ID: 1167110330

View in Genome Browser
Species Human (GRCh38)
Location 19:47456963-47456985
Sequence GTGGACTACCGCACTGAGGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167110330_1167110337 18 Left 1167110330 19:47456963-47456985 CCGTCCTCAGTGCGGTAGTCCAC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1167110337 19:47457004-47457026 CTCGCCGCCCTGGCACGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1167110330_1167110341 30 Left 1167110330 19:47456963-47456985 CCGTCCTCAGTGCGGTAGTCCAC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1167110341 19:47457016-47457038 GCACGTGACGGACAGCAGCACGG 0: 1
1: 0
2: 0
3: 8
4: 92
1167110330_1167110334 8 Left 1167110330 19:47456963-47456985 CCGTCCTCAGTGCGGTAGTCCAC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167110330 Original CRISPR GTGGACTACCGCACTGAGGA CGG (reversed) Exonic
900176807 1:1294717-1294739 GTGGACAGCGTCACTGAGGAGGG - Exonic
916635285 1:166661725-166661747 GTGGCCAACCACACTGAGGGTGG - Intergenic
918235289 1:182574454-182574476 GTGGACCACCCCACAGAGGAGGG - Exonic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
1068018975 10:51556709-51556731 GGGAACTACCAGACTGAGGAAGG + Intronic
1073009425 10:100347938-100347960 GTGAACTACGGCGCTGCGGAAGG + Intronic
1074079840 10:110158754-110158776 GTGGAATGCAGCACTGAGCAGGG + Intergenic
1076294545 10:129374408-129374430 CTTGACTACCCCACTCAGGATGG - Intergenic
1078066888 11:8084562-8084584 GAGGACAAGGGCACTGAGGACGG - Intronic
1078355334 11:10628301-10628323 GTGCCCTGCCGCACTGATGAGGG + Intronic
1089204598 11:116749471-116749493 GTTAACTACAGCACTGGGGATGG + Intronic
1090672030 11:128955027-128955049 GTGAAATACCGCACAGTGGAAGG - Intergenic
1096906431 12:54941079-54941101 GTGGAATACGGCAGTGGGGACGG - Intergenic
1113355225 13:109572662-109572684 GTGGAATACAGCATTCAGGAGGG + Intergenic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1118046793 14:61978768-61978790 GTGGACTAAAGCAGTGAGGGAGG - Intergenic
1118922998 14:70167110-70167132 GTGGACTACAAAACAGAGGATGG - Exonic
1121888796 14:97570268-97570290 GTGGAATCTCGCACAGAGGAGGG - Intergenic
1123881530 15:24680680-24680702 GTGGTCTTCTGCACTGTGGAGGG + Exonic
1126217433 15:46172399-46172421 GTGGCCTAGAGGACTGAGGAAGG + Intergenic
1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG + Intronic
1136104503 16:28020010-28020032 TTGGACTAAAGCACTGAAGATGG + Intronic
1137595050 16:49717941-49717963 CTGGACTACCCCACAGAGGGAGG + Intronic
1152563316 17:81089394-81089416 GTGGACCACAGCACTGAGGCAGG - Intronic
1160016073 18:75141704-75141726 GTGGCCTGGAGCACTGAGGAAGG - Intergenic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168185102 19:54695538-54695560 GTGGATTAAGGCACAGAGGAAGG + Intronic
926782631 2:16488272-16488294 GTGGAGGTCCGCACTGAGGAAGG + Intergenic
935411859 2:102772415-102772437 GGGGACTTCCACACTGAGTAGGG + Intronic
936104903 2:109615068-109615090 GGGGGCTACCGCACAGAGGCCGG + Exonic
946337301 2:219046617-219046639 GCTGACTTCCACACTGAGGAAGG - Intergenic
1171178557 20:23074374-23074396 GTGGCCTTCCACACTTAGGATGG - Intergenic
1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG + Intronic
1177479395 21:21667465-21667487 GTGGACTACTACAGTGGGGATGG + Intergenic
1179165184 21:38929956-38929978 ATGGACTAAGGCACTGATGAAGG + Intergenic
1180116649 21:45710733-45710755 GTGCTCTGCCTCACTGAGGATGG + Intronic
1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG + Intronic
1183292489 22:37011259-37011281 ATGGACTTCCTGACTGAGGATGG - Exonic
955805667 3:62731456-62731478 GTGGACTACCTCAGTTTGGAAGG - Intronic
956706782 3:72005931-72005953 GTAGACTAGTTCACTGAGGAGGG + Intergenic
962628155 3:137248255-137248277 GTGGACCAGCACAGTGAGGAAGG - Intergenic
965816433 3:172641505-172641527 GTGGATTATGGCACTGGGGAAGG - Intronic
967986783 3:195101086-195101108 GTGGATTACAGCAGTGAGGCTGG - Intronic
978628435 4:110714679-110714701 GTGGACTACTAAAGTGAGGAGGG + Intergenic
984526967 4:180868705-180868727 GTGGACCATCGCATTGAAGAAGG - Intergenic
992194212 5:74323985-74324007 GTGGACTGCAGTACAGAGGAAGG - Intergenic
996436463 5:123438530-123438552 GTTGACTGCCGTACTGAGAATGG + Intergenic
1001752973 5:174145583-174145605 GTGGACTAGGGAACTGAGCAAGG + Intronic
1006189159 6:32197023-32197045 GTGGACGCTCGCACAGAGGACGG - Exonic
1006981923 6:38154180-38154202 GGGGGCTGCCTCACTGAGGATGG - Exonic
1023038836 7:36154808-36154830 GTGGACTTCCGCCGTGAGCATGG + Exonic
1026328642 7:69333100-69333122 AAGGACTACCGTAATGAGGACGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1039749625 8:40465112-40465134 GTTTACTTCCTCACTGAGGAAGG - Intergenic
1061492916 9:130956195-130956217 GTGGCCGCCCCCACTGAGGAGGG + Intergenic
1203761551 EBV:14966-14988 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203762480 EBV:18038-18060 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203763409 EBV:21110-21132 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203764338 EBV:24182-24204 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203765267 EBV:27254-27276 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203766196 EBV:30326-30348 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1203767125 EBV:33398-33420 GGGGACTAGGGAACTGAGGAGGG - Intergenic
1186408879 X:9328439-9328461 ATGGACTACCTCAATAAGGAAGG + Intergenic
1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG + Intergenic
1188889504 X:35592852-35592874 GTGGACTACCAGAGTGGGGAAGG - Intergenic
1190341890 X:49303618-49303640 GTGGACATGCGCACTGAGGCGGG - Intergenic
1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG + Intergenic