:18961842-18961864 GAGGAGGCAGGCTGATTCCCAGG - Intergenic
1135607305 16:23835928-23835950 GGGGAGGGAGGCGGAGCCCCGGG - Intergenic
1136222620 16:28837861-28837883 GAGATGGGAGTCCGCTTCCCAGG + Intergenic
1136613646 16:31382174-31382196 GAGAAGGGAGACTGAGGCCTGGG - Intronic
1136990739 16:35149964-35149986 GGGAAGGGAGGCCTGGTCCTAGG - Intergenic
1138509643 16:57500918-57500940 GCGAAGGGAGGCCAAGTGCTTGG + Intergenic
1140402456 16:74682768-74682790 GAGAATTGAGGCGGAGTCACTGG + Exonic
1140929096 16:79610463-79610485 GAGATGAGAGGCGGTGTCCCTGG - Intergenic
1141066559 16:80918665-80918687 GAGAAGGAAGGCAGAGGACCAGG + Intergenic
1141137285 16:81474575-81474597 GAGCAGGGAGCCCCAGCCCCTGG + Intronic
1141570644 16:84931630-84931652 GAGAGAGGAGGCAGAGGCCCGGG - Intergenic
1141679357 16:85535387-85535409 GAGAAGGAAGGCCGAGGCCAGGG - Intergenic
1142103888 16:88291807-88291829 CAGAAGGGAGACTGAGGCCCAGG - Intergenic
1142149630 16:88506898-88506920 GAGAAGGGAGACGGAGCCGCAGG - Intronic
1142963043 17:3563332-3563354 GAGGAGGGAGGCCGACAGCCGGG - Intergenic
1145278731 17:21453423-21453445 GAGGAGGGTGGCTGTGTCCCAGG + Intergenic
1145399121 17:22517062-22517084 GAGGAGGGTGGCTGTGTCCCAGG - Intergenic
1146315284 17:31802134-31802156 GAGAAGGGAGCCCTGGTGCCTGG - Intergenic
1146679212 17:34794982-34795004 GAGAAGGGACTCCAAATCCCTGG - Intergenic
1146928014 17:36758297-36758319 GAGAAGGGAGGGTGGGTCCTAGG + Intergenic
1147927364 17:43953978-43954000 GGAAAGGGAGGGGGAGTCCCAGG + Intronic
1147997952 17:44371573-44371595 GAGAAGGCAGGCTGTGTCCTTGG - Intergenic
1149524132 17:57340846-57340868 CAGCAGGGAAGCCCAGTCCCTGG + Intronic
1149994457 17:61399522-61399544 GCGAGGGGAGCCCGGGTCCCGGG - Intergenic
1152086688 17:78224105-78224127 GAGAATGGAGACAGAGTCCCTGG + Exonic
1153739063 18:8103960-8103982 GAGTAGGGAGGCCCAGTGCCAGG + Intronic
1153931557 18:9883951-9883973 GAGAAAGGAGGCCGGGACACAGG + Intergenic
1155331744 18:24725896-24725918 GAGCTGGGTGGCAGAGTCCCAGG - Intergenic
1155344194 18:24842601-24842623 GAGATGGGAGGGAGAGCCCCGGG + Intergenic
1157537469 18:48470591-48470613 GAGCAGGGAAGAGGAGTCCCAGG + Intergenic
1157586364 18:48803931-48803953 GAGAAGGGAGGACCAGCCCTGGG + Intronic
1157596265 18:48865750-48865772 GAGAATGCAGCCCGAGTCCATGG - Intergenic
1159159862 18:64629871-64629893 GAGATGGGACGCCAAGTCCCTGG + Intergenic
1160378536 18:78431504-78431526 GTGGATGGAGGCAGAGTCCCTGG - Intergenic
1160868985 19:1268481-1268503 GGGAGGGGAGGCCGAGGGCCGGG + Intronic
1160874441 19:1290628-1290650 GAGGAGAGAAGCCGTGTCCCGGG - Intronic
1161134809 19:2613499-2613521 GAGAGAGGAGGAAGAGTCCCAGG - Intronic
1161163172 19:2771874-2771896 GAGAAGGGAGGCCCAGCCAAGGG - Intronic
1161196851 19:2991645-2991667 GAGAAGGGAGGCTGAGGGCTGGG + Intronic
1161213608 19:3081515-3081537 GCTAAGGGAGGAGGAGTCCCTGG + Intergenic
1161235168 19:3194037-3194059 GAGAAGGGAGGCCAGAGCCCAGG + Intronic
1162153222 19:8659971-8659993 CAGAAGGGAGACTGAGGCCCTGG + Intergenic
1162733000 19:12730160-12730182 GGGAGGTGAGGCAGAGTCCCAGG - Intergenic
