ID: 1167107261

View in Genome Browser
Species Human (GRCh38)
Location 19:47437603-47437625
Sequence GAACCAGGGAAGCTCCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 459}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167107247_1167107261 28 Left 1167107247 19:47437552-47437574 CCACCGTGTTCTGGGGATGAGAG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1167107261 19:47437603-47437625 GAACCAGGGAAGCTCCATGTTGG 0: 1
1: 0
2: 1
3: 18
4: 459
1167107250_1167107261 25 Left 1167107250 19:47437555-47437577 CCGTGTTCTGGGGATGAGAGGGT 0: 1
1: 0
2: 1
3: 18
4: 236
Right 1167107261 19:47437603-47437625 GAACCAGGGAAGCTCCATGTTGG 0: 1
1: 0
2: 1
3: 18
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167107261 Original CRISPR GAACCAGGGAAGCTCCATGT TGG Intronic
900553345 1:3267828-3267850 GAACCAGGGAGGCTTCCTGTGGG - Intronic
900556701 1:3284211-3284233 GAACCTGGGACGCTTAATGTCGG - Intronic
900854308 1:5168444-5168466 GAAACAGGGTTTCTCCATGTTGG - Intergenic
901458346 1:9376734-9376756 GAACCAGGGAAGCTCCAGGCAGG + Intergenic
901477964 1:9503936-9503958 GAGCCAGGGTTTCTCCATGTTGG + Intergenic
901485440 1:9557117-9557139 GAGACAGGGATTCTCCATGTTGG + Intronic
902181513 1:14692744-14692766 GAAACAGGGTTTCTCCATGTTGG - Intronic
902776508 1:18678223-18678245 GAAACAGGGTTTCTCCATGTTGG - Intronic
903031185 1:20465415-20465437 GCACCAGGGAGGCTGCAGGTTGG + Intergenic
904861036 1:33537729-33537751 GAACCGGGGCAGCCCCAGGTAGG + Intronic
906027637 1:42687466-42687488 GAAACAGGGTTTCTCCATGTTGG + Intronic
906521422 1:46469133-46469155 CACCCAGGGAACCTCCAGGTGGG + Intergenic
906644711 1:47466077-47466099 GAATCAGGGAAGCTTCCTGGAGG - Intergenic
906971980 1:50525070-50525092 GAAGCAGGGTTTCTCCATGTTGG + Intronic
907673845 1:56500673-56500695 AAAGCAGGGAAGCAACATGTTGG + Intronic
908104970 1:60832015-60832037 GAATCAGAGAAGTTCCATGATGG - Intergenic
908186396 1:61656677-61656699 GAGACAGGGTATCTCCATGTTGG - Intergenic
908353354 1:63308015-63308037 GAAACAGGGTTTCTCCATGTTGG - Intergenic
911052723 1:93684914-93684936 GAAACAGGGGTTCTCCATGTTGG + Intronic
911611025 1:99959369-99959391 GAACCAGACAAACTCCATCTTGG + Intergenic
912922805 1:113885606-113885628 GAGACAGGGATTCTCCATGTTGG + Intronic
915046534 1:153022031-153022053 GAACCAGACAAACTCCATCTTGG + Intergenic
915453994 1:156027119-156027141 GAGACAGGGATTCTCCATGTTGG - Intergenic
915577381 1:156788850-156788872 GAAACAGGGTTTCTCCATGTTGG + Intronic
916118470 1:161507898-161507920 GAAACAGGGTTTCTCCATGTTGG - Intronic
916143282 1:161718275-161718297 GAAACAGGGTTTCTCCATGTTGG - Intergenic
917333588 1:173906929-173906951 GAAACAGGGTTTCTCCATGTTGG - Intronic
917573661 1:176296747-176296769 CAGCCAGGGAAGCTCAAAGTGGG - Intergenic
917718277 1:177759883-177759905 GCAGCAGGGAAGCTCCAACTGGG + Intergenic
919999945 1:202790075-202790097 GAAACAGGGTTTCTCCATGTTGG - Intronic
920106543 1:203557306-203557328 GCATCATGAAAGCTCCATGTGGG - Intergenic
921213818 1:212920963-212920985 GACCCAGGTAAGCCCCATGCTGG + Intergenic
922098210 1:222460574-222460596 GCACTAGGTAAGCTCTATGTGGG - Intergenic
922296521 1:224254599-224254621 GAAACAGGGTTTCTCCATGTTGG + Intronic
923628629 1:235634754-235634776 GAAACAGGGTTTCTCCATGTTGG - Intronic
923931294 1:238700886-238700908 CAACCAGGACAGCTCCATTTTGG - Intergenic
1062811340 10:468572-468594 GAAACAGGGTTTCTCCATGTTGG - Intronic
1062973971 10:1670063-1670085 GAACCTGGGAGGCTTCATGAAGG - Intronic
1063456612 10:6187172-6187194 GAAACAGGGATTCACCATGTTGG - Intronic
1064163275 10:12964184-12964206 GAACCGGGGTTTCTCCATGTTGG - Intronic
1064201121 10:13285788-13285810 GAGACAGGGTTGCTCCATGTTGG + Intronic
1064402144 10:15030425-15030447 GAGACAGGGTTGCTCCATGTTGG + Intergenic
1064460872 10:15534094-15534116 GAGTCAGGGTATCTCCATGTTGG + Intronic
1064609433 10:17082522-17082544 GAACCAGAGAATCACCATGAAGG + Intronic
1065418979 10:25520892-25520914 GAAGCCGGGAAGCTCCAACTGGG - Intronic
1065877578 10:30010728-30010750 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1066469650 10:35686269-35686291 GAAACAGGGATTCGCCATGTTGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067656055 10:48192398-48192420 GAGACAGGGATTCTCCATGTTGG - Intronic
1068313656 10:55312801-55312823 GAGACAGGGATTCTCCATGTTGG + Intronic
1069325515 10:67227275-67227297 GAGCCAGGGTTTCTCCATGTTGG + Intronic
1069824437 10:71246437-71246459 GAATCAGGGAAGCACCCTGTGGG + Intronic
