ID: 1167110341

View in Genome Browser
Species Human (GRCh38)
Location 19:47457016-47457038
Sequence GCACGTGACGGACAGCAGCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167110333_1167110341 11 Left 1167110333 19:47456982-47457004 CCACGTAGAAGGTGCTGTTGCCC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1167110341 19:47457016-47457038 GCACGTGACGGACAGCAGCACGG 0: 1
1: 0
2: 0
3: 8
4: 92
1167110330_1167110341 30 Left 1167110330 19:47456963-47456985 CCGTCCTCAGTGCGGTAGTCCAC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1167110341 19:47457016-47457038 GCACGTGACGGACAGCAGCACGG 0: 1
1: 0
2: 0
3: 8
4: 92
1167110335_1167110341 -9 Left 1167110335 19:47457002-47457024 CCCTCGCCGCCCTGGCACGTGAC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1167110341 19:47457016-47457038 GCACGTGACGGACAGCAGCACGG 0: 1
1: 0
2: 0
3: 8
4: 92
1167110336_1167110341 -10 Left 1167110336 19:47457003-47457025 CCTCGCCGCCCTGGCACGTGACG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1167110341 19:47457016-47457038 GCACGTGACGGACAGCAGCACGG 0: 1
1: 0
2: 0
3: 8
4: 92
1167110331_1167110341 26 Left 1167110331 19:47456967-47456989 CCTCAGTGCGGTAGTCCACGTAG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1167110341 19:47457016-47457038 GCACGTGACGGACAGCAGCACGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167110341 Original CRISPR GCACGTGACGGACAGCAGCA CGG Exonic
902363756 1:15957465-15957487 GCATGAGAATGACAGCAGCAGGG + Intronic
920075061 1:203330145-203330167 GCAGGTGAAGGGCAGCATCAAGG - Intergenic
922867376 1:228871739-228871761 GCAGTGGACGGACAGCAGCTGGG + Intergenic
1065613971 10:27501258-27501280 GCATGTTACTGACAGCAACATGG + Intergenic
1067037102 10:42928584-42928606 GCACCTGAAGGCAAGCAGCATGG - Intergenic
1069625392 10:69864814-69864836 GTGCGTGACAGACATCAGCAGGG + Intronic
1070160712 10:73865284-73865306 GCAGGTGATGGGCAGCAACAGGG + Intronic
1070505890 10:77112379-77112401 GCACGTGGCTGACTGCAGCCGGG - Exonic
1073077685 10:100835001-100835023 GCACATGGCCAACAGCAGCAGGG + Intergenic
1073379363 10:103066222-103066244 GCCCGTGACTGAGAGCAGCAGGG - Intronic
1077096349 11:800733-800755 GCACGGGCCGGAGGGCAGCAGGG - Intronic
1078022267 11:7665767-7665789 ACAGCTGACAGACAGCAGCAGGG - Intronic
1079195435 11:18322540-18322562 GCACGTGACCGGAAGTAGCAAGG - Intronic
1084682682 11:70676112-70676134 TCACGTGAGGGACAGCATTAAGG - Intronic
1086600581 11:88628666-88628688 GCTCCTGATGGACAGCAGCAGGG - Intronic
1089460462 11:118650172-118650194 GCACGTGGTGCTCAGCAGCAAGG + Exonic
1091769104 12:3139891-3139913 GCCCCTGACGGTCAGCTGCAGGG - Intronic
1091784202 12:3232461-3232483 GCAGGAGACGGAAAGCATCAGGG - Intronic
1092418872 12:8313491-8313513 GCAAGTGACGGATAGGAGCCAGG - Intergenic
1094822091 12:34233860-34233882 GCATGTGCAGGAGAGCAGCAAGG + Intergenic
1095950487 12:47779222-47779244 GCATGGGAGGGACAGCAGCGGGG + Intronic