1164739153 19:30563959-30563981 CAGCAGGGAGGCCTAGCCCCAGG + Intronic
1165886868 19:39084655-39084677 GAGTAGGGAGGCGAGGTCCCGGG + Intronic
1166112383 19:40630586-40630608 GAGCAGGGAGCAGGAGTCCCTGG + Intergenic
1166294479 19:41882430-41882452 GAGGAGAGAGGCTGAGACCCAGG + Intergenic
1166803742 19:45472981-45473003 GAGGAGGGAGGGCGAGTTCAGGG - Exonic
1166895145 19:46018156-46018178 GAGAGGGGATGTGGAGTCCCAGG - Intronic
1167105954 19:47429961-47429983 GAGAAGGGAGGCCGAGTCCCAGG + Exonic
1167315752 19:48761912-48761934 GAGAGGGGGGGCAGAGACCCAGG + Intergenic
1167426182 19:49430885-49430907 AGGAAGGGAGGCAGAGACCCAGG + Intronic
1168486318 19:56765235-56765257 GAAAAGGCAGGCCGGGTGCCGGG + Intergenic
925336451 2:3102300-3102322 CAGGTGGGAGGCCGAGCCCCTGG + Intergenic
927743990 2:25599140-25599162 GACAGGGGAGGCCAAGTCCAAGG + Intronic
928549573 2:32357541-32357563 GAGTCGCGAGGCCGAGCCCCGGG - Intronic
930027024 2:47035129-47035151 GAGCAGGGGGGATGAGTCCCGGG + Intronic
932293768 2:70607471-70607493 GAGAAGGCAGGCTGTGTTCCAGG + Intergenic
933707689 2:85304099-85304121 GGGCAGGGAGGCCTAGTCCTGGG - Intronic
934011416 2:87824693-87824715 GAGAGGTGAGGCCGAGGCCGAGG + Intronic
934490852 2:94761288-94761310 GGGAGGGGAGGCCTAGTCCTAGG - Intergenic
935828814 2:106978070-106978092 GAGAAGGGAGACTGGGACCCAGG + Intergenic
937072805 2:119077036-119077058 GAGAAGGGCGTCCTAATCCCGGG - Intergenic
937083684 2:119157506-119157528 GAGAAAGGAGGCTGGTTCCCTGG + Intronic
937131259 2:119515594-119515616 GAGAAGGGTGTCCCAGTTCCAGG - Intronic
937907954 2:127061502-127061524 CAGAAGGGAGGGGAAGTCCCAGG + Intronic
938163806 2:129009204-129009226 GAGAATGGGGGCCGAGCCCGGGG + Intergenic
938315867 2:130327754-130327776 CAGAAGGGACGCCGAGGCCAAGG - Intergenic
939612870 2:144332003-144332025 GAGAAGGGAGGCCGGGCGTCCGG - Intronic
942485889 2:176439534-176439556 GGTAAGGGATGCCAAGTCCCTGG - Intergenic
944202974 2:197127804-197127826 GAGAAGGGAGGGAGAGCACCAGG - Intronic
945098143 2:206239008-206239030 GAGAATGGAGGTGGAGTCTCTGG - Intergenic
945801625 2:214439175-214439197 GAGAAGACAGACTGAGTCCCAGG + Intronic
948170163 2:235894998-235895020 GAAAACGGAGGCCGAGGCCGAGG - Intronic
948234909 2:236380158-236380180 GAGCAGTGAGGCCCAGTCTCAGG - Intronic
948661305 2:239508173-239508195 GAGAAGGGAGGCTGGGTCCCAGG - Intergenic
948901684 2:240959558-240959580 GAGAAGGGAAGAGTAGTCCCTGG + Intronic
1170216613 20:13898291-13898313 GAGATGGGAGGCTTATTCCCTGG + Intronic
1172100807 20:32483294-32483316 GAGAAGGGGGGCGGCGGCCCGGG + Intronic
1172113308 20:32559999-32560021 AAGAAGGCAGCCCGAGTGCCAGG - Intronic
1172197553 20:33102438-33102460 GAGATGGGAGGCTGAGGCCGGGG - Intronic
1172272636 20:33663307-33663329 CAGAAAGGAGGCGGAGTCCGGGG + Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1172879865 20:38192889-38192911 GAGAAGGGAGGGAGGGTCCCTGG - Intergenic
1178237767 21:30862837-30862859 GAGAAGGGAGGCCTAGGGACAGG - Intergenic
1178636225 21:34306728-34306750 GAGAAGGGAGGGAGAGTGACAGG + Intergenic