1070106096 10:73432817-73432839 GAACCAGGGAAGCTGTGTCTGGG - Intronic
1071448277 10:85769813-85769835 GCAGCAGGGAAGCTCCAACTGGG + Intronic
1071459319 10:85877096-85877118 GCAGCAGGGAAGCTCCAACTGGG + Intronic
1072685290 10:97533053-97533075 GACCCAGGGAAACACCATGCAGG - Intronic
1073995190 10:109307448-109307470 GAACCAGACAAACTCCATCTTGG - Intergenic
1076448017 10:130531718-130531740 GAACCAGGGTTTCACCATGTTGG - Intergenic
1077873220 11:6280844-6280866 GAACCAGACAAACTCCATCTTGG + Intergenic
1079036616 11:17025761-17025783 GAAGCAGGGTTTCTCCATGTTGG - Intergenic
1079202168 11:18385576-18385598 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1079225363 11:18600387-18600409 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1079241886 11:18727435-18727457 GGCCCAGGGAATCTGCATGTGGG - Intergenic
1079647182 11:22880097-22880119 TAAACAGAGAAGCTCCAGGTAGG + Intergenic
1079970382 11:27029541-27029563 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1080288594 11:30644935-30644957 GAACCAGAGCAACTCCATCTTGG + Intergenic
1081921521 11:46782009-46782031 GAAGCAGGGTTTCTCCATGTTGG + Intronic
1083461390 11:62814778-62814800 GAAACGGGGTTGCTCCATGTTGG + Intronic
1084174773 11:67417503-67417525 GAGCCAGGGAAGCAGCCTGTGGG - Exonic
1084588620 11:70077923-70077945 GAACCAGGCAAGCTCCCCGGAGG + Intergenic
1084762167 11:71280842-71280864 GAGCCAGGGTTTCTCCATGTTGG - Intergenic
1086347401 11:85910983-85911005 GAAACAGGGTTTCTCCATGTTGG - Intronic
1087598734 11:100286220-100286242 GCAGCAGGGAAGCTCCAACTGGG + Intronic
1088286401 11:108193537-108193559 GAGCCAGGGTTTCTCCATGTTGG - Intronic
1088288745 11:108213085-108213107 GCACCAGGGTTTCTCCATGTTGG - Intronic
1089505693 11:118960731-118960753 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1089509876 11:118989886-118989908 GAAGCAGGGTTTCTCCATGTTGG - Intergenic
1089740731 11:120580460-120580482 GAAACAGGGTTTCTCCATGTTGG + Intronic
1091077074 11:132629154-132629176 CAAGCAGGGAAGCACCAGGTTGG - Intronic
1091174717 11:133547699-133547721 GATCCAGGAAACTTCCATGTGGG - Intergenic
1092370591 12:7913827-7913849 GAGACAGGGTTGCTCCATGTTGG + Intergenic
1092815979 12:12312681-12312703 GAGACAGGGAATCACCATGTTGG + Intergenic
1094541174 12:31364339-31364361 GAACCAGGGTTTCACCATGTTGG - Intergenic
1095567912 12:43647987-43648009 GAGACAGGGTATCTCCATGTTGG - Intergenic
1095764194 12:45876362-45876384 GAAACAGGGTTTCTCCATGTTGG - Intronic
1096298888 12:50408381-50408403 GAGACAGGGATTCTCCATGTTGG + Intronic
1097022524 12:56030541-56030563 GAAACAGGGTTTCTCCATGTTGG - Intronic
1097068228 12:56336276-56336298 GAAACAGGGTTTCTCCATGTTGG - Intronic
1097665024 12:62468220-62468242 GAAACAGGGTTTCTCCATGTTGG + Intronic
1097879780 12:64676353-64676375 GAAACAGGGTTTCTCCATGTTGG + Intronic
1098469705 12:70829105-70829127 CAGACAGGTAAGCTCCATGTGGG + Intronic
1101305889 12:103527489-103527511 GAATGAGGGAAACTCCAAGTTGG - Intergenic
1101564301 12:105891154-105891176 GACACAGTGAAGCTCCATTTAGG - Intergenic
1102284841 12:111647707-111647729 GAAACAGGGTTTCTCCATGTTGG - Intronic
1103389340 12:120559881-120559903 GAAACAGGGTATCTCTATGTTGG + Intronic
1104919089 12:132281278-132281300 GCACCGGGGAAGCTCCAGGCTGG + Intronic
1105057728 12:133118129-133118151 GAACCAGGGTTTCACCATGTTGG + Exonic
1105470151 13:20686101-20686123 CAGCCAAGGAAGCTCGATGTGGG - Intronic
1106370340 13:29126711-29126733 GGCCCAGGGAAGCTACATATTGG + Intronic
1107498400 13:40951677-40951699 GAAACAGGGTTTCTCCATGTTGG - Intronic
1107963162 13:45576509-45576531 GCACTGGGGAAGCTCCTTGTGGG + Intronic
1108189161 13:47919508-47919530 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1109577660 13:64283245-64283267 GAAGCAGGGTTTCTCCATGTTGG - Intergenic
1110003104 13:70231075-70231097 GAGCCAGGGTTTCTCCATGTTGG + Intergenic
1110516222 13:76415783-76415805 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1111214393 13:85123670-85123692 GCAGCAGGGAAGCTCGATCTGGG + Intergenic
1111523455 13:89435071-89435093 GAGACAGGGATTCTCCATGTTGG + Intergenic
1112429440 13:99337737-99337759 GAACCAAGGAGGGTCCATGTGGG - Intronic
1112695509 13:101943785-101943807 GAGACAGGGATTCTCCATGTTGG - Intronic
1113236212 13:108277989-108278011 GAACCAGAGAACCTCCATCTTGG - Intronic
1113309103 13:109112567-109112589 GAAACAGGGTTTCTCCATGTTGG - Intronic
1113832651 13:113308509-113308531 GAGACAGGGATTCTCCATGTTGG + Intronic
1114223375 14:20716794-20716816 AAACAAGGGAAGCTCCTTATGGG - Intergenic
