ID: 1167110334

View in Genome Browser
Species Human (GRCh38)
Location 19:47456994-47457016
Sequence TGCTGTTGCCCTCGCCGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167110331_1167110334 4 Left 1167110331 19:47456967-47456989 CCTCAGTGCGGTAGTCCACGTAG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 185
1167110328_1167110334 19 Left 1167110328 19:47456952-47456974 CCTTGGCAGAGCCGTCCTCAGTG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 185
1167110327_1167110334 22 Left 1167110327 19:47456949-47456971 CCGCCTTGGCAGAGCCGTCCTCA 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 185
1167110326_1167110334 23 Left 1167110326 19:47456948-47456970 CCCGCCTTGGCAGAGCCGTCCTC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 185
1167110330_1167110334 8 Left 1167110330 19:47456963-47456985 CCGTCCTCAGTGCGGTAGTCCAC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG 0: 1
1: 0
2: 1
3: 6
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167110334 Original CRISPR TGCTGTTGCCCTCGCCGCCC TGG Exonic
900153976 1:1196724-1196746 TACTGTGCCCCCCGCCGCCCAGG - Intronic
900390884 1:2433313-2433335 TGCTGGTGGCCTGGCCTCCCTGG + Intronic
900622386 1:3593400-3593422 TGCAGTTGCCTTCCCCGCCCGGG + Intronic
904484225 1:30814271-30814293 TGCTGTTGCCCTCACCTCCAAGG + Intergenic
907296940 1:53461387-53461409 CGCTGATGACCCCGCCGCCCTGG + Intronic
909556070 1:76955846-76955868 TGCTGTTTCCTTCCCTGCCCAGG - Intronic
913186291 1:116373315-116373337 CGCTGTTGCTGCCGCCGCCCGGG - Intronic
914490100 1:148146431-148146453 TTCTGCTGCCCTCCCTGCCCCGG + Intronic
917746842 1:178018257-178018279 TTCTGTTACCCTTGCCTCCCTGG - Intergenic
919824855 1:201496147-201496169 TGCTGTTGCCTTGGACACCCTGG - Intronic
920202062 1:204265809-204265831 TGCTCTGGCCCTCTCCTCCCTGG + Intronic
920303294 1:205002696-205002718 TGCTGATGCCCTCGTTGTCCCGG - Exonic
920420617 1:205830764-205830786 TGCTGTTCCCCATGACGCCCAGG + Intronic
920420631 1:205830828-205830850 TGCTGTTCCCCATGACGCCCAGG + Intronic
922587454 1:226745613-226745635 TGGTCTTGCCCTTGTCGCCCAGG + Intergenic
924776054 1:247114964-247114986 TGCTGGTGCCCTTACCGCCTGGG - Intergenic
1067696115 10:48536771-48536793 TTCTGTTGCCCTGGGCTCCCAGG + Intronic
1068504123 10:57877717-57877739 TGCTTTTATCCTCGCCGCACTGG - Intergenic
1069754032 10:70762293-70762315 CCCTGTTGCCCTCCCCTCCCTGG + Exonic
1071433537 10:85625566-85625588 TGCTGTTGTCCTGGCATCCCAGG - Intronic
1075592550 10:123703175-123703197 TGCTGGTGCCCTGCCAGCCCTGG + Intergenic
1076751229 10:132544381-132544403 TGCAGGTGCCCTCCCTGCCCCGG + Intronic
1076753840 10:132557793-132557815 GGCTATGGCCCTCCCCGCCCAGG - Intronic
1077190473 11:1254034-1254056 TGGTGGTGCCCTCGCTCCCCAGG - Intronic
1077408932 11:2394645-2394667 TGCTGCTGCACACGCCTCCCTGG + Intronic
1078265933 11:9756423-9756445 AGCTGTTGCCCTCCCAGCCTGGG + Intergenic
1078717645 11:13855083-13855105 AGCTGTTGCCCTGTACGCCCTGG + Intergenic
