ID: 1167106536

View in Genome Browser
Species Human (GRCh38)
Location 19:47433113-47433135
Sequence AGCAAACGGTCTTGGGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167106536 Original CRISPR AGCAAACGGTCTTGGGGAAC TGG (reversed) Intronic
900535512 1:3175216-3175238 AGCAAACTGTTTTTGGGAAGGGG + Intronic
903224484 1:21887079-21887101 AACAAACAGGCTTGGGGGACTGG + Intronic
903936304 1:26897492-26897514 AGGAACCTGTCTTGGGGAACTGG + Exonic
904090001 1:27938140-27938162 AGCAAACAGCTTTGGTGAACAGG - Intronic
913210280 1:116576528-116576550 AGAAAACTGTCTTGGAGAATGGG - Exonic
914754252 1:150553928-150553950 GGCCAAGGGCCTTGGGGAACGGG + Exonic
918881149 1:190122935-190122957 AGCAGACAGTCTAGGGAAACTGG + Intronic
922977615 1:229798478-229798500 AGCCCACAGTCTTGGGGAAATGG - Intergenic
1063019686 10:2115152-2115174 AGCAAACACTCTTCTGGAACTGG - Intergenic
1076644806 10:131945826-131945848 TGCAAAGGCACTTGGGGAACAGG - Intronic
1078780691 11:14436393-14436415 AGAAAAGGGACTTGGGGAAATGG - Intergenic
1080137170 11:28868913-28868935 AGAAAACGGTACTGTGGAACAGG - Intergenic
1082031599 11:47608600-47608622 AGCAGAGGCTGTTGGGGAACTGG + Intergenic
1084207797 11:67606105-67606127 AGAAAGGGGTCTTGGGGGACGGG + Intronic
1087288144 11:96288994-96289016 AGAAAACCGTCATGGGGAAAGGG + Intronic
1087657823 11:100946827-100946849 AGCAAACGCTCTTGGAAAAATGG + Intronic
1088781137 11:113135386-113135408 AGAAAACAGACTTGGGCAACAGG + Intronic
1092080438 12:5711601-5711623 AGGAGCAGGTCTTGGGGAACTGG - Intronic
1105307977 13:19182202-19182224 AGGAACCGGTCTGGGGCAACTGG - Intronic
1105434672 13:20366175-20366197 AGCAAACAGCATTGGGTAACAGG + Intergenic
1106461782 13:29976853-29976875 AACAAAGGGACTTGGGGAAGGGG - Intergenic
1106677906 13:31981074-31981096 AGCAAACTGCCTGGGGAAACTGG + Intergenic
1111462060 13:88558304-88558326 AGGAAAAGGTATTGGTGAACAGG + Intergenic
1112499449 13:99931321-99931343 AACAAACGGTCTTGGGGAAGAGG - Intergenic
1117762496 14:59045294-59045316 AGCAATCAGTGTTGGGAAACTGG - Intergenic
1125301996 15:38264766-38264788 AGAAAAGGGTATTGGGGAAGAGG + Intronic
1129713573 15:77833916-77833938 AGCAAAGGGGCTCTGGGAACTGG - Intergenic
1132749263 16:1449914-1449936 AGCACACGGGCCTGGGGAGCAGG + Intronic
1138387981 16:56649145-56649167 AGTGTACGGTTTTGGGGAACTGG + Intronic
1141425868 16:83944015-83944037 AGCAAGCCACCTTGGGGAACAGG + Intronic
1141529452 16:84636144-84636166 AGCCAACAGTTTTGGGGAGCAGG + Intergenic
1141790561 16:86231529-86231551 AGCAATTGCTCTTGGGGAATTGG - Intergenic
1142055855 16:87995406-87995428 AGAAAATGTTCTTAGGGAACAGG + Intronic
1142232507 16:88906400-88906422 AGCAAGTGGTCTTGGGGACGAGG - Intronic