1115089083 14:29552066-29552088 AAACCATGGACACTCCATGTTGG + Intergenic
1115868254 14:37772331-37772353 GCAGCAGGGAAGCTCCAACTGGG - Intronic
1116339087 14:43699120-43699142 GCAGCAGGGAAGCTCCAACTGGG + Intergenic
1116520908 14:45845663-45845685 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1117392655 14:55276914-55276936 GAACCAGACAAACTCCATCTTGG - Intronic
1119242777 14:73075343-73075365 GAAACAGGGCTTCTCCATGTTGG + Intronic
1119378720 14:74215146-74215168 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1119836438 14:77754228-77754250 GAGACAGGGTTGCTCCATGTTGG + Intronic
1120487837 14:85137397-85137419 GAACCAGGTAAACACAATGTGGG - Intergenic
1120975868 14:90247793-90247815 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1121300898 14:92869871-92869893 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1121301094 14:92871665-92871687 GAAACAGGGGTTCTCCATGTTGG - Intergenic
1121989188 14:98538741-98538763 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1123142260 14:106091725-106091747 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1124387416 15:29222016-29222038 GAACCAGAGTAACTCCATCTTGG + Intronic
1126039425 15:44575954-44575976 GAAACAGGGTTTCTCCATGTTGG - Intronic
1126512524 15:49495834-49495856 GAGACAGGGATTCTCCATGTGGG - Intronic
1126651760 15:50930251-50930273 GAACCAGGGTTTCACCATGTTGG + Intronic
1127856870 15:62960553-62960575 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1128342686 15:66833753-66833775 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1129865116 15:78901380-78901402 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1129988222 15:79937316-79937338 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1130230956 15:82096525-82096547 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1131764813 15:95663995-95664017 GAGCCAGGGAAGCTATATGTAGG - Intergenic
1131929070 15:97418975-97418997 GCAGCAGGGAAGCTCCAACTGGG - Intergenic
1133253917 16:4504544-4504566 GAAACAGGGTTTCTCCATGTTGG + Intronic
1133396350 16:5450478-5450500 CAACCAGGGGAGCTGCGTGTGGG + Intergenic
1133414813 16:5598108-5598130 GATACAGGGAATCGCCATGTTGG - Intergenic
1134255894 16:12611162-12611184 GAACCAGAGCAACTCCATCTTGG + Intergenic
1134305240 16:13025989-13026011 GAAACAGGGTTTCTCCATGTTGG + Intronic
1134463872 16:14455796-14455818 GAACCAGGACAGCAACATGTAGG - Intronic
1134645174 16:15859319-15859341 AAACCAGGTAAGCTTGATGTTGG - Intergenic
1136296665 16:29307909-29307931 GAGCTGGGGCAGCTCCATGTGGG + Intergenic
1136319836 16:29476821-29476843 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1136434407 16:30216162-30216184 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1136748941 16:32615897-32615919 GAACTAGTGATGCTCCCTGTTGG - Intergenic
1137398823 16:48136388-48136410 GAAACAGAGATGCTCCATGGGGG - Intronic
1137601059 16:49756622-49756644 GACCCAGGGAAGCTTCAAGTTGG + Intronic
1137775935 16:51054352-51054374 GAGACAGGGTTGCTCCATGTTGG + Intergenic
1137966268 16:52936447-52936469 GAACCAGGGAAACTTCAGGTGGG - Intergenic
1139665808 16:68454657-68454679 GAGACAGGGAATCACCATGTTGG + Intergenic
1140015471 16:71178231-71178253 GAAACAGGGTTTCTCCATGTTGG - Intronic
1140079215 16:71728741-71728763 GAGACAGGGATTCTCCATGTTGG + Intergenic
1140234814 16:73148758-73148780 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1141106830 16:81241018-81241040 GAAACAGGGTATCTCCATGTTGG + Intronic
1142040352 16:87889585-87889607 GAAACAGGGTTTCTCCATGTTGG - Intronic
1203051074 16_KI270728v1_random:875111-875133 GAACTAGTGATGCTCCCTGTTGG - Intergenic
1142786272 17:2226087-2226109 GAAACAGGGTTTCTCCATGTTGG - Intronic
1142891483 17:2946939-2946961 GAAACAGGGTTTCTCCATGTTGG + Intronic
1142985702 17:3694390-3694412 GAAACAGGGTTTCTCCATGTTGG + Intronic
1143447420 17:7017688-7017710 GAGCCAGGGAAGCTGGGTGTGGG + Intergenic
1143567333 17:7731840-7731862 GAAACAGGGTTTCTCCATGTTGG - Intronic
1143569781 17:7749120-7749142 GAGACAGGGTATCTCCATGTTGG - Intronic
1143656653 17:8298309-8298331 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1144251236 17:13418765-13418787 GAATCAGGGTTTCTCCATGTTGG + Intergenic
1144525678 17:15987794-15987816 GAAACAGGGTTTCTCCATGTTGG + Intronic
1145746632 17:27324940-27324962 GAAGCTGGGAAACTCCACGTGGG + Intergenic
1146187526 17:30734312-30734334 GAGGCAGGGTATCTCCATGTTGG + Intergenic