1080217193 11:29857690-29857712 TACTGTAGCCCCCGCCTCCCAGG - Intergenic
1080551314 11:33376131-33376153 TGCGGTAGCACTCGCGGCCCGGG + Intergenic
1081672868 11:44951118-44951140 TGGCGTGGCCCGCGCCGCCCAGG + Intronic
1082003947 11:47409570-47409592 TCCTGTTGCCCTCAGTGCCCTGG + Intronic
1085201670 11:74705777-74705799 TCCTGCTGCCCTCCCCACCCAGG - Intronic
1089127787 11:116189535-116189557 CTCTGTTCCCCTCGCTGCCCAGG - Intergenic
1091198117 11:133749075-133749097 TGCTGCTGCCTTCCCTGCCCTGG - Intergenic
1091675836 12:2488671-2488693 TGCTGTTGTCCTGGCCCCCTTGG - Intronic
1091927869 12:4370447-4370469 GGCTGTTGTCCTCGGCGCTCGGG + Exonic
1092105536 12:5919424-5919446 TGCTGTTGCCCTCTCTGCTTTGG - Intronic
1092105543 12:5919469-5919491 TGCTGTTGCCCTCTCTGCTTTGG - Intronic
1096848158 12:54419085-54419107 TGCTGCTGCCGCCGCCACCCAGG - Exonic
1097053678 12:56238041-56238063 TCCTGCTGCCCTCGGCACCCTGG + Exonic
1097781949 12:63716886-63716908 TGCTCTCGCTCTTGCCGCCCAGG - Intergenic
1098450091 12:70609980-70610002 TGCTGCTGCTCCTGCCGCCCCGG + Intronic
1100437700 12:94586842-94586864 TGCTGTTGCTTTCGCCAACCTGG - Intronic
1103308945 12:119989449-119989471 TGCTGCTGCCGCCGCCGGCCGGG - Intergenic
1103672855 12:122632412-122632434 TGCTGTTGCCCAGGCCACCTGGG - Intergenic
1105274502 13:18906714-18906736 TGCTGTTGCCCTCAATGCACCGG - Intergenic
1106087668 13:26557861-26557883 TGCTGTGGCCCTCTCGGCTCCGG + Intronic
1112091869 13:96091068-96091090 CCCAGTTGCCCCCGCCGCCCCGG + Exonic
1113424094 13:110193682-110193704 TGCTATTGCCCACTCTGCCCTGG + Intronic
1113627290 13:111856623-111856645 TGCTGCTGCCCTGGAGGCCCTGG + Intergenic
1114463293 14:22902043-22902065 TGCTGCTGCCGCCGCCGCCCAGG - Exonic
1114602825 14:23969981-23970003 TGCGGCAGCCCTCACCGCCCGGG + Intronic
1116757269 14:48963391-48963413 TTCTGTTGCCCTCTCTGACCAGG + Intergenic
1118177386 14:63455124-63455146 TGCTGTTGCCCTCCTCTCCAGGG - Intronic
1118705772 14:68478990-68479012 TCCTATTGCCCTTGCTGCCCGGG - Intronic
1119410639 14:74427904-74427926 TGCTGCTCCCCTCCCCACCCTGG + Intergenic
1119421180 14:74508896-74508918 TGTTCTTGCACTCGCCTCCCAGG + Exonic
1119456816 14:74763404-74763426 GGCTGTCGCCGTCGCCGCCGCGG + Exonic
1123424403 15:20157560-20157582 CGCTGTTGCCCAAGCCACCCAGG - Intergenic
1123506254 15:20942820-20942842 TGCTGTTGCCCTCAATGCACTGG - Intergenic
1123533625 15:21164091-21164113 CGCTGTTGCCCAAGCCACCCAGG - Intergenic
1123563480 15:21516524-21516546 TGCTGTTGCCCTCAATGCACTGG - Intergenic
1123599732 15:21953810-21953832 TGCTGTTGCCCTCAATGCACTGG - Intergenic
1129330322 15:74823777-74823799 TGCCTTTGCCCTCCCCTCCCAGG + Intronic
1129648095 15:77456602-77456624 CTCTGTTGCCCACGCCTCCCAGG - Intronic
1130003403 15:80068171-80068193 TGGTGTTGCCTTTGTCGCCCAGG + Intronic
1131867595 15:96728623-96728645 TCCTGTTGCCCACTCTGCCCTGG - Intergenic
1202971838 15_KI270727v1_random:243661-243683 TGCTGTTGCCCTCAATGCACTGG - Intergenic