1179597669 21:42453762-42453784 GAGAGAGGAGGCCAAGTCCCTGG + Intergenic
1179985140 21:44916432-44916454 GCGACGTGAGGCCGAGGCCCCGG + Intronic
1180595714 22:16971882-16971904 GAGAAGGAATGCAGAGGCCCAGG - Intronic
1180941775 22:19664132-19664154 GGGGAGGGAGGCGGAGTCCCAGG - Intergenic
1181846973 22:25718360-25718382 GAGAGGAGAGGGAGAGTCCCGGG + Exonic
1181886114 22:26023609-26023631 GAGCAGGATGGCAGAGTCCCGGG + Intronic
1181967978 22:26669820-26669842 GTGCAGGGAGGCGGAGGCCCTGG + Intergenic
1184214521 22:43057854-43057876 GAAAACGGAGGCCCAGGCCCCGG - Intronic
1184541620 22:45129431-45129453 GACAAGGGAGGCAGAGTCAAAGG + Intergenic
1184890649 22:47376927-47376949 GAGAAGGCAGGCAGAGGCCACGG - Intergenic
1185029519 22:48434341-48434363 GGGCAGGGAGGCGGAGCCCCGGG + Intergenic
1185270833 22:49928795-49928817 CAGAAGGCAGGCCTTGTCCCTGG + Intergenic
1185316211 22:50180307-50180329 GTGGAGGGAGGCGAAGTCCCCGG - Intergenic
950421952 3:12904572-12904594 GAGGAGGGAGGCCATGTCCTGGG - Intronic
950466984 3:13161519-13161541 GAAAAGGGAGGCCCAGCTCCTGG + Intergenic
950795354 3:15505992-15506014 GAGGAGGGAGGCTGGGTTCCTGG + Intronic
951020040 3:17773378-17773400 GAGAATGGAGGCTGGGACCCTGG - Intronic
951729013 3:25790221-25790243 GAGAGGGGAGTCCGAGGACCTGG + Intronic
954681215 3:52347041-52347063 AACAAGAGAGGCCCAGTCCCTGG + Intronic
955336995 3:58095020-58095042 GAAAATGGAGGCACAGTCCCTGG - Intronic
957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
959496045 3:107053094-107053116 GAGAAGGGAAGCAGAGTACCTGG - Intergenic
961441497 3:126955923-126955945 GAGAAGGGAAGACCAGACCCAGG + Intronic
963827406 3:149970556-149970578 GGGCGGGGAGGCCGAGGCCCGGG - Intronic
965265057 3:166532159-166532181 GAGTAGGGAGGCCCTGGCCCTGG + Intergenic
965503006 3:169478721-169478743 GAGAAGGGATGCCAATTCCTAGG + Intronic
966567239 3:181396813-181396835 GAGAAGGCAGGCCTACACCCTGG - Intergenic
966914022 3:184575165-184575187 GAGAAGGGATGCTCAGGCCCTGG + Intronic
967807647 3:193729784-193729806 GTGAAGGCAGGCTGAGTCTCTGG - Intergenic
969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
969614810 4:8246211-8246233 GAATGGGGAGGCCGAGCCCCAGG + Intergenic
969732206 4:8963995-8964017 GAGGAGGGAGGCTGAGTCCGGGG - Intergenic
971150150 4:24022688-24022710 TAGAAAGGAGCCAGAGTCCCGGG + Intergenic
971405859 4:26320612-26320634 GAGAAGGGAGGAGGGGTCCTGGG - Intronic
972323809 4:37996158-37996180 GAGCAGGGAGGCCCACACCCAGG - Intronic
975820362 4:78265028-78265050 GAGACTGTAGTCCGAGTCCCTGG + Exonic
975871054 4:78778561-78778583 TAGAAGGGAGGCCAAGGCCTAGG + Intronic
986035464 5:3932856-3932878 CAGAAGGGAGGCTCAGTTCCAGG + Intergenic
986349912 5:6867566-6867588 GAGAAGGGAGCCGGGGACCCCGG + Intergenic
990446649 5:55899440-55899462 GAGAAGGGAGCCAGCTTCCCTGG - Intronic
991548084 5:67805895-67805917 GAGAATGGAGGCAGTCTCCCAGG + Intergenic
992457919 5:76933191-76933213 GAGAAGCCAGGCGGAGTGCCCGG + Intergenic
996900459 5:128537722-128537744 GAGCAGGGAGCCCGAGCCCGAGG - Exonic