1096543662 12:52322558-52322580 GGAGGTGAGGGACATCAGCAGGG + Intergenic
1102783410 12:115584824-115584846 GCCAGTGACTGACAACAGCAGGG + Intergenic
1104109077 12:125688846-125688868 GCATGTGAGGACCAGCAGCAAGG + Intergenic
1105038206 12:132941766-132941788 GCGCGTGACGGAGGGCAGCCCGG - Intronic
1108579371 13:51815586-51815608 GCACGTGGCTGAGAGAAGCACGG + Intergenic
1113815623 13:113168522-113168544 ACATGTGAGGAACAGCAGCAGGG - Intronic
1116769975 14:49116275-49116297 ACACGCTACGGCCAGCAGCATGG + Intergenic
1121016730 14:90553453-90553475 GCCCATGAGGGACAGCAGCAGGG - Intronic
1121669225 14:95695210-95695232 GCAGGTGAAGGACAGCACCCAGG - Intergenic
1128338190 15:66802088-66802110 GCAACTGACAGAGAGCAGCAGGG - Intergenic
1132367925 15:101271076-101271098 GCTCTTGATGGACGGCAGCAAGG + Exonic
1143265348 17:5632693-5632715 GCAGGTGAAGGACGGCAGCAGGG + Intergenic
1146876293 17:36414720-36414742 GCACCTGACAAAAAGCAGCAAGG - Intronic
1147063090 17:37898153-37898175 GCACCTGACAAAAAGCAGCAAGG + Intergenic
1148637390 17:49159168-49159190 GCACGTGACATACACCAGCACGG + Exonic
1150477691 17:65487427-65487449 CCACGTGAGGCACAGCCGCAAGG - Intergenic
1152224141 17:79084957-79084979 CCACGCCACGGCCAGCAGCAAGG - Intronic
1152431736 17:80252046-80252068 GTACGGGAGGGACAGGAGCAGGG + Intronic
1159042093 18:63333916-63333938 TGACGTGAGGGACAGAAGCAGGG + Intronic
1162997335 19:14344518-14344540 GCACGTGACAGAGACCAGCCTGG + Intergenic
1163368569 19:16889512-16889534 GCAGGTGACGAGAAGCAGCAGGG - Intronic
1167110341 19:47457016-47457038 GCACGTGACGGACAGCAGCACGG + Exonic
1167220688 19:48196435-48196457 GCAGGTGACGGCCTGCAGGAAGG + Intronic
926240214 2:11079648-11079670 ACACGGGAGTGACAGCAGCAGGG + Intergenic
927758211 2:25725776-25725798 TCACGTGGCGGAAAGCAGAAGGG + Intergenic
932613384 2:73216196-73216218 GCACTAGCCGGATAGCAGCATGG + Intronic
933153557 2:78945298-78945320 TCAGGAGACGGACAGCAGCTTGG - Intergenic
933999392 2:87694625-87694647 GAAGGAGTCGGACAGCAGCAGGG + Intergenic
935838534 2:107081660-107081682 AAACGTGACGGTCAGAAGCAGGG + Intergenic
938538460 2:132265468-132265490 CCACGTCCCGGACACCAGCAGGG - Intergenic
942286367 2:174421492-174421514 GCCAGTGACTGAGAGCAGCAGGG + Intronic
943671149 2:190662504-190662526 GCACCTGCCGAACACCAGCAAGG - Intronic
946950122 2:224864982-224865004 GCATCTGTCTGACAGCAGCATGG + Exonic
947840455 2:233204392-233204414 GCACGTGAAGGAGCGCAGCCGGG - Exonic
949032029 2:241801838-241801860 GCACAAGACGGCCAGCAGCACGG + Exonic
1172050027 20:32110110-32110132 GGACGTGACGGGGAGGAGCAAGG - Intronic
1172179397 20:32991948-32991970 GCACGTTGCGCACAGCAGAAAGG + Intronic
1172384391 20:34523440-34523462 GCAGGGGAGGGACAGCAGCTGGG - Intronic
1177571856 21:22897539-22897561 CCAGGTGACTGAAAGCAGCAGGG + Intergenic
1179472505 21:41620866-41620888 GCCAGTGACTGACAGCTGCAAGG - Intergenic
1179478819 21:41665151-41665173 GCGCGTGACAGAGCGCAGCATGG - Intergenic