1146820988 17:35983681-35983703 AAAGCAGGGAAGCTCCAAGAGGG + Exonic
1146990782 17:37270121-37270143 GACTCAGGAAAGCTCGATGTAGG - Intronic
1147027076 17:37595939-37595961 GAAACAGGGATTCACCATGTTGG + Intronic
1147037723 17:37694239-37694261 GAAACAGGGATTCACCATGTTGG - Intronic
1147209121 17:38861215-38861237 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1147601577 17:41749513-41749535 GAGACAGGGATTCTCCATGTTGG + Intergenic
1149299253 17:55288985-55289007 TAAGTAGAGAAGCTCCATGTTGG + Intronic
1149772084 17:59330686-59330708 AAACCAGGGAGGCACCAGGTGGG - Intergenic
1149914242 17:60593817-60593839 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1150685980 17:67321255-67321277 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1150795566 17:68234143-68234165 GAAACAGGGGTTCTCCATGTTGG - Intergenic
1151033449 17:70770512-70770534 TATCCAGGGAAGCGCCAGGTGGG - Intergenic
1151662916 17:75528550-75528572 GAGACAGGGTATCTCCATGTTGG - Intronic
1151943191 17:77305483-77305505 TAACCAGGGAGGCTTCATGGAGG - Intronic
1152151087 17:78601781-78601803 GAACCTGCGAAGGTCCAGGTCGG + Intergenic
1152761613 17:82110836-82110858 GAAACAGGGTTTCTCCATGTTGG - Intronic
1152872896 17:82767625-82767647 GAAACAGGGTTTCTCCATGTTGG + Intronic
1153064189 18:1026426-1026448 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1153782407 18:8505838-8505860 GAGACAGGGTTGCTCCATGTTGG - Intergenic
1154401562 18:14043235-14043257 GCAGCAGGGAAGCTCCAACTGGG - Intergenic
1154985104 18:21543342-21543364 GAAACAGGGTTTCTCCATGTTGG + Intronic
1156320453 18:36016407-36016429 GAAACAGGGTTTCTCCATGTTGG + Intronic
1158386258 18:56995717-56995739 GAAACAGGGAGGATCCCTGTGGG - Intronic
1158705100 18:59785369-59785391 GAGCCAGGGTTTCTCCATGTTGG - Intergenic
1158873324 18:61709805-61709827 GAACAAGGGAAGCTCAAAGGTGG + Intergenic
1160020655 18:75178143-75178165 GTACCAGGGAAGCTTCATTCAGG + Intergenic
1161518715 19:4711584-4711606 GAAGCAGGGTTTCTCCATGTTGG - Intronic
1161640459 19:5419371-5419393 GAACCAGGACAACTCCATCTTGG + Intergenic
1162429847 19:10621801-10621823 GAAACAGGGTTTCTCCATGTTGG + Intronic
1162704873 19:12547995-12548017 GAAACAGGGTTTCTCCATGTTGG + Intronic
1162712491 19:12606064-12606086 GAAACAGGGTTTCTCCATGTTGG + Intronic
1162881622 19:13663979-13664001 GAATCAGGGCAGCCCCATGCAGG - Intergenic
1163503475 19:17689432-17689454 CAAACTGGGCAGCTCCATGTGGG + Intergenic
1163692728 19:18746074-18746096 GAATCAGGGCAGCACCATCTGGG + Intronic
1163917813 19:20257905-20257927 GAACCAGACAAACTCCATCTTGG + Intergenic
1164035755 19:21453097-21453119 GAAACAGGGTTTCTCCATGTTGG - Intronic
1165377957 19:35456621-35456643 GAACCTGAGAATCACCATGTTGG - Intergenic
1165381062 19:35480688-35480710 GAGACAGGGTTGCTCCATGTGGG + Intergenic
1166206242 19:41271355-41271377 GAACCAGGGAAGCTCTCTTCAGG + Intronic
1166584931 19:43937395-43937417 GAGCCAGGGTTTCTCCATGTTGG + Intergenic
1166953455 19:46446016-46446038 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1167107261 19:47437603-47437625 GAACCAGGGAAGCTCCATGTTGG + Intronic
1167485542 19:49760900-49760922 GAAACAGGGTTTCTCCATGTTGG - Intronic
1167607964 19:50491571-50491593 GAAACAGGAAAGCCCCATGGAGG + Intergenic
1167836240 19:52073485-52073507 GAAACAGGGATTCACCATGTTGG + Intronic
1168284793 19:55325644-55325666 GAAACAGGGTTTCTCCATGTCGG + Intronic
1168674627 19:58268111-58268133 GAAACAGGGTTTCTCCATGTTGG - Intronic
925270164 2:2600335-2600357 GAAACAGGGAAGCTAAATGCAGG - Intergenic
927769739 2:25849249-25849271 GAGGCAGGGAATCTCCATGTTGG - Intronic
927789503 2:25999431-25999453 GAAACAGGGTTTCTCCATGTTGG + Intergenic
927795657 2:26046136-26046158 GAAACAGGGTTTCTCCATGTTGG - Intronic
928197068 2:29223597-29223619 GATCCAGGGAGGCTTCCTGTAGG - Intronic
928871958 2:35990696-35990718 GAGACAGGGTATCTCCATGTTGG + Intergenic
929476771 2:42258584-42258606 GAAACAGGGTTTCTCCATGTTGG + Intronic
930570513 2:53080029-53080051 GAAACAGGGTTACTCCATGTTGG - Intergenic
931143661 2:59491384-59491406 GAACCAGAGCAACTCCATCTTGG - Intergenic
931581635 2:63781729-63781751 GAACTAGGGAAGCTTCTTGGAGG + Intronic
931876216 2:66516235-66516257 GAAGCACGGGAGCTCCATGCAGG - Intronic
932825840 2:74939166-74939188 GAGACAGGGTATCTCCATGTTGG - Intergenic
933706570 2:85295385-85295407 GAAACAGGGTTTCTCCATGTTGG + Intronic
935442012 2:103109967-103109989 GAAACAGGGATTCACCATGTTGG + Intergenic
935717498 2:105952181-105952203 GACCCAGGGATCCTCCCTGTGGG - Intergenic