1132518434 16:376626-376648 TGCTGCTGCCCTCACCGCCCTGG - Exonic
1132665234 16:1078457-1078479 TGCTGCTGCCCTCGTCTACCAGG - Intergenic
1132797470 16:1732276-1732298 GGCTTTTGCCATCGCAGCCCTGG - Intronic
1132872876 16:2123499-2123521 TGCTTTTGCCATCGCCGTTCTGG + Intronic
1134551966 16:15142678-15142700 TGCTTTTGCCATCGCCGTTCTGG + Intergenic
1136910588 16:34141539-34141561 TTCGGTTTCCCACGCCGCCCTGG + Intergenic
1142198162 16:88748356-88748378 TGCTGCTACCCTCGTCACCCAGG + Intronic
1142653882 17:1377019-1377041 TGCTCTTGCCCCAGCCTCCCTGG + Intronic
1143602536 17:7958125-7958147 TGGAGTTTCCCTCGTCGCCCAGG + Intergenic
1144207479 17:12989250-12989272 TGCTGCTGCAGCCGCCGCCCTGG - Intronic
1145694462 17:26775501-26775523 GGCTTTTGCCCCCGCCGCCGTGG + Intergenic
1147690382 17:42311395-42311417 TGCTGTTGCCCACGTTTCCCGGG + Exonic
1151317841 17:73334970-73334992 TGTTGCTGCCCACGCCTCCCTGG - Exonic
1151398892 17:73842904-73842926 TGGTGTGGCCCTCACAGCCCTGG + Intergenic
1151659594 17:75511878-75511900 TGCTGCTGGCCTCACCGCTCTGG - Intronic
1151945848 17:77319496-77319518 GGCAGTTGCCGTCCCCGCCCAGG - Intronic
1152903573 17:82958511-82958533 TGCTGCTGCCTCCGCCTCCCGGG + Intronic
1203192066 17_KI270729v1_random:199455-199477 TGCTTTTTCCCCCGCCGCCGCGG + Intergenic
1154241580 18:12658018-12658040 TCCTCTTGCCCACGCCTCCCGGG - Exonic
1157762631 18:50275643-50275665 TGCCTTCGCCCTCCCCGCCCTGG - Exonic
1157927308 18:51780417-51780439 TGCTGGTGCCCTGGCAGCCGCGG - Intergenic
1159152492 18:64538001-64538023 TGTCGTTGCCCTCGGCCCCCAGG - Intergenic
1160147910 18:76379335-76379357 TGCTGAAGCCCCCGCCACCCGGG + Exonic
1160814977 19:1030965-1030987 TGCTGTTGCCCTGGAGTCCCCGG + Intronic
1160991515 19:1862256-1862278 CCCGGTTCCCCTCGCCGCCCCGG + Intronic
1160993005 19:1868307-1868329 TGATGTTGACCTCGGCCCCCTGG - Intergenic
1161016356 19:1985637-1985659 TACTGTTGCCCTAGCCCACCTGG - Exonic
1161673264 19:5626278-5626300 TGCTGCCGCCCTCACCACCCAGG - Intronic
1161684075 19:5694552-5694574 TTGTGTTGCCCTGACCGCCCAGG - Exonic
1162675300 19:12294343-12294365 TGCTGCAGCCCTCGGCGTCCGGG + Intronic
1162832970 19:13298653-13298675 CGCCCTCGCCCTCGCCGCCCCGG + Exonic
1167106384 19:47432182-47432204 TGCTGTTGTCTTCGTTGCCCTGG - Exonic
1167110334 19:47456994-47457016 TGCTGTTGCCCTCGCCGCCCTGG + Exonic
925158307 2:1663680-1663702 TGGTGTTGCCCTCCACGACCAGG - Exonic
928717559 2:34079574-34079596 TACTGTTGCCATCACAGCCCAGG - Intergenic
929969561 2:46562266-46562288 AGCTGCTGCCCTCACTGCCCTGG + Intronic
934131692 2:88954920-88954942 TGCTGCTTCCCTCACAGCCCAGG - Intergenic
934458841 2:94199474-94199496 CGCTGTTGCCCAAGCCACCCAGG + Intergenic
938320763 2:130361611-130361633 TGCAGTTTCCCTCGTCACCCAGG + Intronic
942748719 2:179264623-179264645 CGCTGCTGCCGCCGCCGCCCGGG - Exonic
946191646 2:218010687-218010709 TGCTGCCGCCGCCGCCGCCCCGG - Intergenic
948428083 2:237901282-237901304 TGCTCTTACCCTCCCTGCCCCGG + Intronic