1183388162 22:37526859-37526881 GAACGAAAGGGACAGCAGCATGG + Intergenic
1185269188 22:49920849-49920871 GCATGCCAGGGACAGCAGCAGGG - Intronic
949591654 3:5500655-5500677 GCAGGCAACGGACACCAGCATGG + Intergenic
950582931 3:13874455-13874477 GCACAGGACGGGCAGCAGTAGGG + Intronic
954015734 3:47688851-47688873 GCACATGAGGGACACTAGCAGGG + Intronic
961318447 3:126056394-126056416 GCACAAGCCGGACAGCAGAATGG + Intronic
971766808 4:30842811-30842833 CCACGAGAGGGACAGCAGCAGGG + Intronic
981291792 4:143084818-143084840 GCATGTGACAGTCACCAGCAGGG + Intergenic
988831176 5:34988679-34988701 GCAAGAGACAGACAGCAGGATGG + Intergenic
989043256 5:37249864-37249886 TCTCGTGACTGACAGGAGCAGGG + Intergenic
991655330 5:68898496-68898518 GAACCTGAGGGACAGAAGCAGGG - Intergenic
1000088994 5:157913489-157913511 CCATCTGAAGGACAGCAGCAGGG - Intergenic
1002414588 5:179112999-179113021 GCAGGTGGAGGACAGCTGCACGG + Exonic
1003249498 6:4413591-4413613 GCACATGACAGCCAGAAGCAAGG - Intergenic
1019524328 7:1473988-1474010 GCACGTGAGGGGCAGCAGGCAGG + Intronic
1019613368 7:1947986-1948008 ACTGGTCACGGACAGCAGCATGG - Intronic
1019900950 7:4020249-4020271 GCACGTGGCAGGCAGCAGGAAGG + Intronic
1026589560 7:71683173-71683195 GCAGCTGACGGAAAGCAGCCGGG - Intronic
1028148507 7:87345551-87345573 GGACTGGACGGACAGCTGCAAGG - Intergenic
1036609239 8:10335173-10335195 GCAGGTGAAGGACAAAAGCAAGG + Intronic
1036680116 8:10865782-10865804 GGACATCACAGACAGCAGCATGG + Intergenic
1040455499 8:47593836-47593858 GCATGTGAGGAACAGCAACAAGG - Intronic
1043889830 8:85643315-85643337 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043891368 8:85655223-85655245 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043892441 8:85662060-85662082 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043893116 8:85715275-85715297 GCACGTGCGGGACGGCCGCAAGG + Intergenic
1043895803 8:85736729-85736751 GCACGTGCGGGACGGCCGCAAGG + Intergenic
1043896876 8:85745079-85745101 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043900810 8:85775640-85775662 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043902774 8:85790915-85790937 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043904384 8:85803108-85803130 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043905996 8:85815302-85815324 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1043907604 8:85827489-85827511 GCACGTGCGGGACGGCCGCAAGG - Intergenic
1049027517 8:140005381-140005403 GCACATGAAGCACAGCAGCGTGG + Intronic
1049424254 8:142531058-142531080 TCCCCTGACGGGCAGCAGCAGGG + Intronic
1055451248 9:76433255-76433277 CCACGTAACGGAAAGCAGCAGGG + Intronic
1062099232 9:134719583-134719605 GCACGAAGAGGACAGCAGCAAGG + Intronic
1062396499 9:136354944-136354966 GCAGGTGACGGACAGAGGCCTGG + Intronic
1200073848 X:153541738-153541760 ACAGATGACGGACAGCAGGATGG - Exonic