936139526 2:109927411-109927433 GAAACAGGGTTTCTCCATGTTGG - Intergenic
936205170 2:110444075-110444097 GAAACAGGGTTTCTCCATGTTGG + Intronic
936437333 2:112519942-112519964 GAAACAGGGTTTCTCCATGTTGG - Intronic
936462927 2:112725174-112725196 GACTCAGGAAAGCTCCACGTGGG + Exonic
937414435 2:121703158-121703180 GAAACAGGGTTTCTCCATGTTGG + Intergenic
939252224 2:139696615-139696637 GAGCCAGGGTTTCTCCATGTTGG - Intergenic
940382588 2:153033004-153033026 GTACCAGGGAGGCTGCATCTGGG + Intergenic
940855311 2:158724695-158724717 GCACCAGGCAGTCTCCATGTGGG + Intergenic
942160854 2:173185053-173185075 GAAACAGGGTTTCTCCATGTTGG - Intronic
945113150 2:206383348-206383370 GAGCCAGGGTTTCTCCATGTTGG + Intergenic
945161846 2:206899866-206899888 GCAGCAGGGAAGCTCTATCTGGG - Intergenic
947841352 2:233209745-233209767 GAACCAGGGAAGGTAGCTGTGGG - Intergenic
948451652 2:238078877-238078899 GAAACAGGGTTTCTCCATGTTGG + Intronic
1169056227 20:2623896-2623918 GCCCAAAGGAAGCTCCATGTTGG + Intronic
1170135681 20:13070985-13071007 GAATCAAGGAAGCTTTATGTGGG - Intronic
1172366618 20:34354920-34354942 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1172895611 20:38298094-38298116 TAACCTGGAAGGCTCCATGTAGG + Intronic
1172922992 20:38502789-38502811 GAGTCAGGGATTCTCCATGTTGG + Intronic
1173330623 20:42073518-42073540 GAACCAGTGAAGGTCCAAGTAGG - Exonic
1174061272 20:47834653-47834675 GACCCAGGGAGGAGCCATGTTGG - Intergenic
1174070504 20:47896046-47896068 GACCCAGGGAGGAGCCATGTTGG + Intergenic
1175093579 20:56524141-56524163 GAGACAGGGTATCTCCATGTTGG - Intronic
1175421126 20:58834424-58834446 GAACCAGACAAGCTCAGTGTAGG + Intergenic
1175534132 20:59695917-59695939 GATCCAGGGTTTCTCCATGTTGG + Intronic
1175823348 20:61923730-61923752 GAACCTGGGAAGCTGCAGGCAGG - Intronic
1178879513 21:36437678-36437700 GAACCAGGGTTTCGCCATGTTGG - Intergenic
1179279811 21:39924905-39924927 GAACAAGAGAAGCTCCAGGCGGG - Intronic
1179649395 21:42797192-42797214 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1181378166 22:22477042-22477064 GAGACAGGGTATCTCCATGTTGG - Intergenic
1182258624 22:29056285-29056307 GAGACAGGGTATCTCCATGTTGG + Exonic
1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG + Intronic
1182541585 22:31045837-31045859 GAACCAGGAAAGCTTTAGGTGGG - Intergenic
1182589200 22:31365743-31365765 GAATCAGGGTTTCTCCATGTTGG - Intergenic
1182625514 22:31642914-31642936 GAGACGGGGATGCTCCATGTTGG - Intronic
1182633035 22:31702405-31702427 GAAACAGGGTTTCTCCATGTTGG + Intronic
1182688592 22:32140233-32140255 GAACCAGACAAACTCCATCTTGG - Intergenic
1182846994 22:33439504-33439526 GAGAGAGGGAAGCTCCATGGAGG - Intronic
1182959435 22:34458272-34458294 GAAACAGGGTTGCTTCATGTTGG + Intergenic
1183208491 22:36435280-36435302 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1184951823 22:47848552-47848574 AATCCAGGCAGGCTCCATGTAGG - Intergenic
1185136102 22:49073510-49073532 GGACCAGGGGAGCTTCAGGTGGG + Intergenic
949184705 3:1176229-1176251 GAAACAGGGTTTCTCCATGTTGG - Intronic
951653695 3:24981426-24981448 GAGGCAGGGAAGCTCCAACTGGG - Intergenic
952315975 3:32232584-32232606 GAACCAGGGAAGTTTCAGATTGG - Intergenic
952552763 3:34497843-34497865 GAAACAGGGTTTCTCCATGTTGG - Intergenic
953366940 3:42353143-42353165 GAACCAGGGAATTACCATCTGGG - Intergenic
953580139 3:44146210-44146232 GTACCAGAGAAGGTCCATGGAGG + Intergenic
953585904 3:44200756-44200778 GAACCATGGAAGCTGTTTGTTGG + Intergenic
953747863 3:45588742-45588764 GAGCTAGGGATTCTCCATGTTGG - Intronic
954071894 3:48149146-48149168 GAGACAGGGATTCTCCATGTTGG + Intergenic
954181693 3:48886336-48886358 GAAACAGGGTTTCTCCATGTTGG - Intronic
954260938 3:49438369-49438391 GATACAGGGATTCTCCATGTTGG + Intergenic
954660662 3:52225156-52225178 GAGCCAGGGTTTCTCCATGTTGG - Intronic
954769094 3:52949763-52949785 GAAACAGGGTTTCTCCATGTTGG + Intronic
954917087 3:54157601-54157623 GAGACAGGGATTCTCCATGTTGG - Intronic
955256447 3:57337471-57337493 GAAACAGGGTTTCTCCATGTTGG - Intronic
955691194 3:61592151-61592173 GAAACAGGGTTTCTCCATGTTGG + Intronic
955731790 3:61995273-61995295 GAAACAGGGTTTCTCCATGTTGG + Intronic
956169722 3:66423383-66423405 GAGACAGGGTTGCTCCATGTTGG - Intronic
956437237 3:69246021-69246043 GAAACAGGGTTTCTCCATGTTGG + Intronic
957287973 3:78241399-78241421 GAAACAGGGTTTCTCCATGTTGG + Intergenic
958913034 3:100016375-100016397 GAGGCAGGGTATCTCCATGTTGG + Intronic