997521707 5:134527498-134527520 GGGAAGGGCAGCCGAGCCCCAGG - Intronic
997782605 5:136675269-136675291 GAGAGGGGAGGCCGTGGGCCAGG + Intergenic
998469848 5:142375192-142375214 AGGAAAGGAGGCCGAGACCCCGG - Intergenic
998957708 5:147454062-147454084 GGGAGCGGAGGCTGAGTCCCGGG + Intronic
1001457122 5:171872429-171872451 AAGCAGGGAGGCCGAGTGCTGGG + Intronic
1001560902 5:172668425-172668447 GAGAAGGAAGGCCCAGTCACGGG - Intronic
1001647641 5:173294260-173294282 GAGGAGGGAGGGCGAGAGCCCGG + Intergenic
1001675889 5:173514980-173515002 GTGAAGGGAGTCTGTGTCCCTGG + Intergenic
1003767906 6:9261587-9261609 GAGAAGGGAGGCCCTGGACCTGG + Intergenic
1006521258 6:34572586-34572608 GAGAAGAAAGCCCGAGTCCCTGG + Intergenic
1007092050 6:39190701-39190723 GAGAACAGAGGCCCTGTCCCGGG + Exonic
1007298314 6:40845744-40845766 GAGAAGGGAGGCTGAGGTCCAGG + Intergenic
1007394008 6:41566961-41566983 GAGAAGGAGTGCAGAGTCCCAGG - Intronic
1007473153 6:42103801-42103823 GAGATGGGATGGCGGGTCCCAGG + Exonic
1007716241 6:43857775-43857797 GGTAAGGGATGCCGAGGCCCAGG + Intergenic
1007774863 6:44219416-44219438 GAGAAGGGGGTCCGAGCCCTTGG + Intergenic
1007810245 6:44480556-44480578 GAGAAGGGAGGCTTCTTCCCGGG - Intergenic
1010660613 6:78566770-78566792 GAGAAGGCAGGCCCAAGCCCAGG + Intergenic
1015848396 6:137546730-137546752 GAGAGGGGAGGCTGAGTGGCTGG + Intergenic
1018308795 6:162487358-162487380 GAGAAGGAAGGCCAAGTGACTGG + Intronic
1018438697 6:163788392-163788414 GAAAAGGGAGGAAGAGTTCCTGG - Intergenic
1019491378 7:1315056-1315078 CAGAGGGGAGGCCGGGTCCCAGG + Intergenic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1022675505 7:32495527-32495549 GGGAAGGGCGGCCGTGGCCCTGG + Exonic
1024544166 7:50503013-50503035 AAGAAGGGAGGCCAACGCCCAGG + Intronic
1024710608 7:52010943-52010965 GGGCAGGGAGGCAGAGTCCAAGG - Intergenic
1025145176 7:56495654-56495676 GAAAAGGGAGGCCCAGTCCTAGG - Intergenic
1025260778 7:57416146-57416168 GGGAAGGGAGGCCCAGTCCTAGG - Intergenic
1025983691 7:66428997-66429019 GAGAGGGGACTCGGAGTCCCAGG - Intergenic
1026031504 7:66798361-66798383 GAGAAGGGACTCGGAGTCCCAGG + Intronic
1026160370 7:67863265-67863287 GAGAGGGGAAGCCCAGTCTCTGG + Intergenic
1026846059 7:73699805-73699827 GGGAAGGGAAGCTGAGGCCCAGG + Exonic
1028163736 7:87514604-87514626 GAGTGGGGAGGCAGAGTCCAGGG - Intronic
1028602604 7:92618301-92618323 GACATGGGGGGCAGAGTCCCAGG + Intronic
1030309288 7:108053428-108053450 GAGAAGGCAGGCCCTGTCCAGGG + Intronic
1032189488 7:129755931-129755953 GAGATGGGAGGCTGAGGCCCGGG - Exonic
1032516298 7:132508658-132508680 GAGAAGGCAGGTCCAGTTCCAGG + Exonic
1033321340 7:140342470-140342492 GAGAATGTTGGCCGAGTCTCAGG - Intronic
1034051573 7:147989603-147989625 GAGAAGACAGGCCTAGTCTCAGG + Intronic
1035595217 8:852290-852312 GAGACAGGAGGCAGAGCCCCAGG - Intergenic
1037188369 8:16092382-16092404 AAGAAGGGAGGCTGGGCCCCAGG + Intergenic
1037512976 8:19602540-19602562 GAGAACGGTGGGCGCGTCCCAGG + Intronic
1037758588 8:21727321-21727343 GGCAAGGGAGGCCCTGTCCCTGG - Intronic