1142352786 16:89587462-89587484 AGGAAACGGGCTTGGGGTTCAGG + Intronic
1147968071 17:44204755-44204777 AGTACATGGTCTTGGGGAATTGG - Intergenic
1148092541 17:45031266-45031288 AGCAGCAGGTCTTGGGGAACAGG - Intronic
1148843570 17:50515129-50515151 AGGAAAGGGCCCTGGGGAACAGG - Intronic
1148931052 17:51127659-51127681 ATCCAAAGCTCTTGGGGAACAGG - Intergenic
1148985942 17:51621517-51621539 AGCAAAGGGTCTAGGGTAGCTGG + Intergenic
1149902491 17:60493014-60493036 TGAAAACAGTGTTGGGGAACCGG - Intronic
1149999074 17:61421141-61421163 AGCAAACTATCTCGGGGGACTGG + Intergenic
1151384844 17:73748725-73748747 ACCATATGGTGTTGGGGAACAGG + Intergenic
1154126217 18:11694622-11694644 AGCTCACGGGCTTGGGGAGCAGG + Intronic
1155329197 18:24697702-24697724 AGGAAATTGTCTTGGAGAACTGG - Intergenic
1161491800 19:4566479-4566501 AGCAGATGGTCTTGGGGATAGGG - Intergenic
1163775009 19:19212586-19212608 AGCGAACGGCCATGGGGAAGGGG + Intronic
1167106536 19:47433113-47433135 AGCAAACGGTCTTGGGGAACTGG - Intronic
1167739434 19:51315396-51315418 AGCAAATGTTCTTGGGGACCAGG + Intronic
924995011 2:351725-351747 AGCAAATGGTGTTGGGAGACTGG + Intergenic
925285716 2:2714353-2714375 GGGAAAGGGTCTTGGGGAAGGGG + Intergenic
927531374 2:23806294-23806316 ACCAAATGGTCTTGGAAAACTGG - Intronic
929424487 2:41830201-41830223 AGAAAAAGGTCTTGGGCAAGGGG - Intergenic
931203700 2:60126276-60126298 AGCAAACCGTTTTGGGCAAGAGG + Intergenic
932585130 2:73022851-73022873 AGCAAAAGTCCATGGGGAACGGG + Intronic
933625377 2:84591868-84591890 AACAAACGGTGTTAAGGAACTGG + Intronic
935068599 2:99674432-99674454 GGAAAACAGTCTTGGGGAAGGGG - Intronic
1170798217 20:19568954-19568976 AGCAAACCTAGTTGGGGAACTGG - Intronic
1172802131 20:37583232-37583254 AGCAAATGCTCTCAGGGAACAGG - Intergenic
1173835065 20:46119422-46119444 AGCAATGGCTCTTAGGGAACAGG + Intronic
1178719295 21:34993987-34994009 AGCAAGTGGTTTTGGGGAAAGGG + Intronic
1178787275 21:35665165-35665187 AGGAAAGGGTCTTGGGGGATGGG + Intronic
951276766 3:20696913-20696935 AGCAAACTTTCTGTGGGAACAGG + Intergenic
957906159 3:86558805-86558827 AGCAGCAGGTCTTGGGGAAATGG + Intergenic
963177918 3:142321065-142321087 AGCAAATGGTGCTGGGTAACTGG - Intronic
964928314 3:161983461-161983483 AGCAAACCCCCTTGGAGAACTGG + Intergenic
966803458 3:183786280-183786302 AGCAAACGGTCCTGCACAACAGG + Exonic
967488660 3:190063352-190063374 AGCAAATGTTCTTGGGAAAAAGG + Intronic
969454493 4:7293596-7293618 AGTGAATGGTTTTGGGGAACTGG + Intronic
969627560 4:8315452-8315474 AGGAAGGTGTCTTGGGGAACAGG - Intergenic
969943812 4:10762029-10762051 AGGGAAGGGTCTGGGGGAACTGG + Intergenic
970737089 4:19184609-19184631 AGCAAATGGGCTTGGGGAAGTGG + Intergenic