962914076 3:139883095-139883117 CAGCCAGGGAAGCTCGAAGTGGG - Intergenic
963091310 3:141486657-141486679 CAATCAGGGAAACTCCCTGTGGG - Intergenic
964035126 3:152186669-152186691 GAAACAGGGTTTCTCCATGTTGG + Intergenic
964960064 3:162411397-162411419 GCAGCAGGGAAGCTCCAACTGGG - Intergenic
965021489 3:163237413-163237435 GCAGCAGGGAAGCTCCAACTGGG + Intergenic
965103722 3:164334410-164334432 GAACCAGACAAACTCCATCTTGG - Intergenic
965104738 3:164341815-164341837 GAACCAGACAAACTCCATCTTGG - Intergenic
966189163 3:177256109-177256131 GAAACAGGGTTTCTCCATGTTGG + Intergenic
966631796 3:182084343-182084365 GAAACAGGGTTTCTCCATGTTGG - Intergenic
967628275 3:191711627-191711649 GAACCAGACAAACTCCATCTTGG - Intergenic
967693841 3:192507941-192507963 GAACCAGTGAATCGCCATGTTGG - Intronic
967732957 3:192923051-192923073 GAGACAGGGAATCACCATGTTGG + Intergenic
967916220 3:194580195-194580217 GAAACAGGGTTTCTCCATGTTGG + Intergenic
968994939 4:3939358-3939380 GAAACAGGGATTCACCATGTTGG + Intergenic
969097938 4:4748127-4748149 GAGCCAGGGAAGTGCAATGTTGG + Intergenic
969916633 4:10498007-10498029 GAGACAGGGTTGCTCCATGTTGG - Intronic
971887946 4:32476971-32476993 GAACCAGGGTTTCTCCATGTTGG - Intergenic
972017848 4:34268564-34268586 GAAACAGGGTTTCTCCATGTTGG - Intergenic
972667547 4:41181757-41181779 GAGACAGGGTTGCTCCATGTTGG - Intronic
973300216 4:48573735-48573757 GAAACAGGGTTTCTCCATGTTGG + Intronic
974201876 4:58653338-58653360 GAACCAGTGAAGTTTCAAGTAGG - Intergenic
974290168 4:59919588-59919610 GAACCAGGTAAGGTCCATTATGG - Intergenic
974406386 4:61476517-61476539 GAGCCAGGGTTTCTCCATGTTGG - Intronic
974748737 4:66109626-66109648 GAAACGGGGTAGCACCATGTTGG + Intergenic
975140736 4:70915829-70915851 GAAGCAGGGTAGCTCCTTGATGG + Intronic
975187346 4:71419347-71419369 GCAGCAGGGAAGCTCCAACTGGG - Intronic
978234423 4:106441148-106441170 GAAACAGGGTTTCTCCATGTTGG - Intergenic
978301456 4:107272954-107272976 GAACCAGGGTAGCATCATGGAGG - Intronic
978432135 4:108643790-108643812 GAAACAGGGTTTCTCCATGTTGG + Intergenic
980942167 4:139285046-139285068 GAAACAGGGTTTCTCCATGTTGG + Intronic
982702190 4:158670207-158670229 GAAACAGGGTTTCTCCATGTTGG + Intronic
983822505 4:172212855-172212877 GAAACAGGGTTTCTCCATGTTGG + Intronic
984419181 4:179497581-179497603 GAAACAGGGTTTCTCCATGTTGG - Intergenic
984493678 4:180468712-180468734 GGACCTGGGAAGCTCCAGCTTGG + Intergenic
986568788 5:9143983-9144005 GAACCATGGAAGGTTTATGTTGG - Intronic
986787301 5:11126113-11126135 GAGACAGGGATTCTCCATGTTGG - Intronic
989155999 5:38345527-38345549 GAACCAGGCAAACACCAAGTAGG + Intronic
990422515 5:55650975-55650997 GAGACAGGGTTGCTCCATGTTGG + Intronic
991065493 5:62420100-62420122 GAAACAGGGTATCACCATGTTGG - Intronic
991363507 5:65844720-65844742 GAACCAGAGCAACTCCATCTTGG - Intronic
992080010 5:73227632-73227654 GCACCAGGGAAAGGCCATGTGGG + Intergenic
992148758 5:73880079-73880101 GCAGCGGGGAAGCTCCAAGTGGG - Intronic
993886508 5:93421615-93421637 GCACCAGGGAGGATCCATGATGG + Intergenic
994364330 5:98895005-98895027 GAGACAGGGTATCTCCATGTTGG + Intronic
994618156 5:102131834-102131856 GCAGCAGGGAAGCTCCAACTGGG + Intergenic
994623437 5:102189959-102189981 GCAGCAGGGAAGCTCCAACTGGG + Intergenic
994662626 5:102671705-102671727 GCAGCAGGGAAGCTCCAACTGGG + Intergenic
995384470 5:111573610-111573632 GAACCAGAAATGCTCCATATGGG + Intergenic
996461031 5:123743204-123743226 GAAACAGGGATTCACCATGTTGG - Intergenic
997133713 5:131302363-131302385 GAAACAGGGTTTCTCCATGTTGG + Intronic
997557109 5:134809820-134809842 GAAACAGGGTTTCTCCATGTTGG - Intronic
997799004 5:136841079-136841101 GGAGCTGGGGAGCTCCATGTGGG + Intergenic
998019685 5:138758987-138759009 GAGACAGGGATTCTCCATGTTGG + Intronic
998084764 5:139310982-139311004 GAGCCAGGGTTTCTCCATGTTGG + Intronic
999204530 5:149838577-149838599 AGACCAGGGAAGCTCCAGCTTGG - Intronic
1000806963 5:165807066-165807088 GAAACAGGGTATCGCCATGTTGG + Intergenic
1001182653 5:169534900-169534922 GAATCAGGGAGGCTGCATGCGGG + Intergenic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1001857896 5:175028679-175028701 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1001953160 5:175830196-175830218 GAACCAGGGCAGCTCTGTGGCGG - Intronic
1002209581 5:177589396-177589418 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1002414613 5:179113280-179113302 GAACCAAGTCAGCTCCAGGTGGG + Exonic
1002851990 6:1004323-1004345 GAGCCAGGGAGGCTCCAGGTAGG + Intergenic
