ID: 1167110337

View in Genome Browser
Species Human (GRCh38)
Location 19:47457004-47457026
Sequence CTCGCCGCCCTGGCACGTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167110333_1167110337 -1 Left 1167110333 19:47456982-47457004 CCACGTAGAAGGTGCTGTTGCCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1167110337 19:47457004-47457026 CTCGCCGCCCTGGCACGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1167110331_1167110337 14 Left 1167110331 19:47456967-47456989 CCTCAGTGCGGTAGTCCACGTAG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1167110337 19:47457004-47457026 CTCGCCGCCCTGGCACGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1167110328_1167110337 29 Left 1167110328 19:47456952-47456974 CCTTGGCAGAGCCGTCCTCAGTG 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1167110337 19:47457004-47457026 CTCGCCGCCCTGGCACGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 55
1167110330_1167110337 18 Left 1167110330 19:47456963-47456985 CCGTCCTCAGTGCGGTAGTCCAC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1167110337 19:47457004-47457026 CTCGCCGCCCTGGCACGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167110337 Original CRISPR CTCGCCGCCCTGGCACGTGA CGG Exonic
903742619 1:25567014-25567036 CAAGCGGCCCTGACACGTGATGG + Exonic
905441471 1:37999047-37999069 CTCACTGTCCTGGCAGGTGAAGG + Exonic
1063450702 10:6148150-6148172 CTCCCCTCCCTGGCACTTGCTGG - Intronic
1065690126 10:28324214-28324236 CTGGCCCCTCTGCCACGTGAGGG + Intronic
1067077347 10:43195732-43195754 CTCGCAGCCCAGGCTCCTGAGGG + Exonic
1067582188 10:47452773-47452795 CTCTCCGCCCTGGCCGGTGGGGG - Intergenic
1070437574 10:76408544-76408566 ATCTCTGCCCTGGCACCTGAAGG - Intronic
1075930270 10:126289314-126289336 CTCCCCGCCTTGGCATCTGATGG - Intronic
1076809319 10:132878492-132878514 CTCGCGGCCCTGACACCTGGGGG + Intronic
1085284246 11:75349871-75349893 CTCCCCTCCCTGGCCCATGAGGG + Intronic
1092192905 12:6533522-6533544 CTCCCCGCCCTGGGACGTGCAGG - Intergenic
1098140146 12:67442907-67442929 TTCTCCCCCCTGGCACTTGAGGG - Intergenic
1104066950 12:125314065-125314087 CACGCCGCCCAGGCAGGTGCTGG - Intronic
1104931022 12:132339537-132339559 CTCCCTGCCCTGCGACGTGAGGG - Intergenic
1108340662 13:49496013-49496035 GTCGCCGCCCCGGCCCGAGAGGG + Exonic
1113112556 13:106839366-106839388 CTGTCTGACCTGGCACGTGATGG + Intergenic
1116973729 14:51094424-51094446 CTCGCAGAGCTGGCACTTGAGGG + Exonic
1118324211 14:64770519-64770541 CTCCCAGCCCTGGGATGTGAGGG - Intronic
1118732547 14:68678600-68678622 CTCCCTGCCCTGGCAGCTGAGGG + Intronic
1120624431 14:86807220-86807242 GTCGAGGCCCTGGCAGGTGAGGG + Intergenic
1121156236 14:91687448-91687470 CTTGCCCCTCTGCCACGTGAGGG + Intronic
1139451389 16:67030009-67030031 CTCGCCGCGGTGGCGCGTGTCGG + Intronic
1152574280 17:81133282-81133304 CCCGCTGGCCTGGCAGGTGACGG - Intronic
1152645012 17:81464829-81464851 CTCGCCGCCCTGGCACACTCGGG + Exonic
1161270686 19:3387834-3387856 CTCTCCGACCTGCCACGTGCTGG + Intronic
1161574480 19:5048094-5048116 GTCTCCGCCCTGGCACGTCTGGG + Intronic
1167110337 19:47457004-47457026 CTCGCCGCCCTGGCACGTGACGG + Exonic
1168176569 19:54631566-54631588 CTGGCCCCCCTGACACCTGAGGG - Exonic
1168335175 19:55593239-55593261 CTCGCAGCGCGGGCACTTGAAGG + Exonic
929774206 2:44918095-44918117 CTTGCCACCCTGTCACGTGGAGG + Intergenic
932599474 2:73113441-73113463 ATTGCCGCCCCGCCACGTGACGG + Intronic
941830768 2:169956381-169956403 CTCGACAACCTGGCACGGGAGGG - Intronic
946193071 2:218017621-218017643 CTCCTGGCCCTGGCACGTGTGGG + Intergenic
948178535 2:235962286-235962308 CTCCCAGCCCTGGCCCATGACGG + Intronic
1176129676 20:63491405-63491427 CTCACAGCCCTGGGAGGTGAGGG - Intronic
1181808631 22:25390443-25390465 CTGCCCGCCCTAGCAGGTGAGGG - Intronic
1184768502 22:46584974-46584996 CTTGCCACCCTGGCAGGGGACGG + Intronic
964409582 3:156383863-156383885 CTCGCAGCTCTGCCACTTGACGG + Intronic
969579135 4:8053843-8053865 CTCCCCGTCCTGCCACGGGACGG + Intronic
977990825 4:103439856-103439878 CTCTCCTGCCTGGCACCTGAGGG - Intergenic
985930278 5:3051644-3051666 CATGCCCACCTGGCACGTGACGG - Intergenic
997641745 5:135452923-135452945 CTGGCTGCCCTGGAATGTGAAGG + Intergenic
999530626 5:152459285-152459307 TTTGCCACCCTGGCAAGTGAGGG + Intergenic
1002633968 5:180598144-180598166 CTCCCAGCCCTGGCACGTGGAGG - Intergenic
1006321805 6:33323513-33323535 CGCGCCGCCCTTGCAGGGGAAGG - Intronic
1006840148 6:37023191-37023213 CTCAGCACCCTGGCACCTGATGG + Intronic
1017776419 6:157684471-157684493 GTCTCCTCCCTGGCAGGTGACGG - Intergenic
1024022684 7:45386200-45386222 CTCCCAGCACTGCCACGTGAGGG - Intergenic
1026771828 7:73206985-73207007 CTCCCCGCGCTGGCACCTCAGGG - Intergenic
1027012696 7:74760381-74760403 CTCCCCGCGCTGGCACCTCAGGG - Intronic
1027075344 7:75185672-75185694 CTCCCCGCGCTGGCACCTCAGGG + Intergenic
1044707458 8:95022872-95022894 CTAGCTGCCATGACACGTGAGGG - Intronic
1049328912 8:142039286-142039308 TGCGCCACCCTGGCATGTGAGGG - Intergenic
1049409169 8:142464833-142464855 CTCGCCGCCCAGGCAGGCGCAGG - Exonic
1054747270 9:68867263-68867285 CACGCCACCCTGGCAGGTGCCGG + Intronic
1189576944 X:42364137-42364159 CCCTTCACCCTGGCACGTGATGG + Intergenic
1196824278 X:119728670-119728692 CTCGCTGCCCTGCCACCTGGCGG - Intergenic
1198546148 X:137694871-137694893 CTAGCCGCGCTGGCAGGGGAGGG - Intergenic