1038353558 8:26805427-26805449 GAGAAGGGAGACCAAGACTCTGG + Intronic
1043394357 8:79822186-79822208 AAGAAGGGAGGGAGTGTCCCTGG + Intergenic
1045354373 8:101372341-101372363 GAGAAGGGAAGCTGAGTGCCTGG + Intergenic
1045582791 8:103499374-103499396 GAGGAGGGAGGAAGGGTCCCTGG - Intergenic
1046860288 8:119083943-119083965 GAAAAGGGAGGCCCAGACCCTGG - Intronic
1048182181 8:132205727-132205749 GAGAAAGGATGCAAAGTCCCTGG + Intronic
1049223041 8:141436561-141436583 AAGCAGGGAGGCCCAGGCCCTGG - Intergenic
1049409581 8:142466494-142466516 GAGGAGGGAGGCAGCGCCCCTGG + Intronic
1049606667 8:143532802-143532824 GAGATGGGAGGCTGGGGCCCAGG - Intronic
1049641720 8:143718963-143718985 GAGGAGGCAGGCTGAGGCCCCGG - Intronic
1051342148 9:16121436-16121458 GAGAAGGGGAGCAGAGTCGCAGG - Intergenic
1053000308 9:34574155-34574177 GAGGAGGGAGGCCTGGCCCCTGG + Intronic
1053363960 9:37509705-37509727 GACATGGCAGCCCGAGTCCCGGG - Intergenic
1053537204 9:38937730-38937752 GAGACAGGAGGCTGAGACCCCGG - Intergenic
1053667142 9:40324400-40324422 GGGAGGGGAGGCCTAGTCCTAGG + Intronic
1053916732 9:42949511-42949533 GGGAGGGGAGGCCTAGTCCTAGG + Intergenic
1054378288 9:64464428-64464450 GGGAGGGGAGGCCTAGTCCTAGG + Intergenic
1054517468 9:66051883-66051905 GGGAGGGGAGGCCTAGTCCTAGG - Intergenic
1054628931 9:67426200-67426222 GAGACAGGAGGCTGAGACCCCGG + Intergenic
1056098178 9:83275247-83275269 GAGAAGGAAGTCGGAATCCCAGG - Intronic
1056766277 9:89446587-89446609 GAGAGGGGAGGCTGCCTCCCAGG + Intronic
1057142664 9:92737016-92737038 GAGAAGGCAGGCCAGGTCCCAGG + Intronic
1057256245 9:93549925-93549947 GAGAAGGGAAGGAGACTCCCAGG + Intronic
1057948857 9:99353756-99353778 GAGAAAGGAGGGCCAGTCTCTGG - Intergenic
1059438326 9:114289314-114289336 CAGCAGGGAGACTGAGTCCCAGG + Intronic
1060829225 9:126703308-126703330 GAAAATGTAGGCTGAGTCCCGGG + Intergenic
1060855816 9:126914629-126914651 GAGCTCGGAGGCCGAGGCCCGGG + Intergenic
1060867581 9:127012416-127012438 GGGAAGGGTGGCCGAGACACAGG - Intronic
1061042090 9:128146203-128146225 GAGAAAGCAGGCCCAGTCCAGGG + Intergenic
1061578849 9:131524381-131524403 GAGAAGCGAGGCGGATGCCCTGG - Exonic
1061802523 9:133120343-133120365 GAGGAGGGTGGCCCAGGCCCAGG - Intronic
1062015589 9:134289584-134289606 GAGCTGGGAGGCAGAGTACCTGG - Intergenic
1062277761 9:135738811-135738833 GAGAAGGAAGGAGGAGACCCCGG - Intronic
1203769050 EBV:40024-40046 GAGCAGGGAGGGGGCGTCCCGGG - Intergenic
1186514907 X:10159782-10159804 GAGAAGGGAGGGCGGGGACCCGG - Intronic
1189282418 X:39828135-39828157 GAGACGCGATGACGAGTCCCTGG + Intergenic
1190265921 X:48827100-48827122 GCGCAGGGAGGCCGCGGCCCTGG - Intergenic
1190286711 X:48966313-48966335 CAGAAGGGAGGCAGGGTCACGGG + Intronic
1192227386 X:69238578-69238600 GGGAAGGGAGGCTGTGGCCCCGG + Intergenic
1195354112 X:104022312-104022334 GTGAAGGGATACCGAGTTCCTGG + Intergenic
1195870035 X:109475909-109475931 GAGAAAAGCGCCCGAGTCCCAGG + Exonic
1199601534 X:149544093-149544115 GAGAAGGGAGGCAGAGTGGGAGG + Intronic
1199648843 X:149935391-149935413 GAGAAGGGAGGCAGAGTGGGAGG - Intronic