1004012494 6:11702922-11702944 GAGCCAGGGAGGCACCTTGTGGG - Intergenic
1004075009 6:12337173-12337195 GAGACAGGGTATCTCCATGTTGG + Intergenic
1004392225 6:15219403-15219425 GAGACAGGGTATCTCCATGTTGG - Intergenic
1004643612 6:17539080-17539102 GAACCATGGCAGCTCCAGCTTGG - Intronic
1005105493 6:22220495-22220517 GAAGCAGGGATGCTCCGTCTAGG - Intergenic
1005411340 6:25550668-25550690 GAACCAAGCAAGCTTCATGCTGG - Intronic
1005647976 6:27860113-27860135 GAAACAGGGCTTCTCCATGTTGG - Intronic
1005830274 6:29665280-29665302 GAAACAGGGTTTCTCCATGTTGG + Intronic
1006019256 6:31108016-31108038 GAGACAGGGTAGCACCATGTTGG + Intergenic
1006871013 6:37252077-37252099 GAGCCAGGGTTTCTCCATGTTGG + Intronic
1007156718 6:39752358-39752380 GAGGCAGGGTAGCTCCATGATGG - Intergenic
1007365526 6:41389251-41389273 GAACCAGGGAAGCTCCAAAATGG + Intergenic
1007593004 6:43034680-43034702 GAGACAGGGTTGCTCCATGTTGG - Intergenic
1007951923 6:45880214-45880236 GCACCAGGGAGGCTGCCTGTGGG + Intergenic
1008171613 6:48214413-48214435 GAACCAGGGAACCTCCCTCATGG - Intergenic
1008180101 6:48317828-48317850 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1008913525 6:56762206-56762228 GAAACAGGGTTTCTCCATGTTGG + Intronic
1010807799 6:80259431-80259453 TAACCAGGAAACCTCCATGAGGG - Intronic
1011355879 6:86473102-86473124 GAACCAGACAAACTCCATCTTGG + Intergenic
1011356980 6:86481212-86481234 GAACCAGACAAACTCCATCTTGG + Intergenic
1011473733 6:87732879-87732901 GAGACAGGGATTCTCCATGTTGG - Intergenic
1013000962 6:106021804-106021826 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1014553033 6:122810717-122810739 GAACAAAGGAAGCCCAATGTTGG + Intergenic
1016413993 6:143814167-143814189 GAGACAGGGATTCTCCATGTTGG - Intronic
1016464304 6:144310348-144310370 GAGACAGGGTTGCTCCATGTTGG - Intronic
1016691541 6:146943463-146943485 CAACCTGGGAAGCTCAAGGTAGG - Intergenic
1016745202 6:147572051-147572073 GAACGAGGGAAGCACCAAGTGGG - Intronic
1016884028 6:148941616-148941638 AAACCAGGGAATATCCATGAAGG + Intronic
1016887506 6:148971659-148971681 GAACCAGGGAAGCTGCAGCAGGG + Intronic
1016902635 6:149117428-149117450 TTCCCAGGGAAGCTCCAGGTTGG - Intergenic
1018438275 6:163782904-163782926 GAACCAGGGCAGCAGCAGGTGGG + Intergenic
1018714939 6:166524894-166524916 GTATCAGGGATTCTCCATGTTGG + Intronic
1018829382 6:167431315-167431337 GAAACAGGGTTTCTCCATGTCGG + Intergenic
1020719577 7:11724320-11724342 AAGCCAGGGTAGCTCCATTTTGG + Intronic
1022686680 7:32603661-32603683 GAACCAGACAAACTCCATTTTGG - Intergenic
1022735742 7:33074238-33074260 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1024239201 7:47421025-47421047 GACCCTGGGAGGCCCCATGTGGG - Intronic
1024791241 7:52967074-52967096 GAAGCAGGGTTTCTCCATGTTGG - Intergenic
1026965796 7:74439135-74439157 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1027957452 7:84899191-84899213 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1029165386 7:98585711-98585733 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1030184725 7:106750486-106750508 GAGACAGGGATTCTCCATGTTGG + Intergenic
1030192716 7:106825482-106825504 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1030939796 7:115631870-115631892 GACTCAGAGAAGCTCCATGTAGG - Intergenic
1031096551 7:117427463-117427485 CAGCCAAGGAAGCTCCCTGTCGG + Exonic
1032213947 7:129942021-129942043 GAAACAGGGTTGCGCCATGTTGG - Intronic
1032263957 7:130357433-130357455 GAAACAGGGTTTCTCCATGTTGG - Intronic
1032289718 7:130577962-130577984 GCAGCAGGGAAGCTCCAACTGGG + Intronic
1032613359 7:133440479-133440501 GAACCAGAGCAACTCCATCTTGG + Intronic
1034443656 7:151100982-151101004 GAACCAGCTGAGCTCCATGGGGG - Intronic
1036643887 8:10600522-10600544 TCACCACGGAAGCTCCTTGTTGG - Intergenic
1036990226 8:13584220-13584242 CAAACAGGGAAGCTGCAGGTTGG - Intergenic
1037376310 8:18233734-18233756 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1038599456 8:28924796-28924818 GAAACAGGGTTTCTCCATGTTGG + Intronic
1038796759 8:30717049-30717071 GAAACAGGGTTTCTCCATGTTGG - Intronic
1039985280 8:42442117-42442139 GAAACAGGGTTTCTCCATGTTGG + Intronic
1040031995 8:42833158-42833180 GAACCAGACAAACTCCATCTTGG - Intergenic
1040384298 8:46903283-46903305 GACCCAGGGCAGTTCCTTGTAGG + Intergenic
1040444670 8:47481560-47481582 GAACCTGGGAGGCTCCATCAGGG + Intronic
1041549269 8:59081211-59081233 GAAACAGGGTTTCTCCATGTTGG + Intronic