948729845 2:239955963-239955985 TGCTGTCGCCCCTGCCTCCCTGG - Intronic
949045962 2:241872782-241872804 TGCTGGTGGCCTCCCCTCCCAGG + Exonic
1171813184 20:29762069-29762091 TTCGGTTTCCCACGCCGCCCTGG - Intergenic
1174124665 20:48295047-48295069 TGCTGTAGCCCTCTGAGCCCTGG + Intergenic
1174467887 20:50731517-50731539 CGCTGTCGCCGTCGCCGCCGGGG + Intergenic
1175946667 20:62562182-62562204 TGCTGGAGCCCTCGGGGCCCGGG + Intronic
1176126058 20:63475361-63475383 CGCTGCTGCCCTGGCCGCCTGGG - Intergenic
1176275942 20:64269263-64269285 AGCTGGTGCCCTCCCCGCCAAGG - Intronic
1176582995 21:8549160-8549182 TCTTTTTGCCCCCGCCGCCCCGG + Intergenic
1179909377 21:44439827-44439849 TGCTCTTGCCTTGGCCTCCCAGG + Intronic
1179973319 21:44848499-44848521 TGTTTTTGCTCTCGTCGCCCAGG + Intergenic
1180265793 22:10526068-10526090 TCTTTTTGCCCCCGCCGCCCCGG + Intergenic
1180281289 22:10699036-10699058 TGATTTTGCCCCCGCCGCCGCGG + Intergenic
1181339614 22:22167116-22167138 TGCTGTCCCCCTCCCTGCCCTGG + Intergenic
1181357366 22:22306976-22306998 CGCTGTTGCCCAAGCCACCCAGG - Intergenic
951870062 3:27351837-27351859 TGCTGTTCCCCAAGCCTCCCTGG + Intronic
952796429 3:37243282-37243304 TGCCGTTGTCGTCGCCGCCGCGG + Exonic
953041664 3:39261042-39261064 TGCGGTTGCCAGCGCTGCCCCGG + Intergenic
953412863 3:42699906-42699928 TCCTGATGCCCTCGCTCCCCAGG - Intronic
954712999 3:52514183-52514205 TGCTGTTGCCCTGGGCCTCCAGG - Exonic
955359266 3:58258930-58258952 TGCTGTTGCCCTTGCAGTGCTGG + Intronic
955502276 3:59597384-59597406 TGCTCTTGCCCTTGCACCCCTGG - Intergenic
958641696 3:96814237-96814259 GGCTGCTGCCCACGCCGCTCAGG + Intergenic
959716139 3:109434857-109434879 TCCTCTTGCCCTAGCCTCCCAGG + Intergenic
961077039 3:123992043-123992065 CGCTGCTGCCCTCCCCGCCGAGG - Intronic
961307537 3:125969257-125969279 CGCTGCTGCCCTCCCCGCCGAGG + Exonic
961450864 3:127001735-127001757 TGCTGTGGGCCTGGCCACCCTGG + Intronic
961650742 3:128415623-128415645 TGATGCTGCCCTCGCCGCCGGGG + Intergenic
963026305 3:140922722-140922744 AGCTGCTGCCCTCCCCACCCTGG + Intergenic
964258959 3:154811827-154811849 AGCTGGTTCCCTCGCGGCCCAGG + Intergenic
967501206 3:190200173-190200195 TGCTGTTGCCCTTGTTGCCCAGG - Intergenic
967684910 3:192408300-192408322 TGCCCTTTCCCTGGCCGCCCAGG - Exonic
968648412 4:1750991-1751013 TGCTGCTCCCCACCCCGCCCCGG - Intergenic
968831199 4:2933780-2933802 TGCTGCTGCCCCTGCTGCCCGGG - Exonic
969405323 4:6987543-6987565 TGCTGATGCGCTCTCCTCCCTGG + Intronic
969651651 4:8471652-8471674 TCCTGTGGCCCTCGCCCCACGGG + Intronic
969858562 4:10018866-10018888 TCCTGTTGCGCTCGCGGCGCGGG - Intronic
969867710 4:10086381-10086403 TGCTGCTGCCCCCACTGCCCCGG + Intronic
972686868 4:41360645-41360667 AGCTGTTCCCGGCGCCGCCCGGG - Intronic
984928376 4:184826068-184826090 TGCTGGTGCGCTCGCCGCGCCGG + Intronic
985388248 4:189467352-189467374 TGGGGTTGCCATCGCCTCCCTGG + Intergenic