970950680 4:21752023-21752045 AGCTAACAGCCTTGGGGAGCTGG - Intronic
976988795 4:91337684-91337706 AGGAAAAAGCCTTGGGGAACAGG - Intronic
983986321 4:174064263-174064285 AGCAAATGGACTTTGGGATCTGG + Intergenic
985793795 5:1947223-1947245 GGCAAATTGTCTTGGGGAAAGGG - Intergenic
988313057 5:29587143-29587165 ACCAAATGGGCTTGGGGAAAGGG - Intergenic
993576935 5:89613579-89613601 AGCAGAAGGTCTTTGGGGACAGG - Intergenic
994669591 5:102751181-102751203 GGCAAACTGACTTGGAGAACTGG + Intergenic
1003594727 6:7464076-7464098 AGCAAATGGTTCTGGGGAAAAGG + Intergenic
1005296530 6:24432686-24432708 AGCAAACAATTTTGGAGAACAGG + Intronic
1015257913 6:131200419-131200441 AGCAAAGGGTCATGGAGAGCAGG - Intronic
1017644699 6:156527980-156528002 AGCAAACCGTCCTGAGGACCAGG + Intergenic
1023741034 7:43280848-43280870 AGCAAATGGGTTTGAGGAACAGG + Intronic
1026136713 7:67669419-67669441 AGCAAGAATTCTTGGGGAACAGG - Intergenic
1028426510 7:90695841-90695863 AGCAAAGGGTCTGGGGGAGAAGG + Intronic
1028792325 7:94866924-94866946 ATCAATAGGTTTTGGGGAACAGG + Intergenic
1032717357 7:134520998-134521020 AGCAAAGGGTCTGGAGGAGCTGG + Intergenic
1033876472 7:145825045-145825067 AGCAAATGACTTTGGGGAACTGG - Intergenic
1034537146 7:151732516-151732538 AGCAATCCTTCTTGGAGAACAGG + Intronic
1036482559 8:9151393-9151415 AGCATACGCCCTGGGGGAACAGG + Intronic
1038573800 8:28686538-28686560 AGTAAATGGGCTTGGGGAGCAGG + Intronic
1039405498 8:37309060-37309082 AGCAAAAGGTATGGGGGAAATGG - Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1041717664 8:60946659-60946681 AGGAAATGGTCTTTGGGATCAGG + Intergenic
1043365869 8:79532716-79532738 AACAAATGGTGTTGGGTAACTGG - Intergenic
1047524906 8:125624607-125624629 GGCAAAGATTCTTGGGGAACTGG + Intergenic
1049968387 9:799638-799660 AGCAAACGTTGATGGGGAATTGG + Intergenic
1052563497 9:30116040-30116062 AGCAAAATGTCTTGAGTAACAGG + Intergenic
1055597225 9:77877947-77877969 AGCAAATGGTGTTAGGGAAGAGG - Intronic
1056292966 9:85162300-85162322 AACAAATGGTGTTGGGAAACTGG - Intergenic
1057002636 9:91526594-91526616 AACAAATGGTCCTGGGAAACTGG + Intergenic
1061900873 9:133671345-133671367 AGCAAGAGGTTTTGGGGAAATGG + Intronic
1062241484 9:135542364-135542386 AGCAAACGGGCTGGAGCAACTGG - Intergenic
1203784940 EBV:122398-122420 AGCAGACTGTTTTGGTGAACGGG - Intergenic
1191142555 X:57132037-57132059 ATCACATGGGCTTGGGGAACAGG + Intergenic
1191780988 X:64865208-64865230 AGCCAATAGTCTTGGGAAACAGG - Intergenic
1192810440 X:74542524-74542546 AGCATACCGTCTTGGGCAACTGG + Intergenic
1196697246 X:118626364-118626386 AGCAAAGGGTTTTGGGGACCGGG - Intronic
1200345810 X:155447207-155447229 AACAAACGGTGTTGGAAAACTGG + Intergenic