1041885301 8:62801105-62801127 GAAGCCGGGAAGCTCCAACTGGG + Intronic
1042082891 8:65075203-65075225 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1042514457 8:69644871-69644893 GAACCCAGGAAGCTCCATTAGGG - Intronic
1042541102 8:69907719-69907741 CAGCCAGGGAAGCTCCAACTGGG + Intergenic
1043969354 8:86513186-86513208 GAGCCAGGGCTTCTCCATGTTGG - Intronic
1044227520 8:89736373-89736395 GAACCAGACAAACTCCATCTTGG + Intergenic
1044310547 8:90687431-90687453 GAGGCAGGGAAGCTCCTTGATGG - Intronic
1044432315 8:92122855-92122877 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1044463712 8:92479533-92479555 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1045017838 8:98014158-98014180 GCACAAGGGAAGCTCCAGGAAGG + Intronic
1045288887 8:100814952-100814974 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1046262723 8:111790880-111790902 GTACCAGGTCAGCTCCATTTGGG - Intergenic
1046755830 8:117971962-117971984 GAAACAGGGTTTCTCCATGTTGG - Intronic
1047604710 8:126463615-126463637 GTAACAGGGAAGCTGCATGTAGG + Intergenic
1048327521 8:133450832-133450854 GAAACAGGGAAGGGCCATGAGGG - Intergenic
1048414696 8:134213125-134213147 GAGCCAGGGAAAGTCAATGTAGG + Intergenic
1048580708 8:135728098-135728120 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1049001102 8:139826114-139826136 GAACCAACGAGGCTCCAGGTTGG - Intronic
1050446460 9:5728191-5728213 GTGGCAGGGAAGCTCCAAGTGGG - Intronic
1050539173 9:6655472-6655494 GAAACAGGGCTTCTCCATGTTGG + Intergenic
1050742835 9:8842162-8842184 GAACCTGTGACGCTCCCTGTAGG + Intronic
1051251622 9:15165158-15165180 GAGACAGGGTATCTCCATGTTGG - Exonic
1053233053 9:36427894-36427916 GAGACAGGGTATCTCCATGTTGG + Intronic
1053240632 9:36492022-36492044 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1055825194 9:80314960-80314982 GAAACAGGGTTGCACCATGTTGG + Intergenic
1055977945 9:81972732-81972754 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1056810908 9:89763242-89763264 CTACCAGGGAAGCTAAATGTGGG + Intergenic
1057191712 9:93092027-93092049 GTAACAGGGAAGCTCCATGGGGG + Intergenic
1057739598 9:97700011-97700033 GAACCAGACAAACTCCATCTTGG - Intergenic
1060271141 9:122142783-122142805 GAACCTAGGAAGCAACATGTGGG + Intergenic
1060613493 9:124989986-124990008 GAAACAGGGTTTCTCCATGTTGG - Intronic
1061278236 9:129581789-129581811 GTACCATGGAAGCCCCATGAAGG - Intergenic
1061710501 9:132484122-132484144 GAGACAGGGATTCTCCATGTTGG + Intronic
1061780388 9:132992650-132992672 GACCCAGGGAGGCTTCATGGAGG - Intergenic
1061843516 9:133374364-133374386 GAAACAGGGTTTCTCCATGTTGG - Intronic
1062336512 9:136072663-136072685 GAAACAGGGTTTCTCCATGTTGG - Intronic
1185989151 X:4873469-4873491 GAGACAGGGATTCTCCATGTTGG + Intergenic
1187377966 X:18774273-18774295 GAAACAGGGTTTCTCCATGTTGG + Intronic
1187463515 X:19508356-19508378 GAACCAGGGTTTCGCCATGTTGG + Intronic
1187877498 X:23816358-23816380 GAAGCAGTGAAACTCCCTGTGGG - Intergenic
1188135412 X:26488519-26488541 TAGCCAGGGAAGCTTCATGCCGG + Intergenic
1189095715 X:38136933-38136955 TGAACTGGGAAGCTCCATGTTGG - Intronic
1189694267 X:43647602-43647624 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1190238964 X:48641839-48641861 GAGACAGGGATTCTCCATGTTGG - Intergenic
1190839563 X:54131622-54131644 GAAACAGGGTTTCTCCATGTTGG + Intronic
1191892337 X:65956822-65956844 GAACCAGGGAACCTCCCTCACGG - Intergenic
1192039829 X:67607213-67607235 GAAACAGGGTTTCTCCATGTTGG + Intronic
1193345605 X:80400094-80400116 GAACCAGGGAAGCTAGCTGATGG + Intronic
1195592499 X:106646599-106646621 GATCAAGGGAAGCTTCTTGTAGG + Intronic
1195951633 X:110281259-110281281 GAACCAGGGAGTCTGCAAGTTGG - Intronic
1196100721 X:111844649-111844671 GAAACAGGGTTTCTCCATGTTGG + Intronic
1196544541 X:116946800-116946822 GCAGCAGGGAAGCTCCAGCTGGG - Intergenic
1196546545 X:116970336-116970358 GCAGCAGGGAAGCTCCAACTGGG - Intergenic
1197212257 X:123837796-123837818 GAGACAGGGTATCTCCATGTTGG - Intergenic
1197234144 X:124040023-124040045 GAATCAGGCAATCTCCATGAAGG + Intronic
1197780792 X:130158074-130158096 GAAACAGGGTTTCTCCATGTTGG - Intronic
1198031490 X:132757568-132757590 AAACGAGGGGAGCTCCAAGTGGG + Intronic
1199627074 X:149750628-149750650 AACCCAGGGAAGCCCCAGGTTGG + Intergenic
1199799978 X:151240819-151240841 GAAACAGGGTTTCTCCATGTTGG - Intergenic
1200408614 Y:2840051-2840073 GAAACAGGGTTTCTCCATGTTGG + Intergenic
1200757334 Y:7002195-7002217 ATACCAGGCAAGCTCCATGAGGG - Intronic