985431567 4:189886268-189886290 AGCTGGTGCCCTCGCCTCCTTGG - Intergenic
991496792 5:67234860-67234882 TGCTGTTCCCCTCCCCTGCCCGG + Intergenic
994072801 5:95620755-95620777 CGCGCGTGCCCTCGCCGCCCTGG + Exonic
994083339 5:95731595-95731617 TGCGGGTGAACTCGCCGCCCGGG + Exonic
997469235 5:134107576-134107598 TCCTGGTGCCCTCCCCACCCTGG + Intergenic
998095119 5:139392310-139392332 TGCTGCCGCCCTCGTCTCCCGGG - Exonic
999727299 5:154446897-154446919 CGCCGTGGGCCTCGCCGCCCCGG + Intronic
1002379193 5:178813410-178813432 TGCTGCTGCCCTCACTGCCTGGG + Intergenic
1005583193 6:27251977-27251999 TGCGGTTGCCCCCGCCCCCGAGG - Exonic
1005927050 6:30452843-30452865 TGAGGCTGCACTCGCCGCCCTGG - Intergenic
1006359895 6:33581490-33581512 TGCTGTTGCCCAGGCTGGCCTGG - Intergenic
1006582225 6:35083719-35083741 TGCTGTTAGCCTCGCCACCTGGG + Intronic
1007607363 6:43126610-43126632 TGCTCTTCCCATCCCCGCCCAGG - Intronic
1008572546 6:52829437-52829459 TGCTGTGCCCCTCACTGCCCAGG + Intergenic
1009615498 6:65999609-65999631 TGCTAATCCCCTCGCCGCCTGGG + Intergenic
1013395047 6:109727362-109727384 TGCTGTAGCCTTGGCCTCCCAGG + Intronic
1015162440 6:130168407-130168429 TGGTGTTTCACTCGTCGCCCAGG - Intronic
1016591532 6:145750565-145750587 TGCTTTTATCCTAGCCGCCCTGG - Intergenic
1017672312 6:156778957-156778979 TGCTGCTGCCGCCGCCGCCGCGG - Exonic
1018207086 6:161445938-161445960 TGCTGCTGCCCTCTCTGCTCTGG - Intronic
1018936882 6:168279556-168279578 TGGTGTTGCCACAGCCGCCCAGG + Intergenic
1019488114 7:1298806-1298828 CGCTGGTGCCCTGGCCGCCTTGG + Intergenic
1019540841 7:1550333-1550355 TGATGGCGCCCTCGCCTCCCAGG + Exonic
1026028046 7:66762892-66762914 TGCTGTGGCCCTTGCTGTCCAGG - Intronic
1029488721 7:100858798-100858820 TGCTGATGCACTCTCCTCCCTGG + Intronic
1030063135 7:105639062-105639084 AGCTGTTCCCCTGGCCACCCCGG + Intronic
1032085892 7:128883855-128883877 TGGTGCAGCCCTCGCCGGCCAGG + Intronic
1036588859 8:10149448-10149470 TCCTGCTGCCCTCCCTGCCCAGG + Intronic
1036702473 8:11022252-11022274 TGCTGTTGCCTTAGCATCCCTGG + Intronic
1039425394 8:37481118-37481140 TACTGTTGCCCAAGCAGCCCAGG + Intergenic
1040835186 8:51723690-51723712 TGCTGGTGCTCCCGCAGCCCAGG - Intronic
1044719220 8:95129652-95129674 TGCTGTGGCGCTCACTGCCCTGG - Intergenic
1049060243 8:140270888-140270910 TGCTGTCGCCCTGGCCCCCGCGG - Intronic
1057221872 9:93261840-93261862 TGCTGTGGACGTCGCCGCTCAGG + Exonic
1057851301 9:98568709-98568731 TGCTGTTGCCATGGCCACCATGG + Intronic
1060945806 9:127568913-127568935 CGCTGTTGCCCGCGCTGCTCAGG + Exonic
1061123156 9:128656611-128656633 TGCAGCGGCCCTGGCCGCCCCGG + Exonic
1061534777 9:131240751-131240773 CGCTGATGCCCTTGCCACCCAGG - Intergenic
1061651649 9:132055067-132055089 TGCTGTCCCCCTCACTGCCCTGG + Intronic
1062718747 9:138023853-138023875 CGCTGGGGCCCGCGCCGCCCCGG - Intronic
1203364157 Un_KI270442v1:243063-243085 TTCGGTTTCCCACGCCGCCCTGG - Intergenic
1196741289 X:119028431-119028453 TTCAGTGGCCCTCGCCGCCGCGG + Intergenic